Starting /dee2/code/volunteer_pipeline.sh SRR13259394 current disk space = 3086495301632 free memory = 1574860960 SRR13259394 SRAfilesize 40dd065b1c8be4d289140d8eff650284 SRR13259394.sra SRR13259394.sra file validated SRR13259394 is paired end SRR13259394 is conventional basespace SRR13259394 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6295 37.0 37.0 37.0 37.0 37.0 2 36.6045 37.0 37.0 37.0 37.0 37.0 3 36.6505 37.0 37.0 37.0 37.0 37.0 4 36.6015 37.0 37.0 37.0 37.0 37.0 5 36.7255 37.0 37.0 37.0 37.0 37.0 6 36.585 37.0 37.0 37.0 37.0 37.0 7 36.577 37.0 37.0 37.0 37.0 37.0 8 36.687 37.0 37.0 37.0 37.0 37.0 9 36.6825 37.0 37.0 37.0 37.0 37.0 10-14 36.622600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.640299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5773 37.0 37.0 37.0 37.0 37.0 25-29 36.5664 37.0 37.0 37.0 37.0 37.0 30-34 36.5415 37.0 37.0 37.0 37.0 37.0 35-39 36.4928 37.0 37.0 37.0 37.0 37.0 40-44 36.452999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.427899999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4428 37.0 37.0 37.0 37.0 37.0 55-59 36.38245 37.0 37.0 37.0 37.0 37.0 60-64 36.35045 37.0 37.0 37.0 37.0 37.0 65-69 36.2101 37.0 37.0 37.0 37.0 37.0 70-74 36.318799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.230199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.280100000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2201 37.0 37.0 37.0 37.0 37.0 90-94 36.1712 37.0 37.0 37.0 37.0 37.0 95-99 36.1378 37.0 37.0 37.0 37.0 37.0 100-104 35.982 37.0 37.0 37.0 37.0 37.0 105-109 36.032799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0164 37.0 37.0 37.0 37.0 37.0 115-119 35.935300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.99999999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.821200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.6582 37.0 37.0 37.0 37.0 37.0 135-139 35.71419999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7682 37.0 37.0 37.0 37.0 37.0 145-149 35.5804 37.0 37.0 37.0 34.6 37.0 150 35.521 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 0.0 23 2.0 24 1.0 25 4.0 26 4.0 27 12.0 28 12.0 29 14.0 30 21.0 31 30.0 32 59.0 33 60.0 34 114.0 35 275.0 36 3182.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.750000000000004 17.549999999999997 21.975 32.725 2 21.575 26.174999999999997 35.35 16.900000000000002 3 22.15 28.7 27.650000000000002 21.5 4 23.625 33.825 20.05 22.5 5 22.05 36.1 23.05 18.8 6 18.55 37.625 22.6 21.224999999999998 7 16.675 18.625 42.175000000000004 22.525000000000002 8 20.45 22.1 28.725 28.725 9 20.375 23.674999999999997 29.025000000000002 26.924999999999997 10-14 20.79 29.175 26.815 23.22 15-19 20.95 28.435 27.67 22.945 20-24 21.279999999999998 28.705000000000002 27.534999999999997 22.48 25-29 21.475 28.565 27.71 22.25 30-34 21.295 28.244999999999997 27.284999999999997 23.175 35-39 21.355 28.73 27.889999999999997 22.025 40-44 21.404999999999998 29.020000000000003 27.115000000000002 22.46 45-49 20.91 29.01 27.83 22.25 50-54 21.445 28.405 27.83 22.32 55-59 21.6010800540027 28.07140357017851 27.701385069253465 22.626131306565327 60-64 21.311065553277665 28.496424821241064 28.091404570228512 22.101105055252763 65-69 21.490000000000002 28.205000000000002 28.13 22.175 70-74 21.595 28.17 27.400000000000002 22.835 75-79 22.06 27.675 28.105000000000004 22.16 80-84 21.310000000000002 28.7 27.12 22.869999999999997 85-89 22.384999999999998 28.854999999999997 27.150000000000002 21.61 90-94 21.64 27.639999999999997 28.365000000000002 22.355 95-99 21.8 28.88 26.919999999999998 22.400000000000002 100-104 22.15 28.235 27.775 21.84 105-109 21.51 28.199999999999996 28.12 22.17 110-114 22.11 27.425 27.985 22.48 115-119 21.795 28.015 27.97 22.220000000000002 120-124 21.82 27.584999999999997 28.549999999999997 22.045 125-129 21.895 28.165000000000003 27.375 22.564999999999998 130-134 21.82 27.76 28.65 21.77 135-139 21.88 28.185 27.96 21.975 140-144 22.165000000000003 27.794999999999998 27.915 22.125 145-149 21.47 27.61 28.605000000000004 22.314999999999998 150 22.325 27.725 29.075 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 2.0 24 3.0 25 2.0 26 4.0 27 5.0 28 8.5 29 16.0 30 22.5 31 23.5 32 30.5 33 48.0 34 53.5 35 56.0 36 80.0 37 122.0 38 153.0 39 174.0 40 192.0 41 206.0 42 236.0 43 259.0 44 281.5 45 298.5 46 268.0 47 242.5 48 232.0 49 204.0 50 166.0 51 139.5 52 115.5 53 79.5 54 60.0 55 52.0 56 37.5 57 25.0 58 20.0 59 18.5 60 14.5 61 10.5 62 10.5 63 6.5 64 2.5 65 3.5 66 3.5 67 1.5 68 0.5 69 0.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.44889960807959 69.19999999999999 2 13.536328007235454 22.45 3 2.291227012360567 5.7 4 0.5125113053964425 1.7000000000000002 5 0.12059089538739826 0.5 6 0.09044317154054868 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGCTTTCATGAGGGGTGCATTGAAGATCAAGGGTAGTTTGAGTGCTGCG 6 0.15 No Hit CGAGCCTATACTCATAGTACTTGAAGTCTGCACAATTCTCATCAAATAAA 6 0.15 No Hit CCTTTCCCGAGAAACACTTCTCAGGGATACGAGATTACAACCTTCTATAA 6 0.15 No Hit GTCAAGATCTTAACTTTTACTGAAAAAAACAATAAAGACCAATCCTTTAA 5 0.125 No Hit CAGGCTTCATGGTATTCCCTTAAGATTTCCCCCCACATTTCTGGCTCATG 5 0.125 No Hit ATGAAGATGAATAATTCAATGGGGAGTCTTGGTGGAAAGATTTGTGCAGG 5 0.125 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259394 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.526 37.0 37.0 37.0 37.0 37.0 2 36.523 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.4835 37.0 37.0 37.0 37.0 37.0 5 36.5865 37.0 37.0 37.0 37.0 37.0 6 36.614 37.0 37.0 37.0 37.0 37.0 7 36.524 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.6375 37.0 37.0 37.0 37.0 37.0 10-14 36.5595 37.0 37.0 37.0 37.0 37.0 15-19 36.5625 37.0 37.0 37.0 37.0 37.0 20-24 36.5025 37.0 37.0 37.0 37.0 37.0 25-29 36.497499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.46640000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4812 37.0 37.0 37.0 37.0 37.0 40-44 36.4302 37.0 37.0 37.0 37.0 37.0 45-49 36.3898 37.0 37.0 37.0 37.0 37.0 50-54 36.3664 37.0 37.0 37.0 37.0 37.0 55-59 36.3261 37.0 37.0 37.0 37.0 37.0 60-64 36.1999 37.0 37.0 37.0 37.0 37.0 65-69 36.242399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2943 37.0 37.0 37.0 37.0 37.0 75-79 36.117900000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.0843 37.0 37.0 37.0 37.0 37.0 85-89 35.9584 37.0 37.0 37.0 37.0 37.0 90-94 36.0022 37.0 37.0 37.0 37.0 37.0 95-99 35.9448 37.0 37.0 37.0 37.0 37.0 100-104 36.0415 37.0 37.0 37.0 37.0 37.0 105-109 35.9196 37.0 37.0 37.0 37.0 37.0 110-114 35.8784 37.0 37.0 37.0 37.0 37.0 115-119 35.8786 37.0 37.0 37.0 37.0 37.0 120-124 35.69760000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.678999999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.6431 37.0 37.0 37.0 37.0 37.0 135-139 35.5185 37.0 37.0 37.0 34.6 37.0 140-144 35.659400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.454899999999995 37.0 37.0 37.0 37.0 37.0 150 35.6135 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 4.0 23 1.0 24 3.0 25 2.0 26 7.0 27 4.0 28 7.0 29 9.0 30 17.0 31 26.0 32 40.0 33 64.0 34 115.0 35 556.0 36 3014.0 37 129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 17.224999999999998 22.925 31.900000000000002 2 22.5 24.65 34.725 18.125 3 22.975 29.825000000000003 27.625 19.575 4 25.3 33.525 20.3 20.875 5 23.575 36.6 21.825 18.0 6 17.424999999999997 37.275000000000006 23.474999999999998 21.825 7 18.275 16.950000000000003 43.25 21.525 8 20.25 20.0 29.349999999999998 30.4 9 20.849999999999998 23.425 27.474999999999998 28.249999999999996 10-14 21.69 28.95 26.729999999999997 22.63 15-19 21.7 27.47 27.62 23.21 20-24 21.915000000000003 28.720000000000002 27.52 21.845 25-29 21.404999999999998 28.88 27.355 22.36 30-34 21.275 28.849999999999998 28.18 21.695 35-39 21.825 28.884999999999998 26.815 22.475 40-44 22.185 28.939999999999998 27.200000000000003 21.675 45-49 21.790000000000003 28.485 27.625 22.1 50-54 21.435000000000002 29.220000000000002 26.88 22.465 55-59 21.6 28.405 27.839999999999996 22.155 60-64 21.61 29.12 27.125 22.145 65-69 22.295 28.000000000000004 27.35 22.355 70-74 21.315 28.925 27.57 22.189999999999998 75-79 21.785 29.015 27.92 21.279999999999998 80-84 21.905 28.360000000000003 27.245 22.49 85-89 21.63 28.92 27.345000000000002 22.105 90-94 22.415 28.46 27.779999999999998 21.345 95-99 22.21 28.605000000000004 27.11 22.075 100-104 22.225 28.549999999999997 26.924999999999997 22.3 105-109 22.0 27.839999999999996 28.1 22.06 110-114 22.295 27.785 28.249999999999996 21.67 115-119 22.31 28.275 27.235 22.18 120-124 22.015 28.115000000000002 27.515 22.355 125-129 22.07 27.975 28.215 21.740000000000002 130-134 22.065 28.050000000000004 27.894999999999996 21.990000000000002 135-139 23.27 27.455000000000002 28.165000000000003 21.11 140-144 22.58 28.03 27.82 21.57 145-149 22.335 27.61 28.249999999999996 21.805 150 21.875 26.700000000000003 28.325 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.5 23 1.0 24 1.5 25 3.0 26 5.0 27 6.5 28 8.5 29 13.0 30 19.5 31 27.0 32 28.5 33 37.5 34 46.5 35 68.0 36 101.5 37 112.0 38 129.5 39 172.5 40 212.0 41 220.0 42 216.5 43 243.0 44 272.5 45 288.0 46 288.5 47 255.0 48 236.0 49 214.0 50 163.5 51 126.0 52 96.5 53 79.5 54 62.5 55 47.5 56 48.0 57 42.0 58 28.5 59 16.0 60 16.0 61 16.0 62 6.5 63 4.0 64 4.0 65 1.5 66 1.5 67 2.0 68 1.0 69 2.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.175 #Duplication Level Percentage of deduplicated Percentage of total 1 83.64893297264803 69.575 2 13.465584610760445 22.400000000000002 3 2.164111812443643 5.4 4 0.5410279531109108 1.7999999999999998 5 0.09017132551848511 0.375 6 0.09017132551848511 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGTGACTTGTCAATCCAACTCCAAAAATCTTGACAAATTACGCACCAT 6 0.15 No Hit TCCAGTCCCATGTTAAATGAAAAAAACCAACAATTTATGAATTCATCAAC 6 0.15 No Hit CAAAGCTTATGGCACCTGCGGTTAAGTTGGGTGAAGATGAGGAGGATGAA 6 0.15 No Hit ATCCATGTAAAAAATGTAATGAAACTCTCCATCATAACCATGTACTTGTA 5 0.125 No Hit GTTATATCATACAACAACCTGTGCTATAGAACAGAAATCACGCCTTACCA 5 0.125 No Hit TGTGAGGGTAACTACCAGGAAGGTAAAACCCATATCCAGATTGGAAAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0125 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATGG 10 0.006973645 144.0 1 >>END_MODULE Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113259 spots for SRR13259394.sra Written 1113259 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra Read 1113257 spots for SRR13259394.sra Written 1113257 spots for SRR13259394.sra SRR ids: ['SRR13259394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6kp78gvh SRR13259394.sra spots: 22265142 blocks: [[1, 1113257], [1113258, 2226514], [2226515, 3339771], [3339772, 4453028], [4453029, 5566285], [5566286, 6679542], [6679543, 7792799], [7792800, 8906056], [8906057, 10019313], [10019314, 11132570], [11132571, 12245827], [12245828, 13359084], [13359085, 14472341], [14472342, 15585598], [15585599, 16698855], [16698856, 17812112], [17812113, 18925369], [18925370, 20038626], [20038627, 21151883], [21151884, 22265142]] SRR13259394 file size 7501482 SRR13259394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259394 SRR13259394_1.fastq SRR13259394_2.fastq Input file: SRR13259394_1.fastq Paired file: SRR13259394_2.fastq trimmed: SRR13259394-trimmed-pair1.fastq, SRR13259394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:07:57 2025 >> started Fri Feb 14 05:08:21 2025 >> done (24.037s) 22265142 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 82 ( 0.00%) empty read pairs filtered out after trimming by size control 22265060 (100.00%) read pairs available; of these: 6767 ( 0.03%) trimmed read pairs available after processing 22258293 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 2 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 2 0.00% 46 0 0.00% 47 1 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 1 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 2 0.00% 69 2 0.00% 70 0 0.00% 71 0 0.00% 72 2 0.00% 73 4 0.00% 74 5 0.00% 75 2 0.00% 76 3 0.00% 77 2 0.00% 78 5 0.00% 79 2 0.00% 80 2 0.00% 81 3 0.00% 82 2 0.00% 83 4 0.00% 84 5 0.00% 85 4 0.00% 86 4 0.00% 87 3 0.00% 88 5 0.00% 89 7 0.00% 90 7 0.00% 91 5 0.00% 92 13 0.00% 93 6 0.00% 94 16 0.00% 95 14 0.00% 96 16 0.00% 97 13 0.00% 98 20 0.00% 99 12 0.00% 100 17 0.00% 101 19 0.00% 102 25 0.00% 103 37 0.00% 104 32 0.00% 105 33 0.00% 106 39 0.00% 107 24 0.00% 108 28 0.00% 109 26 0.00% 110 47 0.00% 111 48 0.00% 112 30 0.00% 113 56 0.00% 114 58 0.00% 115 48 0.00% 116 53 0.00% 117 76 0.00% 118 62 0.00% 119 57 0.00% 120 78 0.00% 121 84 0.00% 122 79 0.00% 123 92 0.00% 124 98 0.00% 125 115 0.00% 126 109 0.00% 127 95 0.00% 128 108 0.00% 129 111 0.00% 130 133 0.00% 131 123 0.00% 132 132 0.00% 133 155 0.00% 134 153 0.00% 135 176 0.00% 136 179 0.00% 137 193 0.00% 138 180 0.00% 139 209 0.00% 140 180 0.00% 141 247 0.00% 142 258 0.00% 143 302 0.00% 144 272 0.00% 145 279 0.00% 146 344 0.00% 147 388 0.00% 148 421 0.00% 149 454 0.00% 150 22258293 99.97% 22265060 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=23 prefix-density=0.84 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=36.35 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.8 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=23 prefix-density=0.82 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=37.03 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.1 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT SRR13259394 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:09:02 Started mapping on | Feb 14 05:09:02 Finished on | Feb 14 05:11:03 Mapping speed, Million of reads per hour | 662.43 Number of input reads | 22265060 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21228400 Uniquely mapped reads % | 95.34% Average mapped length | 298.38 Number of splices: Total | 20994722 Number of splices: Annotated (sjdb) | 20589121 Number of splices: GT/AG | 20661877 Number of splices: GC/AG | 271003 Number of splices: AT/AC | 18513 Number of splices: Non-canonical | 43329 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527681 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 64136 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 508979 508979 508979 N_multimapping 527681 527681 527681 N_noFeature 592552 10830636 10881465 N_ambiguous 223038 57309 57317 UnstrandedReadsAssigned:20412810 PositiveStrandReadsAssigned:10340455 NegativeStrandReadsAssigned:10289618 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259394-trimmed-pair1.fastq SRR13259394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,265,060 reads, 20,750,944 reads pseudoaligned [quant] estimated average fragment length: 240.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR13259394.ke.tsv 34699 SRR13259394.se.tsv 87100 total ==> SRR13259394.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.52 2548 54.6321 Potri.005G024800.1.v4.1 1035 795.525 747 35.8076 Potri.004G059700.1.v4.1 961 721.544 15 0.792751 Potri.007G009000.2.v4.1 1416 1176.52 0 0 Potri.003G141000.2.v4.1 2943 2703.52 1001.55 14.127 Potri.016G087400.1.v4.1 270 52.4357 1144 831.968 Potri.015G069301.1.v4.1 564 324.7 0 0 Potri.010G195200.1.v4.1 1773 1533.52 566 14.0745 Potri.012G127500.1.v4.1 977 737.537 6400 330.905 ==> SRR13259394.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 468 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 380 SRR13259394 completed mapping pipeline successfully