Starting /dee2/code/volunteer_pipeline.sh SRR13259392 current disk space = 3086951993344 free memory = 1582392200 SRR13259392 SRAfilesize bbf276a52350723226d337394c4f680a SRR13259392.sra SRR13259392.sra file validated SRR13259392 is paired end SRR13259392 is conventional basespace SRR13259392 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6465 37.0 37.0 37.0 37.0 37.0 2 36.613 37.0 37.0 37.0 37.0 37.0 3 36.6625 37.0 37.0 37.0 37.0 37.0 4 36.6695 37.0 37.0 37.0 37.0 37.0 5 36.678 37.0 37.0 37.0 37.0 37.0 6 36.4805 37.0 37.0 37.0 37.0 37.0 7 36.6935 37.0 37.0 37.0 37.0 37.0 8 36.649 37.0 37.0 37.0 37.0 37.0 9 36.6705 37.0 37.0 37.0 37.0 37.0 10-14 36.638600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6475 37.0 37.0 37.0 37.0 37.0 20-24 36.6212 37.0 37.0 37.0 37.0 37.0 25-29 36.5477 37.0 37.0 37.0 37.0 37.0 30-34 36.488299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4647 37.0 37.0 37.0 37.0 37.0 40-44 36.4045 37.0 37.0 37.0 37.0 37.0 45-49 36.39040000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.401799999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.342150000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.29175 37.0 37.0 37.0 37.0 37.0 65-69 36.2533 37.0 37.0 37.0 37.0 37.0 70-74 36.271699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.239200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.208299999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.19250000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1524 37.0 37.0 37.0 37.0 37.0 95-99 36.1634 37.0 37.0 37.0 37.0 37.0 100-104 36.0044 37.0 37.0 37.0 37.0 37.0 105-109 36.0219 37.0 37.0 37.0 37.0 37.0 110-114 36.022000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.903000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9393 37.0 37.0 37.0 37.0 37.0 125-129 35.7606 37.0 37.0 37.0 37.0 37.0 130-134 35.6206 37.0 37.0 37.0 37.0 37.0 135-139 35.7447 37.0 37.0 37.0 37.0 37.0 140-144 35.8071 37.0 37.0 37.0 37.0 37.0 145-149 35.6066 37.0 37.0 37.0 37.0 37.0 150 35.4615 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 5.0 23 1.0 24 5.0 25 6.0 26 3.0 27 9.0 28 16.0 29 19.0 30 22.0 31 30.0 32 32.0 33 60.0 34 105.0 35 287.0 36 3181.0 37 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.275 15.7 21.975 34.050000000000004 2 20.3 24.525 36.95 18.224999999999998 3 23.025000000000002 30.7 26.275 20.0 4 24.275 34.599999999999994 20.325 20.8 5 21.975 37.3 21.55 19.175 6 17.025000000000002 38.75 23.625 20.599999999999998 7 17.299999999999997 17.675 42.55 22.475 8 19.5 23.05 28.225 29.225 9 19.7 24.099999999999998 29.9 26.3 10-14 21.815 29.104999999999997 26.755000000000003 22.325 15-19 21.55 27.625 28.084999999999997 22.74 20-24 20.51 29.515 27.744999999999997 22.23 25-29 21.8 28.59 27.644999999999996 21.965 30-34 21.23 28.955 28.035 21.78 35-39 21.555 28.96 27.860000000000003 21.625 40-44 21.38 28.79 27.395000000000003 22.435 45-49 22.095000000000002 28.53 27.245 22.13 50-54 21.595 28.26 27.99 22.155 55-59 21.28606430321516 28.8064403220161 27.2063603180159 22.70113505675284 60-64 21.266063303165158 28.41142057102855 27.83639181959098 22.48612430621531 65-69 21.7 28.685 27.73 21.884999999999998 70-74 21.54 28.575 27.83 22.055 75-79 21.07 28.865000000000002 27.839999999999996 22.225 80-84 21.77 28.335 27.694999999999997 22.2 85-89 21.85 28.189999999999998 28.444999999999997 21.515 90-94 21.765 28.79 27.439999999999998 22.005 95-99 21.67 28.16 28.17 22.0 100-104 22.39 27.384999999999998 27.889999999999997 22.335 105-109 21.78 27.765 27.755000000000003 22.7 110-114 21.634999999999998 28.33 26.97 23.064999999999998 115-119 22.31 28.455000000000002 28.044999999999998 21.19 120-124 22.665 28.215 27.775 21.345 125-129 22.015 28.155 28.035 21.795 130-134 21.47 28.050000000000004 28.035 22.445 135-139 21.57 27.810000000000002 28.134999999999998 22.485 140-144 22.33 28.005000000000003 27.939999999999998 21.725 145-149 21.73 28.13 28.105000000000004 22.035 150 20.275000000000002 27.975 28.925 22.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 0.5 21 1.0 22 3.5 23 3.5 24 1.0 25 1.0 26 4.0 27 4.5 28 5.0 29 13.5 30 17.0 31 19.5 32 30.5 33 46.5 34 59.5 35 61.0 36 86.5 37 120.5 38 144.5 39 180.5 40 204.0 41 234.0 42 257.0 43 272.5 44 288.0 45 281.0 46 271.0 47 244.5 48 208.0 49 182.0 50 171.5 51 145.0 52 109.0 53 90.5 54 63.0 55 44.0 56 36.5 57 21.5 58 12.5 59 10.5 60 9.0 61 9.5 62 9.5 63 5.5 64 2.5 65 1.0 66 2.0 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.325 #Duplication Level Percentage of deduplicated Percentage of total 1 83.3890069845126 68.65 2 13.058001822046766 21.5 3 2.6419678105071362 6.525 4 0.6073489219556636 2.0 5 0.24293956878226544 1.0 6 0.03036744609778318 0.15 7 0.03036744609778318 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAAAGTGACCAGACCAGCAGAGTGGATGGCAATGGAAGAAGAGCTTGA 7 0.17500000000000002 No Hit CGAGGAGTCCTCAAGAGAGGAATACGAGGTTGGAGAATATGTGCTGGAGG 6 0.15 No Hit CAGCAATGCAAATTTATTCAGTTCCTGCAATCTTCTTCTTCAATGATTCA 5 0.125 No Hit CTGGGACTTGTTCTTCTTCTGCTTGCGTCTGCGACGACGACGTTCGTTCA 5 0.125 No Hit CAATGTTGCAAGACAGGGGAAGATCATATTATGGCAGGCCAGAGTACATT 5 0.125 No Hit GCTGAAAACTATCCAGGCCCAGATTACGAATCTTCAATGTTAATGATTCA 5 0.125 No Hit TAGGGACTTCTCTGCAAATGATGCCTTACAACCTGTTTTGAAGCTATTAT 5 0.125 No Hit GCTGTACATGCCACTTTGTAGTGAAGCGCTTGTATGCCCGACCGTCACAG 5 0.125 No Hit CAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCA 5 0.125 No Hit TTGCCTGCTCTGGTTGTTACTTCTGCTCTGGTGACAGTAAGGCTATTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGAG 10 0.006973645 144.0 4 ATGAGCT 10 0.006973645 144.0 6 >>END_MODULE SRR13259392 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.398 37.0 37.0 37.0 37.0 37.0 2 36.3025 37.0 37.0 37.0 37.0 37.0 3 36.3675 37.0 37.0 37.0 37.0 37.0 4 36.4595 37.0 37.0 37.0 37.0 37.0 5 36.5215 37.0 37.0 37.0 37.0 37.0 6 36.44 37.0 37.0 37.0 37.0 37.0 7 36.4455 37.0 37.0 37.0 37.0 37.0 8 36.594 37.0 37.0 37.0 37.0 37.0 9 36.5935 37.0 37.0 37.0 37.0 37.0 10-14 36.486 37.0 37.0 37.0 37.0 37.0 15-19 36.4875 37.0 37.0 37.0 37.0 37.0 20-24 36.4386 37.0 37.0 37.0 37.0 37.0 25-29 36.4054 37.0 37.0 37.0 37.0 37.0 30-34 36.3312 37.0 37.0 37.0 37.0 37.0 35-39 36.3975 37.0 37.0 37.0 37.0 37.0 40-44 36.3024 37.0 37.0 37.0 37.0 37.0 45-49 36.2393 37.0 37.0 37.0 37.0 37.0 50-54 36.2331 37.0 37.0 37.0 37.0 37.0 55-59 36.1923 37.0 37.0 37.0 37.0 37.0 60-64 36.109500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0893 37.0 37.0 37.0 37.0 37.0 70-74 36.0865 37.0 37.0 37.0 37.0 37.0 75-79 36.001400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9981 37.0 37.0 37.0 37.0 37.0 85-89 35.850699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9113 37.0 37.0 37.0 37.0 37.0 95-99 35.8282 37.0 37.0 37.0 37.0 37.0 100-104 35.84740000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.772 37.0 37.0 37.0 37.0 37.0 110-114 35.6914 37.0 37.0 37.0 37.0 37.0 115-119 35.673899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.4226 37.0 37.0 37.0 37.0 37.0 125-129 35.5407 37.0 37.0 37.0 34.6 37.0 130-134 35.399100000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.3154 37.0 37.0 37.0 29.8 37.0 140-144 35.4416 37.0 37.0 37.0 34.6 37.0 145-149 35.2875 37.0 37.0 37.0 29.8 37.0 150 35.356 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 3.0 23 4.0 24 3.0 25 2.0 26 10.0 27 6.0 28 6.0 29 14.0 30 20.0 31 31.0 32 35.0 33 67.0 34 162.0 35 780.0 36 2751.0 37 104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.175 16.825000000000003 23.674999999999997 32.324999999999996 2 21.05 25.174999999999997 33.975 19.8 3 24.025 29.175 26.174999999999997 20.625 4 25.324999999999996 34.5 19.35 20.825 5 22.725 36.625 21.675 18.975 6 18.275 36.8 23.875 21.05 7 16.525000000000002 18.65 43.725 21.099999999999998 8 19.475 20.9 29.125 30.5 9 21.15 22.95 28.549999999999997 27.35 10-14 20.91 28.975 27.474999999999998 22.64 15-19 21.83 26.69 28.660000000000004 22.82 20-24 21.545 28.71 27.665 22.08 25-29 21.13 29.235 27.700000000000003 21.935 30-34 21.65 28.525 27.565 22.259999999999998 35-39 21.725 28.16 27.905 22.21 40-44 21.224999999999998 28.799999999999997 28.215 21.759999999999998 45-49 21.52 29.015 27.529999999999998 21.935 50-54 21.33 28.249999999999996 28.02 22.400000000000002 55-59 21.64 27.860000000000003 27.965 22.535 60-64 21.365000000000002 27.205000000000002 28.65 22.78 65-69 21.759999999999998 27.855 27.55 22.835 70-74 22.045 28.46 27.58 21.915000000000003 75-79 22.37 28.09 27.375 22.165000000000003 80-84 21.425 28.04 27.405 23.13 85-89 21.7 28.384999999999998 27.994999999999997 21.92 90-94 22.134999999999998 27.500000000000004 28.175 22.189999999999998 95-99 21.72 28.065 28.27 21.945 100-104 22.245 27.705000000000002 27.900000000000002 22.15 105-109 21.81 27.625 28.845 21.72 110-114 22.31 27.755000000000003 28.515 21.42 115-119 22.66 28.115000000000002 27.955000000000002 21.27 120-124 22.38 28.194999999999997 27.365000000000002 22.06 125-129 22.34 28.705000000000002 27.32 21.634999999999998 130-134 23.03 27.284999999999997 28.335 21.349999999999998 135-139 21.884999999999998 28.38 28.46 21.275 140-144 21.675 28.410000000000004 28.415000000000003 21.5 145-149 22.33 27.815 28.144999999999996 21.709999999999997 150 22.725 27.85 27.0 22.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 5.5 27 9.5 28 6.0 29 10.0 30 22.0 31 23.5 32 27.0 33 36.5 34 50.0 35 76.5 36 100.5 37 116.0 38 130.0 39 145.5 40 184.0 41 224.0 42 257.0 43 284.5 44 281.0 45 267.0 46 251.5 47 254.0 48 246.5 49 194.5 50 159.5 51 141.5 52 119.0 53 88.0 54 68.5 55 64.5 56 44.5 57 27.5 58 19.0 59 14.5 60 10.5 61 6.0 62 5.0 63 4.0 64 2.5 65 2.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.5254854368932 68.825 2 12.864077669902912 21.2 3 2.7002427184466016 6.675000000000001 4 0.6371359223300971 2.1 5 0.21237864077669902 0.8750000000000001 6 0.030339805825242715 0.15 7 0.030339805825242715 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCCCTCCTCCAGGTTTTCTCTCTATCTCAGTTCTCGCATCTCCCCTTCT 7 0.17500000000000002 No Hit CTAGGCAGTCTGCCCCGGACGCTATCACCGTGGGCTGATAGATCTCCAAC 6 0.15 No Hit GAGATACTCAAGTTGTTGAAGCCAATATTTGATGCCATTGTTGATTCTGA 5 0.125 No Hit CTGTTCTAAGTGTTCTTCTCGAGTTCAAGAACCTCACCAAAAAATCATGA 5 0.125 No Hit CCCGAAGCGCCATCATGCTATCAATTTCAGAATCACTCACTGTAAGAGGT 5 0.125 No Hit GCAACATTGACACCATAACTCTTAGGGCAGGCACCAGGTCTCAACCTATA 5 0.125 No Hit AAGCATATTGATGGGTCCCCTGTAAAATCAGAGGCTGAGAGACAAAGGAT 5 0.125 No Hit ATCGTTGAATCCCCTCAATGTGTTTCTCCAACACATTCTCCTCAGGAATT 5 0.125 No Hit GTAATTATCTATGGAGGAGGGGCAGTAGTTGCTGTTTGGCTATCATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279339 spots for SRR13259392.sra Written 1279339 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra Read 1279337 spots for SRR13259392.sra Written 1279337 spots for SRR13259392.sra SRR ids: ['SRR13259392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gbfu85ib SRR13259392.sra spots: 25586742 blocks: [[1, 1279337], [1279338, 2558674], [2558675, 3838011], [3838012, 5117348], [5117349, 6396685], [6396686, 7676022], [7676023, 8955359], [8955360, 10234696], [10234697, 11514033], [11514034, 12793370], [12793371, 14072707], [14072708, 15352044], [15352045, 16631381], [16631382, 17910718], [17910719, 19190055], [19190056, 20469392], [20469393, 21748729], [21748730, 23028066], [23028067, 24307403], [24307404, 25586742]] SRR13259392 file size 8623819 SRR13259392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259392 SRR13259392_1.fastq SRR13259392_2.fastq Input file: SRR13259392_1.fastq Paired file: SRR13259392_2.fastq trimmed: SRR13259392-trimmed-pair1.fastq, SRR13259392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:50:47 2025 >> started Fri Feb 14 04:51:27 2025 >> done (40.541s) 25586742 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 102 ( 0.00%) empty read pairs filtered out after trimming by size control 25586640 (100.00%) read pairs available; of these: 8145 ( 0.03%) trimmed read pairs available after processing 25578495 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 2 0.00% 42 1 0.00% 43 2 0.00% 44 0 0.00% 45 2 0.00% 46 1 0.00% 47 3 0.00% 48 1 0.00% 49 1 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 1 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 1 0.00% 69 2 0.00% 70 3 0.00% 71 1 0.00% 72 3 0.00% 73 3 0.00% 74 8 0.00% 75 3 0.00% 76 5 0.00% 77 7 0.00% 78 5 0.00% 79 2 0.00% 80 7 0.00% 81 4 0.00% 82 6 0.00% 83 5 0.00% 84 5 0.00% 85 8 0.00% 86 11 0.00% 87 8 0.00% 88 13 0.00% 89 11 0.00% 90 13 0.00% 91 14 0.00% 92 19 0.00% 93 13 0.00% 94 11 0.00% 95 17 0.00% 96 23 0.00% 97 17 0.00% 98 18 0.00% 99 26 0.00% 100 23 0.00% 101 25 0.00% 102 35 0.00% 103 42 0.00% 104 35 0.00% 105 36 0.00% 106 36 0.00% 107 45 0.00% 108 49 0.00% 109 57 0.00% 110 62 0.00% 111 53 0.00% 112 80 0.00% 113 57 0.00% 114 66 0.00% 115 67 0.00% 116 75 0.00% 117 80 0.00% 118 76 0.00% 119 94 0.00% 120 131 0.00% 121 97 0.00% 122 114 0.00% 123 122 0.00% 124 120 0.00% 125 121 0.00% 126 128 0.00% 127 140 0.00% 128 167 0.00% 129 145 0.00% 130 151 0.00% 131 173 0.00% 132 177 0.00% 133 170 0.00% 134 180 0.00% 135 196 0.00% 136 211 0.00% 137 249 0.00% 138 231 0.00% 139 223 0.00% 140 241 0.00% 141 244 0.00% 142 274 0.00% 143 282 0.00% 144 303 0.00% 145 354 0.00% 146 390 0.00% 147 360 0.00% 148 486 0.00% 149 558 0.00% 150 25578495 99.97% 25586640 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=23 prefix-density=0.58 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=37 fanout-score=16.68 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=2.3 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=24 prefix-density=0.57 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=65.17 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.0 sequence=AAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAA SRR13259392 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:52:10 Started mapping on | Feb 14 04:52:10 Finished on | Feb 14 04:54:37 Mapping speed, Million of reads per hour | 626.61 Number of input reads | 25586640 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24264814 Uniquely mapped reads % | 94.83% Average mapped length | 298.31 Number of splices: Total | 24191052 Number of splices: Annotated (sjdb) | 23728059 Number of splices: GT/AG | 23802538 Number of splices: GC/AG | 317832 Number of splices: AT/AC | 20230 Number of splices: Non-canonical | 50452 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 698704 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 92874 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 623122 623122 623122 N_multimapping 698704 698704 698704 N_noFeature 652582 12362684 12426898 N_ambiguous 260628 66889 66601 UnstrandedReadsAssigned:23351604 PositiveStrandReadsAssigned:11835241 NegativeStrandReadsAssigned:11771315 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259392-trimmed-pair1.fastq SRR13259392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,586,640 reads, 23,812,016 reads pseudoaligned [quant] estimated average fragment length: 247.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR13259392.ke.tsv 34699 SRR13259392.se.tsv 87100 total ==> SRR13259392.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.91 4279 81.1261 Potri.005G024800.1.v4.1 1035 788.909 891 37.9411 Potri.004G059700.1.v4.1 961 714.928 40 1.87956 Potri.007G009000.2.v4.1 1416 1169.91 0 0 Potri.003G141000.2.v4.1 2943 2696.91 1360.32 16.9447 Potri.016G087400.1.v4.1 270 50.3008 1477 986.427 Potri.015G069301.1.v4.1 564 318.049 0 0 Potri.010G195200.1.v4.1 1773 1526.91 1154.75 25.4059 Potri.012G127500.1.v4.1 977 730.928 5533 254.299 ==> SRR13259392.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 469 SRR13259392 completed mapping pipeline successfully