Starting /dee2/code/volunteer_pipeline.sh SRR13259395 current disk space = 3087415279616 free memory = 1493926084 SRR13259395 SRAfilesize 04f1ad4187454421f0d432ff516b54ff SRR13259395.sra SRR13259395.sra file validated SRR13259395 is paired end SRR13259395 is conventional basespace SRR13259395 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5795 37.0 37.0 37.0 37.0 37.0 2 36.595 37.0 37.0 37.0 37.0 37.0 3 36.6125 37.0 37.0 37.0 37.0 37.0 4 36.5995 37.0 37.0 37.0 37.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 36.6025 37.0 37.0 37.0 37.0 37.0 7 36.6035 37.0 37.0 37.0 37.0 37.0 8 36.68 37.0 37.0 37.0 37.0 37.0 9 36.602 37.0 37.0 37.0 37.0 37.0 10-14 36.5762 37.0 37.0 37.0 37.0 37.0 15-19 36.6014 37.0 37.0 37.0 37.0 37.0 20-24 36.5689 37.0 37.0 37.0 37.0 37.0 25-29 36.47839999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.458200000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.458600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3996 37.0 37.0 37.0 37.0 37.0 45-49 36.478300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4231 37.0 37.0 37.0 37.0 37.0 55-59 36.347300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3136 37.0 37.0 37.0 37.0 37.0 65-69 36.246 37.0 37.0 37.0 37.0 37.0 70-74 36.2825 37.0 37.0 37.0 37.0 37.0 75-79 36.2308 37.0 37.0 37.0 37.0 37.0 80-84 36.2394 37.0 37.0 37.0 37.0 37.0 85-89 36.266999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.181 37.0 37.0 37.0 37.0 37.0 95-99 36.1605 37.0 37.0 37.0 37.0 37.0 100-104 36.06570000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.0668 37.0 37.0 37.0 37.0 37.0 110-114 36.0557 37.0 37.0 37.0 37.0 37.0 115-119 35.9889 37.0 37.0 37.0 37.0 37.0 120-124 36.0081 37.0 37.0 37.0 37.0 37.0 125-129 35.796400000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6619 37.0 37.0 37.0 37.0 37.0 135-139 35.790800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7845 37.0 37.0 37.0 37.0 37.0 145-149 35.616099999999996 37.0 37.0 37.0 37.0 37.0 150 35.617 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 2.0 25 1.0 26 7.0 27 9.0 28 7.0 29 21.0 30 28.0 31 28.0 32 40.0 33 79.0 34 110.0 35 315.0 36 3141.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.775 17.224999999999998 18.85 31.15 2 20.599999999999998 27.55 36.6 15.25 3 22.25 29.275000000000002 27.425 21.05 4 23.35 34.925 20.4 21.325 5 21.75 37.8 21.325 19.125 6 17.65 37.325 23.125 21.9 7 15.725 15.5 45.2 23.575 8 21.15 21.25 27.650000000000002 29.95 9 19.55 22.95 29.849999999999998 27.650000000000002 10-14 21.295 29.054999999999996 26.955000000000002 22.695 15-19 21.345 28.294999999999998 27.77 22.59 20-24 21.755 28.76 27.775 21.709999999999997 25-29 21.125 28.939999999999998 28.07 21.865000000000002 30-34 21.22 28.46 28.249999999999996 22.07 35-39 21.555 28.585 27.685 22.175 40-44 21.59 28.655 27.675 22.08 45-49 21.099999999999998 28.845 28.299999999999997 21.755 50-54 21.955 28.87 27.37 21.805 55-59 21.847184718471844 28.917891789178917 27.13271327132713 22.102210221022105 60-64 21.527152715271527 28.36283628362836 27.927792779277926 22.182218221822183 65-69 22.105 27.615000000000002 27.88 22.400000000000002 70-74 21.925 27.875 27.755000000000003 22.445 75-79 21.595 27.785 28.58 22.040000000000003 80-84 21.385 27.894999999999996 28.065 22.655 85-89 22.31 28.384999999999998 27.639999999999997 21.665 90-94 21.52 28.225 28.345 21.91 95-99 22.13 28.185 27.325 22.36 100-104 21.790000000000003 27.485 28.775000000000002 21.95 105-109 21.884999999999998 28.555000000000003 28.044999999999998 21.515 110-114 22.155 28.575 27.6 21.67 115-119 21.654999999999998 27.939999999999998 28.025 22.38 120-124 22.235 28.015 27.800000000000004 21.95 125-129 21.68 28.79 27.58 21.95 130-134 22.345000000000002 27.76 28.675 21.22 135-139 21.55 27.905 28.775000000000002 21.77 140-144 21.91 28.415000000000003 27.950000000000003 21.725 145-149 22.115000000000002 28.58 27.405 21.9 150 22.625 27.325 27.275 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.5 24 4.0 25 4.5 26 4.5 27 7.5 28 11.0 29 14.0 30 21.5 31 26.0 32 32.5 33 42.5 34 53.5 35 72.5 36 96.5 37 124.5 38 139.5 39 156.5 40 193.5 41 231.5 42 256.0 43 277.0 44 285.0 45 258.5 46 249.5 47 250.5 48 228.0 49 193.0 50 162.5 51 143.5 52 106.0 53 71.5 54 55.0 55 51.0 56 46.5 57 30.5 58 18.5 59 14.0 60 15.5 61 13.0 62 9.0 63 7.0 64 4.0 65 6.0 66 4.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.29758397171479 72.375 2 12.139068945197407 20.599999999999998 3 2.0624631703005303 5.25 4 0.41249263406010606 1.4000000000000001 5 0.0883912787271656 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAACCCCATAATCCTATCCCCCGGCAACAACAACCCAGTATACACAG 5 0.125 No Hit CCGACAGCGCGTTCGCGCGCGAGCTTCGAAAGGGAATCGGGTTAAAATTC 5 0.125 No Hit ATTCGGATGTCATGCAAGATTTGTGCTCTCCAGATTCAGAGGTTCCTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0125 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259395 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4835 37.0 37.0 37.0 37.0 37.0 2 36.494 37.0 37.0 37.0 37.0 37.0 3 36.4245 37.0 37.0 37.0 37.0 37.0 4 36.514 37.0 37.0 37.0 37.0 37.0 5 36.5375 37.0 37.0 37.0 37.0 37.0 6 36.4925 37.0 37.0 37.0 37.0 37.0 7 36.5065 37.0 37.0 37.0 37.0 37.0 8 36.6095 37.0 37.0 37.0 37.0 37.0 9 36.5315 37.0 37.0 37.0 37.0 37.0 10-14 36.5065 37.0 37.0 37.0 37.0 37.0 15-19 36.5098 37.0 37.0 37.0 37.0 37.0 20-24 36.4671 37.0 37.0 37.0 37.0 37.0 25-29 36.4831 37.0 37.0 37.0 37.0 37.0 30-34 36.4416 37.0 37.0 37.0 37.0 37.0 35-39 36.4402 37.0 37.0 37.0 37.0 37.0 40-44 36.3751 37.0 37.0 37.0 37.0 37.0 45-49 36.3575 37.0 37.0 37.0 37.0 37.0 50-54 36.2887 37.0 37.0 37.0 37.0 37.0 55-59 36.298199999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.1537 37.0 37.0 37.0 37.0 37.0 65-69 36.1633 37.0 37.0 37.0 37.0 37.0 70-74 36.1686 37.0 37.0 37.0 37.0 37.0 75-79 36.063599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0334 37.0 37.0 37.0 37.0 37.0 85-89 35.9304 37.0 37.0 37.0 37.0 37.0 90-94 35.8929 37.0 37.0 37.0 37.0 37.0 95-99 35.90839999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9418 37.0 37.0 37.0 37.0 37.0 105-109 35.857299999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.805099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.839999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.657000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6496 37.0 37.0 37.0 37.0 37.0 130-134 35.57770000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.4958 37.0 37.0 37.0 34.6 37.0 140-144 35.4717 37.0 37.0 37.0 37.0 37.0 145-149 35.3574 37.0 37.0 37.0 32.2 37.0 150 35.529 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 1.0 24 4.0 25 7.0 26 5.0 27 7.0 28 8.0 29 7.0 30 11.0 31 30.0 32 41.0 33 62.0 34 132.0 35 638.0 36 2929.0 37 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.975 17.2 18.8 31.025000000000002 2 20.849999999999998 26.55 37.325 15.275 3 21.15 31.175000000000004 26.450000000000003 21.224999999999998 4 24.325 36.1 19.45 20.125 5 22.85 36.5 22.8 17.849999999999998 6 17.974999999999998 36.6 23.875 21.55 7 16.2 17.7 42.375 23.724999999999998 8 20.1 21.25 28.825 29.825000000000003 9 22.2 22.8 26.900000000000002 28.1 10-14 21.665 28.744999999999997 26.950000000000003 22.64 15-19 21.505 28.22 28.28 21.995 20-24 21.455 29.285 27.415 21.845 25-29 21.21 28.910000000000004 27.755000000000003 22.125 30-34 21.775 28.71 27.96 21.555 35-39 21.255 28.62 28.294999999999998 21.83 40-44 22.095000000000002 29.099999999999998 27.0 21.805 45-49 21.095 28.410000000000004 28.175 22.32 50-54 21.66 28.655 27.944999999999997 21.740000000000002 55-59 21.375 29.015 27.005000000000003 22.605 60-64 21.615000000000002 28.815 27.975 21.595 65-69 21.5 27.67 27.77 23.06 70-74 21.81 28.705000000000002 27.675 21.81 75-79 21.625 27.825 27.935 22.615 80-84 20.985 28.1 28.615000000000002 22.3 85-89 21.884999999999998 27.735 28.035 22.345000000000002 90-94 21.23 28.28 28.22 22.27 95-99 21.625 28.665000000000003 27.255000000000003 22.455 100-104 21.215 28.09 27.985 22.71 105-109 21.560000000000002 28.715000000000003 27.994999999999997 21.73 110-114 21.665 28.244999999999997 28.305000000000003 21.785 115-119 22.11 28.050000000000004 28.384999999999998 21.455 120-124 22.2 27.47 27.689999999999998 22.64 125-129 21.645 27.779999999999998 28.225 22.35 130-134 21.2 28.125 28.345 22.33 135-139 22.09 27.555000000000003 28.08 22.275 140-144 22.445 28.115000000000002 27.93 21.51 145-149 22.509999999999998 28.095 27.694999999999997 21.7 150 22.35 28.7 26.625 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.5 25 4.0 26 4.0 27 7.5 28 12.0 29 14.0 30 17.5 31 26.5 32 42.5 33 55.0 34 65.5 35 78.5 36 95.0 37 122.0 38 140.0 39 163.0 40 197.0 41 232.0 42 251.5 43 268.0 44 262.0 45 252.5 46 262.0 47 238.5 48 206.0 49 188.5 50 170.5 51 142.0 52 109.0 53 75.5 54 62.0 55 54.0 56 37.0 57 28.5 58 31.0 59 23.0 60 12.0 61 10.0 62 6.5 63 3.5 64 3.0 65 4.5 66 3.5 67 1.5 68 3.5 69 4.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 1.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.675 #Duplication Level Percentage of deduplicated Percentage of total 1 85.06052553882492 72.02499999999999 2 12.400354295837024 21.0 3 2.0076764098021846 5.1 4 0.44286979627989376 1.5 5 0.08857395925597875 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCC 5 0.125 No Hit CTTTTGACCATACCATGCATTACGACCTTTCAGTAAGGTTACATAAGTGT 5 0.125 No Hit GTCGGAGAATTTTGTATGTAGAGCGGTAATGGAGGCTCTTGGAAGTCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0125 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGTT 10 0.006973645 144.0 5 >>END_MODULE Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226272 spots for SRR13259395.sra Written 1226272 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra Read 1226257 spots for SRR13259395.sra Written 1226257 spots for SRR13259395.sra SRR ids: ['SRR13259395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_db3fghtm SRR13259395.sra spots: 24525155 blocks: [[1, 1226257], [1226258, 2452514], [2452515, 3678771], [3678772, 4905028], [4905029, 6131285], [6131286, 7357542], [7357543, 8583799], [8583800, 9810056], [9810057, 11036313], [11036314, 12262570], [12262571, 13488827], [13488828, 14715084], [14715085, 15941341], [15941342, 17167598], [17167599, 18393855], [18393856, 19620112], [19620113, 20846369], [20846370, 22072626], [22072627, 23298883], [23298884, 24525155]] SRR13259395 file size 8265119 SRR13259395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259395 SRR13259395_1.fastq SRR13259395_2.fastq Input file: SRR13259395_1.fastq Paired file: SRR13259395_2.fastq trimmed: SRR13259395-trimmed-pair1.fastq, SRR13259395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:25:09 2025 >> started Fri Feb 14 04:25:41 2025 >> done (32.450s) 24525155 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 53 ( 0.00%) empty read pairs filtered out after trimming by size control 24525102 (100.00%) read pairs available; of these: 8371 ( 0.03%) trimmed read pairs available after processing 24516731 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 2 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 1 0.00% 67 0 0.00% 68 3 0.00% 69 2 0.00% 70 3 0.00% 71 5 0.00% 72 4 0.00% 73 1 0.00% 74 2 0.00% 75 2 0.00% 76 2 0.00% 77 5 0.00% 78 7 0.00% 79 7 0.00% 80 3 0.00% 81 6 0.00% 82 4 0.00% 83 3 0.00% 84 2 0.00% 85 4 0.00% 86 6 0.00% 87 11 0.00% 88 6 0.00% 89 9 0.00% 90 12 0.00% 91 16 0.00% 92 19 0.00% 93 23 0.00% 94 22 0.00% 95 17 0.00% 96 29 0.00% 97 17 0.00% 98 33 0.00% 99 28 0.00% 100 22 0.00% 101 34 0.00% 102 42 0.00% 103 40 0.00% 104 36 0.00% 105 45 0.00% 106 50 0.00% 107 35 0.00% 108 50 0.00% 109 51 0.00% 110 43 0.00% 111 74 0.00% 112 63 0.00% 113 68 0.00% 114 70 0.00% 115 89 0.00% 116 67 0.00% 117 82 0.00% 118 76 0.00% 119 70 0.00% 120 96 0.00% 121 92 0.00% 122 100 0.00% 123 117 0.00% 124 111 0.00% 125 119 0.00% 126 132 0.00% 127 130 0.00% 128 136 0.00% 129 150 0.00% 130 150 0.00% 131 176 0.00% 132 163 0.00% 133 205 0.00% 134 194 0.00% 135 207 0.00% 136 220 0.00% 137 252 0.00% 138 239 0.00% 139 237 0.00% 140 279 0.00% 141 282 0.00% 142 288 0.00% 143 322 0.00% 144 317 0.00% 145 338 0.00% 146 389 0.00% 147 451 0.00% 148 499 0.00% 149 547 0.00% 150 24516731 99.97% 24525102 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=11.30 fanout-score-rank=14 prefix-density=0.25 prefix-fanout=4.8 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=260.00 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=27.2 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=12.07 fanout-score-rank=12 prefix-density=0.25 prefix-fanout=5.0 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=335.15 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.9 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT SRR13259395 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:26:26 Started mapping on | Feb 14 04:26:26 Finished on | Feb 14 04:28:47 Mapping speed, Million of reads per hour | 626.17 Number of input reads | 24525102 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23217006 Uniquely mapped reads % | 94.67% Average mapped length | 298.36 Number of splices: Total | 22809934 Number of splices: Annotated (sjdb) | 22402123 Number of splices: GT/AG | 22415335 Number of splices: GC/AG | 328328 Number of splices: AT/AC | 17532 Number of splices: Non-canonical | 48739 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 625639 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 103604 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 682457 682457 682457 N_multimapping 625639 625639 625639 N_noFeature 746130 11883741 11913964 N_ambiguous 301563 68451 68203 UnstrandedReadsAssigned:22169313 PositiveStrandReadsAssigned:11264814 NegativeStrandReadsAssigned:11234839 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259395-trimmed-pair1.fastq SRR13259395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,525,102 reads, 22,762,207 reads pseudoaligned [quant] estimated average fragment length: 236.558 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR13259395.ke.tsv 34699 SRR13259395.se.tsv 87100 total ==> SRR13259395.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.44 1692 38.7701 Potri.005G024800.1.v4.1 1035 799.442 1391 71.0644 Potri.004G059700.1.v4.1 961 725.442 4 0.225201 Potri.007G009000.2.v4.1 1416 1180.44 0 0 Potri.003G141000.2.v4.1 2943 2707.44 1069.3 16.1307 Potri.016G087400.1.v4.1 270 53.7119 944 717.816 Potri.015G069301.1.v4.1 564 328.574 0 0 Potri.010G195200.1.v4.1 1773 1537.44 824.964 21.9154 Potri.012G127500.1.v4.1 977 741.442 1702 93.755 ==> SRR13259395.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR13259395 completed mapping pipeline successfully