Starting /dee2/code/volunteer_pipeline.sh SRR13259393 current disk space = 3087615725568 free memory = 1449488264 SRR13259393 SRAfilesize c5c95f804335a2c38fb98fbdfdb241d7 SRR13259393.sra SRR13259393.sra file validated SRR13259393 is paired end SRR13259393 is conventional basespace SRR13259393 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6965 37.0 37.0 37.0 37.0 37.0 2 36.522 37.0 37.0 37.0 37.0 37.0 3 36.6435 37.0 37.0 37.0 37.0 37.0 4 36.696 37.0 37.0 37.0 37.0 37.0 5 36.6925 37.0 37.0 37.0 37.0 37.0 6 36.6025 37.0 37.0 37.0 37.0 37.0 7 36.568 37.0 37.0 37.0 37.0 37.0 8 36.598 37.0 37.0 37.0 37.0 37.0 9 36.6125 37.0 37.0 37.0 37.0 37.0 10-14 36.6398 37.0 37.0 37.0 37.0 37.0 15-19 36.6102 37.0 37.0 37.0 37.0 37.0 20-24 36.5733 37.0 37.0 37.0 37.0 37.0 25-29 36.517900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4765 37.0 37.0 37.0 37.0 37.0 35-39 36.4394 37.0 37.0 37.0 37.0 37.0 40-44 36.4096 37.0 37.0 37.0 37.0 37.0 45-49 36.382999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.366200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.29805 37.0 37.0 37.0 37.0 37.0 60-64 36.276650000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2045 37.0 37.0 37.0 37.0 37.0 70-74 36.20889999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.16590000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.142100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.153600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.08200000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.137499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.99380000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.922900000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0164 37.0 37.0 37.0 37.0 37.0 115-119 35.9127 37.0 37.0 37.0 37.0 37.0 120-124 35.9129 37.0 37.0 37.0 37.0 37.0 125-129 35.7177 37.0 37.0 37.0 37.0 37.0 130-134 35.616 37.0 37.0 37.0 37.0 37.0 135-139 35.6695 37.0 37.0 37.0 37.0 37.0 140-144 35.7568 37.0 37.0 37.0 37.0 37.0 145-149 35.4962 37.0 37.0 37.0 34.6 37.0 150 35.565 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 2.0 21 5.0 22 3.0 23 1.0 24 3.0 25 1.0 26 8.0 27 9.0 28 14.0 29 15.0 30 25.0 31 31.0 32 46.0 33 73.0 34 104.0 35 305.0 36 3147.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.9 16.0 21.85 33.25 2 21.3 25.1 36.025 17.575 3 22.0 29.775000000000002 26.85 21.375 4 23.75 35.55 21.525 19.175 5 24.15 35.075 22.375 18.4 6 18.8 38.2 22.525000000000002 20.474999999999998 7 18.2 16.825000000000003 41.949999999999996 23.025000000000002 8 19.5 22.025 28.65 29.825000000000003 9 20.0 23.025000000000002 30.55 26.424999999999997 10-14 20.880000000000003 29.035 26.905 23.18 15-19 21.485000000000003 28.38 27.37 22.765 20-24 21.645 28.315 27.775 22.264999999999997 25-29 21.565 28.7 27.794999999999998 21.94 30-34 21.075 29.099999999999998 27.71 22.115000000000002 35-39 21.555 28.92 27.165 22.36 40-44 21.57 29.13 27.47 21.83 45-49 21.51 28.660000000000004 27.384999999999998 22.445 50-54 21.57 28.74 27.825 21.865000000000002 55-59 22.08331249687453 27.799169875481322 28.15422313347002 21.963294494174125 60-64 21.568235235285293 28.229234385157774 28.019202880432065 22.183327499124868 65-69 21.875 28.465 27.450000000000003 22.21 70-74 21.875 28.050000000000004 27.775 22.3 75-79 21.965 27.855 27.93 22.25 80-84 22.055 28.060000000000002 27.515 22.37 85-89 21.735 29.205 27.13 21.93 90-94 21.365000000000002 28.375 27.965 22.295 95-99 22.545 28.54 27.215 21.7 100-104 21.78 27.96 27.775 22.485 105-109 22.11 28.315 27.63 21.945 110-114 21.43 28.115000000000002 28.660000000000004 21.795 115-119 21.93 28.134999999999998 28.050000000000004 21.884999999999998 120-124 22.335 27.87 28.13 21.665 125-129 21.94 28.22 27.865000000000002 21.975 130-134 22.040000000000003 27.389999999999997 28.74 21.83 135-139 22.16 27.560000000000002 27.915 22.365 140-144 22.155 28.04 28.000000000000004 21.805 145-149 22.15 27.950000000000003 27.860000000000003 22.040000000000003 150 21.55 26.85 29.225 22.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 2.0 26 5.0 27 8.5 28 9.0 29 14.5 30 26.5 31 33.0 32 34.0 33 41.0 34 52.0 35 76.5 36 98.5 37 100.0 38 136.5 39 193.0 40 204.0 41 206.0 42 223.5 43 256.0 44 282.5 45 268.0 46 250.5 47 237.5 48 225.5 49 201.0 50 154.5 51 134.5 52 116.5 53 92.5 54 77.5 55 64.0 56 56.0 57 37.5 58 23.5 59 14.5 60 7.5 61 7.0 62 5.5 63 6.5 64 4.5 65 1.5 66 2.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.015 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 85.58030480656507 73.0 2 12.104337631887455 20.65 3 1.875732708089097 4.8 4 0.3810082063305979 1.3 5 0.058616647127784284 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTCGTTGCCAAACTGGGGATTGCACCGGTGGCCTAGAGTGCAAGGGC 5 0.125 No Hit GAGTGAATAAACTGATTCTAAGAAGTGATTGATACTAGTGGGGTGGGGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259393 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.287 37.0 37.0 37.0 37.0 37.0 2 36.097 37.0 37.0 37.0 37.0 37.0 3 36.169 37.0 37.0 37.0 37.0 37.0 4 36.1515 37.0 37.0 37.0 37.0 37.0 5 36.255 37.0 37.0 37.0 37.0 37.0 6 36.251 37.0 37.0 37.0 37.0 37.0 7 36.146 37.0 37.0 37.0 37.0 37.0 8 36.1375 37.0 37.0 37.0 37.0 37.0 9 36.301 37.0 37.0 37.0 37.0 37.0 10-14 36.2472 37.0 37.0 37.0 37.0 37.0 15-19 36.2592 37.0 37.0 37.0 37.0 37.0 20-24 36.2011 37.0 37.0 37.0 37.0 37.0 25-29 36.144000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.14 37.0 37.0 37.0 37.0 37.0 35-39 36.102999999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.04690000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.9484 37.0 37.0 37.0 37.0 37.0 50-54 35.8868 37.0 37.0 37.0 37.0 37.0 55-59 35.8337 37.0 37.0 37.0 37.0 37.0 60-64 35.773 37.0 37.0 37.0 37.0 37.0 65-69 35.773799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.769 37.0 37.0 37.0 37.0 37.0 75-79 35.62089999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.6252 37.0 37.0 37.0 34.6 37.0 85-89 35.4105 37.0 37.0 37.0 37.0 37.0 90-94 35.458800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.3323 37.0 37.0 37.0 29.8 37.0 100-104 35.3393 37.0 37.0 37.0 32.2 37.0 105-109 35.2648 37.0 37.0 37.0 25.0 37.0 110-114 35.211800000000004 37.0 37.0 37.0 29.8 37.0 115-119 35.2677 37.0 37.0 37.0 27.4 37.0 120-124 35.0193 37.0 37.0 37.0 25.0 37.0 125-129 35.026199999999996 37.0 37.0 37.0 27.4 37.0 130-134 34.962199999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.799600000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.9731 37.0 37.0 37.0 25.0 37.0 145-149 34.694300000000005 37.0 37.0 37.0 25.0 37.0 150 34.915 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 4.0 22 2.0 23 3.0 24 7.0 25 10.0 26 15.0 27 11.0 28 12.0 29 14.0 30 28.0 31 42.0 32 61.0 33 112.0 34 302.0 35 1164.0 36 2175.0 37 34.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.25 16.650000000000002 21.6 32.5 2 21.099999999999998 25.174999999999997 35.199999999999996 18.525 3 22.025 31.324999999999996 26.174999999999997 20.474999999999998 4 24.5 34.925 20.525 20.05 5 23.95 35.525 21.349999999999998 19.175 6 19.575 36.4 22.0 22.025 7 16.325 18.775 41.5 23.400000000000002 8 19.925 21.175 29.75 29.15 9 19.85 23.35 29.4 27.400000000000002 10-14 20.919999999999998 28.96 27.435 22.685 15-19 21.34 27.755000000000003 27.875 23.03 20-24 21.535 28.994999999999997 27.685 21.785 25-29 21.525 28.815 27.639999999999997 22.02 30-34 21.545 29.68 27.305 21.47 35-39 21.240000000000002 28.77 27.58 22.41 40-44 21.595 29.005 27.534999999999997 21.865000000000002 45-49 21.404999999999998 28.689999999999998 27.560000000000002 22.345000000000002 50-54 21.015 29.060000000000002 27.79 22.134999999999998 55-59 21.34 28.405 27.755000000000003 22.5 60-64 21.955 28.27 27.26 22.515 65-69 21.7 27.79 28.249999999999996 22.259999999999998 70-74 21.38 28.285 27.68 22.655 75-79 21.759999999999998 27.915 28.24 22.085 80-84 22.34 28.29 27.534999999999997 21.834999999999997 85-89 21.404999999999998 29.175 27.200000000000003 22.220000000000002 90-94 22.005 28.215 27.200000000000003 22.58 95-99 21.6 27.950000000000003 27.73 22.720000000000002 100-104 22.189999999999998 28.43 27.169999999999998 22.21 105-109 21.64 28.115000000000002 28.275 21.97 110-114 21.985 28.560000000000002 27.439999999999998 22.015 115-119 22.105 28.585 28.199999999999996 21.11 120-124 21.884999999999998 28.465 27.334999999999997 22.314999999999998 125-129 22.495 28.175 27.975 21.355 130-134 22.400000000000002 27.725 27.655 22.220000000000002 135-139 21.745 27.939999999999998 28.415000000000003 21.9 140-144 21.705 27.655 27.87 22.770000000000003 145-149 21.66 27.73 28.455000000000002 22.155 150 22.325 28.675 28.275 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 3.5 22 3.0 23 1.0 24 2.0 25 5.5 26 6.0 27 6.0 28 12.0 29 17.5 30 20.0 31 25.5 32 36.0 33 43.5 34 54.0 35 66.0 36 77.0 37 116.0 38 146.0 39 156.5 40 192.0 41 218.0 42 235.5 43 250.5 44 271.5 45 300.5 46 283.0 47 232.0 48 206.0 49 195.0 50 158.0 51 137.0 52 121.5 53 96.5 54 75.5 55 55.0 56 42.0 57 31.0 58 27.5 59 20.5 60 14.5 61 11.0 62 6.5 63 4.5 64 3.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.98893096417129 73.8 2 11.913778036702592 20.45 3 1.747742499271774 4.5 4 0.29129041654529564 1.0 5 0.05825808330905913 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCATGAGTGATCTTGGCCCTTGCAATGGCAACCGTTCTTGCTGTGTGCTC 5 0.125 No Hit GCCCGGAGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093651 spots for SRR13259393.sra Written 1093651 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra Read 1093642 spots for SRR13259393.sra Written 1093642 spots for SRR13259393.sra SRR ids: ['SRR13259393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvc59ulc SRR13259393.sra spots: 21872849 blocks: [[1, 1093642], [1093643, 2187284], [2187285, 3280926], [3280927, 4374568], [4374569, 5468210], [5468211, 6561852], [6561853, 7655494], [7655495, 8749136], [8749137, 9842778], [9842779, 10936420], [10936421, 12030062], [12030063, 13123704], [13123705, 14217346], [14217347, 15310988], [15310989, 16404630], [16404631, 17498272], [17498273, 18591914], [18591915, 19685556], [19685557, 20779198], [20779199, 21872849]] SRR13259393 file size 7368930 SRR13259393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259393 SRR13259393_1.fastq SRR13259393_2.fastq Input file: SRR13259393_1.fastq Paired file: SRR13259393_2.fastq trimmed: SRR13259393-trimmed-pair1.fastq, SRR13259393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:15:09 2025 >> started Fri Feb 14 04:15:34 2025 >> done (24.643s) 21872849 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 55 ( 0.00%) empty read pairs filtered out after trimming by size control 21872794 (100.00%) read pairs available; of these: 8180 ( 0.04%) trimmed read pairs available after processing 21864614 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 1 0.00% 65 0 0.00% 66 0 0.00% 67 1 0.00% 68 1 0.00% 69 0 0.00% 70 1 0.00% 71 4 0.00% 72 7 0.00% 73 3 0.00% 74 1 0.00% 75 2 0.00% 76 4 0.00% 77 1 0.00% 78 9 0.00% 79 3 0.00% 80 5 0.00% 81 4 0.00% 82 5 0.00% 83 4 0.00% 84 13 0.00% 85 14 0.00% 86 3 0.00% 87 9 0.00% 88 4 0.00% 89 8 0.00% 90 12 0.00% 91 15 0.00% 92 16 0.00% 93 22 0.00% 94 20 0.00% 95 17 0.00% 96 25 0.00% 97 24 0.00% 98 21 0.00% 99 25 0.00% 100 24 0.00% 101 34 0.00% 102 34 0.00% 103 30 0.00% 104 36 0.00% 105 33 0.00% 106 47 0.00% 107 40 0.00% 108 48 0.00% 109 53 0.00% 110 49 0.00% 111 55 0.00% 112 49 0.00% 113 69 0.00% 114 70 0.00% 115 71 0.00% 116 75 0.00% 117 98 0.00% 118 79 0.00% 119 95 0.00% 120 106 0.00% 121 109 0.00% 122 103 0.00% 123 100 0.00% 124 113 0.00% 125 134 0.00% 126 125 0.00% 127 132 0.00% 128 143 0.00% 129 157 0.00% 130 164 0.00% 131 149 0.00% 132 175 0.00% 133 200 0.00% 134 190 0.00% 135 237 0.00% 136 213 0.00% 137 210 0.00% 138 203 0.00% 139 249 0.00% 140 247 0.00% 141 275 0.00% 142 271 0.00% 143 334 0.00% 144 304 0.00% 145 352 0.00% 146 374 0.00% 147 391 0.00% 148 520 0.00% 149 501 0.00% 150 21864614 99.96% 21872794 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=14.99 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.3 sequence=AACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=16.47 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.4 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR13259393 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:16:17 Started mapping on | Feb 14 04:16:17 Finished on | Feb 14 04:18:22 Mapping speed, Million of reads per hour | 629.94 Number of input reads | 21872794 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20705323 Uniquely mapped reads % | 94.66% Average mapped length | 298.18 Number of splices: Total | 20041521 Number of splices: Annotated (sjdb) | 19665525 Number of splices: GT/AG | 19723287 Number of splices: GC/AG | 258646 Number of splices: AT/AC | 17445 Number of splices: Non-canonical | 42143 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530310 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 90177 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637161 637161 637161 N_multimapping 530310 530310 530310 N_noFeature 582612 10576283 10600796 N_ambiguous 225091 57173 57529 UnstrandedReadsAssigned:19897620 PositiveStrandReadsAssigned:10071867 NegativeStrandReadsAssigned:10046998 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259393-trimmed-pair1.fastq SRR13259393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,872,794 reads, 20,304,550 reads pseudoaligned [quant] estimated average fragment length: 247.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR13259393.ke.tsv 34699 SRR13259393.se.tsv 87100 total ==> SRR13259393.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.87 2209 49.6974 Potri.005G024800.1.v4.1 1035 788.874 1326 67.005 Potri.004G059700.1.v4.1 961 714.88 14 0.780668 Potri.007G009000.2.v4.1 1416 1169.87 0 0 Potri.003G141000.2.v4.1 2943 2696.87 900.493 13.3104 Potri.016G087400.1.v4.1 270 50.6771 1252.5 985.233 Potri.015G069301.1.v4.1 564 318.061 0 0 Potri.010G195200.1.v4.1 1773 1526.87 535 13.9676 Potri.012G127500.1.v4.1 977 730.88 4646 253.399 ==> SRR13259393.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 397 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 322 SRR13259393 completed mapping pipeline successfully