Starting /dee2/code/volunteer_pipeline.sh SRR13259396 current disk space = 3086874718208 free memory = 1582666216 SRR13259396 SRAfilesize 762793e35d8bed5259e451599fa91369 SRR13259396.sra SRR13259396.sra file validated SRR13259396 is paired end SRR13259396 is conventional basespace SRR13259396 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6545 37.0 37.0 37.0 37.0 37.0 2 36.634 37.0 37.0 37.0 37.0 37.0 3 36.646 37.0 37.0 37.0 37.0 37.0 4 36.682 37.0 37.0 37.0 37.0 37.0 5 36.677 37.0 37.0 37.0 37.0 37.0 6 36.6135 37.0 37.0 37.0 37.0 37.0 7 36.6165 37.0 37.0 37.0 37.0 37.0 8 36.702 37.0 37.0 37.0 37.0 37.0 9 36.693 37.0 37.0 37.0 37.0 37.0 10-14 36.6203 37.0 37.0 37.0 37.0 37.0 15-19 36.6109 37.0 37.0 37.0 37.0 37.0 20-24 36.6113 37.0 37.0 37.0 37.0 37.0 25-29 36.524499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.46660000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4769 37.0 37.0 37.0 37.0 37.0 40-44 36.405499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4091 37.0 37.0 37.0 37.0 37.0 50-54 36.37330000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3709 37.0 37.0 37.0 37.0 37.0 60-64 36.3209 37.0 37.0 37.0 37.0 37.0 65-69 36.3104 37.0 37.0 37.0 37.0 37.0 70-74 36.2175 37.0 37.0 37.0 37.0 37.0 75-79 36.2071 37.0 37.0 37.0 37.0 37.0 80-84 36.188 37.0 37.0 37.0 37.0 37.0 85-89 36.228899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1879 37.0 37.0 37.0 37.0 37.0 95-99 36.146 37.0 37.0 37.0 37.0 37.0 100-104 35.993700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0034 37.0 37.0 37.0 37.0 37.0 110-114 35.993399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.85360000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.8523 37.0 37.0 37.0 37.0 37.0 125-129 35.75240000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5999 37.0 37.0 37.0 37.0 37.0 135-139 35.6001 37.0 37.0 37.0 37.0 37.0 140-144 35.73270000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.44610000000001 37.0 37.0 37.0 34.6 37.0 150 35.572 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 7.0 23 1.0 24 3.0 25 3.0 26 6.0 27 9.0 28 20.0 29 14.0 30 29.0 31 36.0 32 48.0 33 74.0 34 76.0 35 265.0 36 3184.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75 18.224999999999998 17.599999999999998 30.425 2 20.0 24.8 37.15 18.05 3 22.400000000000002 30.925000000000004 26.325 20.349999999999998 4 23.225 35.525 21.4 19.85 5 22.375 36.225 21.575 19.825 6 18.475 37.85 23.474999999999998 20.200000000000003 7 15.825 16.725 43.7 23.75 8 19.075 22.275 28.9 29.75 9 21.825 23.9 26.8 27.474999999999998 10-14 21.279999999999998 29.25 26.865 22.605 15-19 21.78 28.475 27.68 22.065 20-24 21.215 29.04 27.6 22.145 25-29 21.29 28.910000000000004 27.865000000000002 21.935 30-34 20.895 28.465 28.53 22.11 35-39 21.02 28.895 27.634999999999998 22.45 40-44 21.27 28.810000000000002 27.595 22.325 45-49 21.51 29.125 27.150000000000002 22.215 50-54 21.154999999999998 28.76 27.915 22.17 55-59 21.077107710771077 28.64786478647865 27.982798279827982 22.29222922292229 60-64 20.767076707670768 28.442844284428443 27.86278627862786 22.927292729272928 65-69 21.32 28.67 27.67 22.34 70-74 21.84 28.470000000000002 27.46 22.23 75-79 21.775 28.505000000000003 27.465 22.255 80-84 21.175 28.384999999999998 28.000000000000004 22.439999999999998 85-89 22.255 28.435 26.974999999999998 22.335 90-94 21.65 28.93 27.735 21.685 95-99 21.975 28.23 27.715 22.08 100-104 21.38 28.515 28.17 21.935 105-109 22.32 28.005000000000003 27.134999999999998 22.54 110-114 21.224999999999998 28.470000000000002 27.88 22.425 115-119 21.985 28.084999999999997 27.389999999999997 22.54 120-124 21.89 27.435 28.175 22.5 125-129 21.855 27.694999999999997 28.084999999999997 22.365 130-134 21.77 27.63 28.4 22.2 135-139 21.93 27.779999999999998 28.34 21.95 140-144 21.995 27.265 28.565 22.175 145-149 21.560000000000002 28.165000000000003 28.12 22.155 150 20.825 29.65 28.325 21.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 2.0 17 2.5 18 0.5 19 1.0 20 2.0 21 1.0 22 0.5 23 2.0 24 4.5 25 5.0 26 7.0 27 15.0 28 21.0 29 21.0 30 29.5 31 45.0 32 46.5 33 45.0 34 64.0 35 93.0 36 114.5 37 115.5 38 127.0 39 160.0 40 191.5 41 206.5 42 225.5 43 253.0 44 249.5 45 248.0 46 236.5 47 216.5 48 205.5 49 181.5 50 164.5 51 142.0 52 119.0 53 85.0 54 64.5 55 59.5 56 41.0 57 29.0 58 20.0 59 22.5 60 23.5 61 15.5 62 13.0 63 10.5 64 6.5 65 5.0 66 4.5 67 6.0 68 6.0 69 5.5 70 4.0 71 2.5 72 1.0 73 1.0 74 1.0 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.13504631012847 70.39999999999999 2 12.996713474753511 21.75 3 2.24081266806095 5.625 4 0.537795040334628 1.7999999999999998 5 0.029877502240812665 0.125 6 0.05975500448162533 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGGAGTACGACATGTCAAAGTAGGATTATTGTTCATCCACGTGGGGC 6 0.15 No Hit GCAAAATCATCAAAAACCTCGCTCATACCCTTCACTCCTTCATATGCACC 6 0.15 No Hit GTGTCGATGTCAAGGGGTTTTTTGCTTGGTCATTCTTGGATGATTTTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0125 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259396 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2375 37.0 37.0 37.0 37.0 37.0 2 36.3325 37.0 37.0 37.0 37.0 37.0 3 36.3685 37.0 37.0 37.0 37.0 37.0 4 36.4295 37.0 37.0 37.0 37.0 37.0 5 36.4695 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.473 37.0 37.0 37.0 37.0 37.0 8 36.4685 37.0 37.0 37.0 37.0 37.0 9 36.487 37.0 37.0 37.0 37.0 37.0 10-14 36.3926 37.0 37.0 37.0 37.0 37.0 15-19 36.371700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3629 37.0 37.0 37.0 37.0 37.0 25-29 36.4118 37.0 37.0 37.0 37.0 37.0 30-34 36.355999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3001 37.0 37.0 37.0 37.0 37.0 40-44 36.2657 37.0 37.0 37.0 37.0 37.0 45-49 36.2873 37.0 37.0 37.0 37.0 37.0 50-54 36.117900000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1139 37.0 37.0 37.0 37.0 37.0 60-64 36.0354 37.0 37.0 37.0 37.0 37.0 65-69 36.026300000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0583 37.0 37.0 37.0 37.0 37.0 75-79 35.8739 37.0 37.0 37.0 37.0 37.0 80-84 35.8817 37.0 37.0 37.0 37.0 37.0 85-89 35.7453 37.0 37.0 37.0 37.0 37.0 90-94 35.736599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.6637 37.0 37.0 37.0 37.0 37.0 100-104 35.6858 37.0 37.0 37.0 37.0 37.0 105-109 35.6957 37.0 37.0 37.0 37.0 37.0 110-114 35.5781 37.0 37.0 37.0 37.0 37.0 115-119 35.561899999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.40599999999999 37.0 37.0 37.0 32.2 37.0 125-129 35.38440000000001 37.0 37.0 37.0 29.8 37.0 130-134 35.2911 37.0 37.0 37.0 29.8 37.0 135-139 35.223699999999994 37.0 37.0 37.0 29.8 37.0 140-144 35.3169 37.0 37.0 37.0 32.2 37.0 145-149 35.088800000000006 37.0 37.0 37.0 25.0 37.0 150 35.2675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 3.0 24 5.0 25 6.0 26 5.0 27 12.0 28 20.0 29 21.0 30 24.0 31 42.0 32 42.0 33 68.0 34 172.0 35 732.0 36 2759.0 37 84.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.125 18.55 17.625 28.7 2 21.775 25.3 34.625 18.3 3 24.224999999999998 29.725 26.150000000000002 19.900000000000002 4 23.75 36.475 20.375 19.400000000000002 5 22.95 36.25 21.775 19.025 6 17.424999999999997 37.15 22.900000000000002 22.525000000000002 7 15.925 18.175 43.175000000000004 22.725 8 18.099999999999998 23.225 28.675 30.0 9 21.025 22.2 29.7 27.075 10-14 21.25 29.304999999999996 26.52 22.925 15-19 21.93 28.58 27.055 22.435 20-24 21.66 29.01 27.72 21.61 25-29 21.709999999999997 28.77 27.839999999999996 21.68 30-34 21.425 29.235 27.639999999999997 21.7 35-39 21.37 29.04 27.495000000000005 22.095000000000002 40-44 21.745 28.610000000000003 27.315 22.33 45-49 22.465 28.675 26.85 22.009999999999998 50-54 21.84 28.43 27.615000000000002 22.115000000000002 55-59 21.72 28.565 27.27 22.445 60-64 21.715 28.59 28.33 21.365000000000002 65-69 21.64 28.875 27.400000000000002 22.085 70-74 21.955 28.689999999999998 27.18 22.175 75-79 22.17 28.075 27.689999999999998 22.065 80-84 22.515 28.845 27.169999999999998 21.47 85-89 22.62 27.3 27.71 22.37 90-94 22.115000000000002 27.73 28.555000000000003 21.6 95-99 21.310000000000002 28.775000000000002 27.63 22.285 100-104 22.905 28.215 27.355 21.525 105-109 22.745 28.23 27.279999999999998 21.745 110-114 22.165000000000003 28.62 27.22 21.995 115-119 21.790000000000003 28.42 27.939999999999998 21.85 120-124 22.535 27.87 27.205000000000002 22.39 125-129 22.14 28.084999999999997 28.299999999999997 21.475 130-134 22.89 27.534999999999997 28.189999999999998 21.385 135-139 22.15 27.900000000000002 27.950000000000003 22.0 140-144 22.06 27.72 28.73 21.490000000000002 145-149 22.25 27.884999999999998 28.48 21.385 150 22.225 28.225 28.175 21.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.5 21 1.5 22 0.5 23 1.0 24 3.0 25 5.0 26 9.0 27 10.0 28 8.5 29 16.5 30 28.5 31 28.5 32 33.0 33 49.5 34 59.0 35 75.5 36 102.5 37 127.5 38 145.5 39 165.5 40 178.0 41 209.0 42 253.0 43 262.0 44 242.5 45 235.5 46 244.0 47 229.0 48 211.5 49 194.0 50 160.5 51 130.5 52 113.5 53 101.5 54 78.0 55 47.0 56 42.5 57 38.0 58 28.5 59 25.0 60 16.0 61 12.5 62 12.0 63 11.5 64 9.0 65 5.0 66 5.0 67 5.5 68 5.5 69 5.0 70 3.5 71 2.0 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.8 #Duplication Level Percentage of deduplicated Percentage of total 1 84.1288782816229 70.5 2 13.036992840095465 21.85 3 2.3269689737470167 5.8500000000000005 4 0.41766109785202865 1.4000000000000001 5 0.05966587112171838 0.25 6 0.02983293556085919 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTATCCTGATTACTGGGGGTGTTATGCCACGATTCAAAATAAAAGGTAT 6 0.15 No Hit CGCCAATATATGTTTAATCAATTCTCGACTTCTTACGGCTACGAGCTGAT 5 0.125 No Hit TCGGATGTGTATGCGTTTGGTGCACTTTTGCTTGAGGTTGTGTGTGGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.037500000000000006 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.075 0.0 0.0 0.0 0.0 134-135 0.075 0.0 0.0 0.0 0.0 136-137 0.075 0.0 0.0 0.0 0.0 138 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1152012 spots for SRR13259396.sra Written 1152012 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra Read 1151999 spots for SRR13259396.sra Written 1151999 spots for SRR13259396.sra SRR ids: ['SRR13259396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5z9fr13 SRR13259396.sra spots: 23039993 blocks: [[1, 1151999], [1152000, 2303998], [2303999, 3455997], [3455998, 4607996], [4607997, 5759995], [5759996, 6911994], [6911995, 8063993], [8063994, 9215992], [9215993, 10367991], [10367992, 11519990], [11519991, 12671989], [12671990, 13823988], [13823989, 14975987], [14975988, 16127986], [16127987, 17279985], [17279986, 18431984], [18431985, 19583983], [19583984, 20735982], [20735983, 21887981], [21887982, 23039993]] SRR13259396 file size 7763297 SRR13259396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259396 SRR13259396_1.fastq SRR13259396_2.fastq Input file: SRR13259396_1.fastq Paired file: SRR13259396_2.fastq trimmed: SRR13259396-trimmed-pair1.fastq, SRR13259396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:55:13 2025 >> started Fri Feb 14 04:55:38 2025 >> done (24.941s) 23039993 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 151 ( 0.00%) empty read pairs filtered out after trimming by size control 23039842 (100.00%) read pairs available; of these: 9939 ( 0.04%) trimmed read pairs available after processing 23029903 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 29 2 0.00% 30 0 0.00% 31 3 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 2 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 3 0.00% 41 0 0.00% 42 1 0.00% 43 4 0.00% 44 2 0.00% 45 2 0.00% 46 1 0.00% 47 4 0.00% 48 3 0.00% 49 4 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 2 0.00% 63 0 0.00% 64 1 0.00% 65 1 0.00% 66 1 0.00% 67 0 0.00% 68 1 0.00% 69 4 0.00% 70 1 0.00% 71 5 0.00% 72 5 0.00% 73 2 0.00% 74 7 0.00% 75 6 0.00% 76 6 0.00% 77 7 0.00% 78 6 0.00% 79 6 0.00% 80 10 0.00% 81 10 0.00% 82 4 0.00% 83 13 0.00% 84 9 0.00% 85 13 0.00% 86 7 0.00% 87 9 0.00% 88 5 0.00% 89 14 0.00% 90 12 0.00% 91 19 0.00% 92 12 0.00% 93 18 0.00% 94 14 0.00% 95 25 0.00% 96 22 0.00% 97 27 0.00% 98 32 0.00% 99 39 0.00% 100 44 0.00% 101 39 0.00% 102 59 0.00% 103 44 0.00% 104 37 0.00% 105 55 0.00% 106 58 0.00% 107 76 0.00% 108 76 0.00% 109 60 0.00% 110 61 0.00% 111 83 0.00% 112 70 0.00% 113 79 0.00% 114 91 0.00% 115 93 0.00% 116 102 0.00% 117 106 0.00% 118 98 0.00% 119 94 0.00% 120 118 0.00% 121 122 0.00% 122 142 0.00% 123 143 0.00% 124 142 0.00% 125 175 0.00% 126 144 0.00% 127 160 0.00% 128 156 0.00% 129 158 0.00% 130 207 0.00% 131 174 0.00% 132 245 0.00% 133 224 0.00% 134 216 0.00% 135 265 0.00% 136 322 0.00% 137 273 0.00% 138 255 0.00% 139 279 0.00% 140 278 0.00% 141 302 0.00% 142 384 0.00% 143 364 0.00% 144 321 0.00% 145 362 0.00% 146 457 0.00% 147 530 0.00% 148 538 0.00% 149 647 0.00% 150 23029903 99.96% 23039842 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=28 prefix-density=0.11 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=91.36 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.8 sequence=AGGAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCCAGAGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=34 prefix-density=0.11 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=156.35 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=26.1 sequence=CAGCAGCAGCAA SRR13259396 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:56:46 Started mapping on | Feb 14 04:56:49 Finished on | Feb 14 04:59:33 Mapping speed, Million of reads per hour | 505.75 Number of input reads | 23039842 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20816106 Uniquely mapped reads % | 90.35% Average mapped length | 290.23 Number of splices: Total | 17886751 Number of splices: Annotated (sjdb) | 17473993 Number of splices: GT/AG | 17570975 Number of splices: GC/AG | 247246 Number of splices: AT/AC | 16673 Number of splices: Non-canonical | 51857 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 638497 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 116111 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.23% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1585239 1585239 1585239 N_multimapping 638497 638497 638497 N_noFeature 779635 10690064 10716575 N_ambiguous 317403 64739 64490 UnstrandedReadsAssigned:19719068 PositiveStrandReadsAssigned:10061303 NegativeStrandReadsAssigned:10035041 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR13259396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259396-trimmed-pair1.fastq SRR13259396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,039,842 reads, 20,523,988 reads pseudoaligned [quant] estimated average fragment length: 236.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR13259396.ke.tsv 34699 SRR13259396.se.tsv 87100 total ==> SRR13259396.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.75 1306 27.4832 Potri.005G024800.1.v4.1 1035 799.75 1983 93.0213 Potri.004G059700.1.v4.1 961 725.756 33 1.70584 Potri.007G009000.2.v4.1 1416 1180.75 0 0 Potri.003G141000.2.v4.1 2943 2707.75 945.567 13.1008 Potri.016G087400.1.v4.1 270 56.1207 1340.44 896.063 Potri.015G069301.1.v4.1 564 328.872 0 0 Potri.010G195200.1.v4.1 1773 1537.75 1141.81 27.8563 Potri.012G127500.1.v4.1 977 741.756 3280 165.893 ==> SRR13259396.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 46 SRR13259396 completed mapping pipeline successfully