Starting /dee2/code/volunteer_pipeline.sh SRR13259391 current disk space = 3088080883712 free memory = 1449586756 SRR13259391 SRAfilesize 49f7c9f0ccc45a2ea6c890e0822e4bcb SRR13259391.sra SRR13259391.sra file validated SRR13259391 is paired end SRR13259391 is conventional basespace SRR13259391 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.655 37.0 37.0 37.0 37.0 37.0 2 36.6095 37.0 37.0 37.0 37.0 37.0 3 36.6675 37.0 37.0 37.0 37.0 37.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.6875 37.0 37.0 37.0 37.0 37.0 6 36.603 37.0 37.0 37.0 37.0 37.0 7 36.667 37.0 37.0 37.0 37.0 37.0 8 36.7125 37.0 37.0 37.0 37.0 37.0 9 36.677 37.0 37.0 37.0 37.0 37.0 10-14 36.617200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6567 37.0 37.0 37.0 37.0 37.0 20-24 36.5831 37.0 37.0 37.0 37.0 37.0 25-29 36.5502 37.0 37.0 37.0 37.0 37.0 30-34 36.4758 37.0 37.0 37.0 37.0 37.0 35-39 36.447500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.411500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4059 37.0 37.0 37.0 37.0 37.0 50-54 36.4096 37.0 37.0 37.0 37.0 37.0 55-59 36.340399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.306799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.302800000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2864 37.0 37.0 37.0 37.0 37.0 75-79 36.237 37.0 37.0 37.0 37.0 37.0 80-84 36.218399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2197 37.0 37.0 37.0 37.0 37.0 90-94 36.1684 37.0 37.0 37.0 37.0 37.0 95-99 36.1259 37.0 37.0 37.0 37.0 37.0 100-104 36.015100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.03060000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.9951 37.0 37.0 37.0 37.0 37.0 115-119 35.9406 37.0 37.0 37.0 37.0 37.0 120-124 35.904399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.793499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.604 37.0 37.0 37.0 37.0 37.0 135-139 35.67999999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.803700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5433 37.0 37.0 37.0 37.0 37.0 150 35.687 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 2.0 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 9.0 27 7.0 28 6.0 29 16.0 30 28.0 31 31.0 32 49.0 33 77.0 34 91.0 35 306.0 36 3154.0 37 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.125 16.35 18.55 29.975 2 22.575 23.25 35.025 19.15 3 22.225 30.575000000000003 26.75 20.45 4 23.925 33.825 20.5 21.75 5 22.125 35.675000000000004 21.575 20.625 6 18.675 37.75 22.875 20.7 7 16.85 16.8 41.75 24.6 8 20.549999999999997 21.275 27.425 30.75 9 20.775 23.05 28.249999999999996 27.925 10-14 21.47 28.37 27.375 22.785 15-19 22.125 27.61 27.450000000000003 22.814999999999998 20-24 21.925 28.904999999999998 26.97 22.2 25-29 21.48 28.53 27.775 22.215 30-34 21.535 27.91 27.875 22.68 35-39 21.93 28.139999999999997 27.13 22.8 40-44 22.02 28.02 27.47 22.49 45-49 22.05 28.26 26.724999999999998 22.965 50-54 21.68 28.139999999999997 27.665 22.515 55-59 22.542254225422543 28.292829282928295 27.097709770977097 22.06720672067207 60-64 22.247224722472247 28.237823782378236 26.912691269126913 22.6022602260226 65-69 21.955 28.285 26.805 22.955000000000002 70-74 21.815 28.985 26.88 22.32 75-79 22.18 28.09 26.765 22.965 80-84 21.715 28.305000000000003 27.325 22.655 85-89 22.03 28.655 27.279999999999998 22.035 90-94 22.235 28.225 27.165 22.375 95-99 22.525000000000002 27.465 27.065 22.945 100-104 22.38 27.445000000000004 27.96 22.215 105-109 22.155 27.650000000000002 28.575 21.62 110-114 22.295 27.85 27.800000000000004 22.055 115-119 22.835 27.685 27.665 21.815 120-124 22.3 27.284999999999997 28.139999999999997 22.275 125-129 22.255 27.55 28.01 22.185 130-134 22.46 27.575 28.04 21.925 135-139 22.675 28.189999999999998 27.450000000000003 21.685 140-144 22.6 27.555000000000003 28.144999999999996 21.7 145-149 22.470000000000002 28.48 27.02 22.03 150 22.650000000000002 27.075 27.224999999999998 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 4.5 27 3.5 28 6.5 29 11.0 30 17.0 31 23.0 32 26.5 33 39.0 34 49.5 35 55.0 36 78.0 37 106.0 38 142.0 39 163.0 40 179.0 41 215.5 42 233.0 43 257.5 44 253.0 45 247.0 46 271.0 47 244.0 48 217.0 49 189.5 50 154.5 51 148.0 52 137.5 53 105.0 54 78.5 55 76.0 56 65.0 57 49.5 58 36.0 59 30.5 60 24.0 61 13.5 62 13.0 63 12.0 64 8.5 65 4.5 66 1.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.25 #Duplication Level Percentage of deduplicated Percentage of total 1 82.7355623100304 68.05 2 13.465045592705167 22.15 3 3.343465045592705 8.25 4 0.3951367781155016 1.3 5 0.060790273556231005 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACGTTCTGGCCTGTTGTCGGGTGGGTAAATCACCAGTACATACCACAG 5 0.125 No Hit CCGACAATGGCACTGCAGGATCTGTATGTGTCGTGTAAAGAAGTGTTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0125 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACAT 10 0.006973645 144.0 1 AAGATTG 10 0.006973645 144.0 5 CACTTGA 10 0.006973645 144.0 9 GCACTTG 10 0.006973645 144.0 8 >>END_MODULE SRR13259391 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.482 37.0 37.0 37.0 37.0 37.0 2 36.465 37.0 37.0 37.0 37.0 37.0 3 36.469 37.0 37.0 37.0 37.0 37.0 4 36.56 37.0 37.0 37.0 37.0 37.0 5 36.628 37.0 37.0 37.0 37.0 37.0 6 36.552 37.0 37.0 37.0 37.0 37.0 7 36.4215 37.0 37.0 37.0 37.0 37.0 8 36.561 37.0 37.0 37.0 37.0 37.0 9 36.5705 37.0 37.0 37.0 37.0 37.0 10-14 36.543600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.50589999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4818 37.0 37.0 37.0 37.0 37.0 25-29 36.500600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4602 37.0 37.0 37.0 37.0 37.0 35-39 36.440000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.352199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.313 37.0 37.0 37.0 37.0 37.0 50-54 36.2487 37.0 37.0 37.0 37.0 37.0 55-59 36.2752 37.0 37.0 37.0 37.0 37.0 60-64 36.13870000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1168 37.0 37.0 37.0 37.0 37.0 70-74 36.161699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.068400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0232 37.0 37.0 37.0 37.0 37.0 85-89 35.84009999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.877500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9042 37.0 37.0 37.0 37.0 37.0 100-104 35.8346 37.0 37.0 37.0 37.0 37.0 105-109 35.8304 37.0 37.0 37.0 37.0 37.0 110-114 35.7242 37.0 37.0 37.0 37.0 37.0 115-119 35.75449999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5884 37.0 37.0 37.0 37.0 37.0 125-129 35.5888 37.0 37.0 37.0 37.0 37.0 130-134 35.4962 37.0 37.0 37.0 37.0 37.0 135-139 35.456399999999995 37.0 37.0 37.0 32.2 37.0 140-144 35.4801 37.0 37.0 37.0 37.0 37.0 145-149 35.3814 37.0 37.0 37.0 32.2 37.0 150 35.435 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 4.0 24 4.0 25 7.0 26 8.0 27 4.0 28 6.0 29 7.0 30 22.0 31 29.0 32 43.0 33 70.0 34 154.0 35 613.0 36 2898.0 37 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.1 17.1 18.025 30.775000000000002 2 22.7 23.125 36.375 17.8 3 22.325 30.0 26.224999999999998 21.45 4 24.375 34.9 20.424999999999997 20.3 5 22.625 36.025 21.349999999999998 20.0 6 16.7 37.0 26.125 20.175 7 16.825000000000003 16.375 42.3 24.5 8 19.15 21.825 28.975 30.049999999999997 9 20.025000000000002 23.549999999999997 28.475 27.950000000000003 10-14 21.834999999999997 28.860000000000003 26.165 23.14 15-19 21.46 27.965 27.185 23.39 20-24 21.505 27.815 27.215 23.465 25-29 22.435 28.37 27.215 21.98 30-34 22.035 28.945 26.889999999999997 22.13 35-39 21.91 28.015 27.639999999999997 22.435 40-44 21.345 28.199999999999996 27.105 23.35 45-49 21.735 27.644999999999996 27.925 22.695 50-54 21.59 28.405 27.04 22.965 55-59 22.45 27.834999999999997 27.045 22.67 60-64 21.015 28.720000000000002 27.084999999999997 23.18 65-69 21.755 27.58 28.055000000000003 22.61 70-74 22.259999999999998 28.125 27.224999999999998 22.39 75-79 21.69 27.87 27.485 22.955000000000002 80-84 21.035 28.050000000000004 27.715 23.200000000000003 85-89 22.03 28.485 27.224999999999998 22.259999999999998 90-94 22.355 27.534999999999997 27.445000000000004 22.665 95-99 22.1 27.74 27.384999999999998 22.775000000000002 100-104 22.095000000000002 27.67 27.555000000000003 22.68 105-109 22.505 27.66 27.650000000000002 22.185 110-114 22.105 27.965 28.28 21.65 115-119 22.115000000000002 27.105 28.26 22.52 120-124 22.165000000000003 28.26 27.765 21.81 125-129 22.495 27.685 27.96 21.86 130-134 22.095000000000002 27.955000000000002 27.495000000000005 22.455 135-139 22.335 27.439999999999998 28.03 22.195 140-144 22.56 28.110000000000003 27.195000000000004 22.134999999999998 145-149 22.14 28.1 27.655 22.105 150 21.224999999999998 27.775 27.55 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 2.0 27 5.0 28 8.5 29 11.0 30 16.0 31 24.5 32 23.5 33 35.0 34 55.5 35 71.5 36 86.5 37 105.5 38 108.5 39 132.5 40 181.0 41 204.5 42 237.0 43 257.5 44 256.5 45 278.5 46 272.5 47 253.0 48 240.0 49 194.0 50 172.5 51 153.5 52 112.5 53 98.5 54 88.0 55 63.0 56 53.5 57 43.5 58 32.0 59 27.5 60 20.0 61 17.0 62 17.5 63 10.0 64 7.0 65 8.0 66 4.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.075 #Duplication Level Percentage of deduplicated Percentage of total 1 82.54645141638744 67.75 2 13.646055437100213 22.400000000000002 3 3.320134023758757 8.175 4 0.39597928723728293 1.3 5 0.09137983551629607 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGCTGGAAGGAAGAAAACACACATCGAGAACTTATCGCACTCGTAAACA 5 0.125 No Hit ACGTTACACGCATATAAATAAGAACTAATGTTGCTGAGTTTATGGTTGCT 5 0.125 No Hit GCCGGGAAGAAATAGTCAAGGCAGCTAAAGAGTGGGGTGTTATGCACCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATCA 35 0.0034045284 61.714283 2 >>END_MODULE Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085986 spots for SRR13259391.sra Written 1085986 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra Read 1085968 spots for SRR13259391.sra Written 1085968 spots for SRR13259391.sra SRR ids: ['SRR13259391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e5iegxrc SRR13259391.sra spots: 21719378 blocks: [[1, 1085968], [1085969, 2171936], [2171937, 3257904], [3257905, 4343872], [4343873, 5429840], [5429841, 6515808], [6515809, 7601776], [7601777, 8687744], [8687745, 9773712], [9773713, 10859680], [10859681, 11945648], [11945649, 13031616], [13031617, 14117584], [14117585, 15203552], [15203553, 16289520], [16289521, 17375488], [17375489, 18461456], [18461457, 19547424], [19547425, 20633392], [20633393, 21719378]] SRR13259391 file size 7317073 SRR13259391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259391 SRR13259391_1.fastq SRR13259391_2.fastq Input file: SRR13259391_1.fastq Paired file: SRR13259391_2.fastq trimmed: SRR13259391-trimmed-pair1.fastq, SRR13259391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:27:32 2025 >> started Fri Feb 14 03:27:56 2025 >> done (23.799s) 21719378 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 87 ( 0.00%) empty read pairs filtered out after trimming by size control 21719291 (100.00%) read pairs available; of these: 6955 ( 0.03%) trimmed read pairs available after processing 21712336 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 1 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 3 0.00% 49 2 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 1 0.00% 69 0 0.00% 70 2 0.00% 71 3 0.00% 72 0 0.00% 73 4 0.00% 74 3 0.00% 75 3 0.00% 76 2 0.00% 77 3 0.00% 78 5 0.00% 79 4 0.00% 80 7 0.00% 81 3 0.00% 82 10 0.00% 83 5 0.00% 84 8 0.00% 85 6 0.00% 86 8 0.00% 87 8 0.00% 88 7 0.00% 89 2 0.00% 90 11 0.00% 91 8 0.00% 92 9 0.00% 93 15 0.00% 94 17 0.00% 95 19 0.00% 96 12 0.00% 97 20 0.00% 98 25 0.00% 99 27 0.00% 100 16 0.00% 101 19 0.00% 102 29 0.00% 103 30 0.00% 104 41 0.00% 105 27 0.00% 106 36 0.00% 107 43 0.00% 108 49 0.00% 109 49 0.00% 110 47 0.00% 111 49 0.00% 112 51 0.00% 113 48 0.00% 114 47 0.00% 115 72 0.00% 116 55 0.00% 117 64 0.00% 118 89 0.00% 119 67 0.00% 120 75 0.00% 121 69 0.00% 122 106 0.00% 123 77 0.00% 124 98 0.00% 125 115 0.00% 126 107 0.00% 127 115 0.00% 128 128 0.00% 129 99 0.00% 130 146 0.00% 131 130 0.00% 132 157 0.00% 133 152 0.00% 134 162 0.00% 135 166 0.00% 136 158 0.00% 137 190 0.00% 138 188 0.00% 139 198 0.00% 140 210 0.00% 141 230 0.00% 142 245 0.00% 143 281 0.00% 144 249 0.00% 145 318 0.00% 146 309 0.00% 147 328 0.00% 148 434 0.00% 149 516 0.00% 150 21712336 99.97% 21719291 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=27 prefix-density=0.38 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=37.60 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=31.39 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.4 sequence=CCTTCCTTGTCCTGGATCTT SRR13259391 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:28:54 Started mapping on | Feb 14 03:28:54 Finished on | Feb 14 03:35:24 Mapping speed, Million of reads per hour | 200.49 Number of input reads | 21719291 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18486912 Uniquely mapped reads % | 85.12% Average mapped length | 298.20 Number of splices: Total | 18155496 Number of splices: Annotated (sjdb) | 17800562 Number of splices: GT/AG | 17864711 Number of splices: GC/AG | 235162 Number of splices: AT/AC | 17145 Number of splices: Non-canonical | 38478 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473151 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 68139 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.28% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2759228 2759228 2759228 N_multimapping 473151 473151 473151 N_noFeature 557668 9461394 9486546 N_ambiguous 195136 49374 49638 UnstrandedReadsAssigned:17734108 PositiveStrandReadsAssigned:8976144 NegativeStrandReadsAssigned:8950728 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259391-trimmed-pair1.fastq SRR13259391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,719,291 reads, 18,126,780 reads pseudoaligned [quant] estimated average fragment length: 242.646 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR13259391.ke.tsv 34699 SRR13259391.se.tsv 87100 total ==> SRR13259391.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.35 2407 59.9325 Potri.005G024800.1.v4.1 1035 793.354 677.044 37.7455 Potri.004G059700.1.v4.1 961 719.377 14 0.86077 Potri.007G009000.2.v4.1 1416 1174.35 0 0 Potri.003G141000.2.v4.1 2943 2701.35 939.25 15.3785 Potri.016G087400.1.v4.1 270 51.4453 1029 884.678 Potri.015G069301.1.v4.1 564 322.534 0 0 Potri.010G195200.1.v4.1 1773 1531.35 948.952 27.4084 Potri.012G127500.1.v4.1 977 735.365 4488 269.939 ==> SRR13259391.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 342 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 734 SRR13259391 completed mapping pipeline successfully