Starting /dee2/code/volunteer_pipeline.sh SRR13259397 current disk space = 3087203020800 free memory = 1486635556 SRR13259397 SRAfilesize 7097678349eb7d11f388b9fd66af1b8a SRR13259397.sra SRR13259397.sra file validated SRR13259397 is paired end SRR13259397 is conventional basespace SRR13259397 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6185 37.0 37.0 37.0 37.0 37.0 2 36.56 37.0 37.0 37.0 37.0 37.0 3 36.631 37.0 37.0 37.0 37.0 37.0 4 36.5645 37.0 37.0 37.0 37.0 37.0 5 36.671 37.0 37.0 37.0 37.0 37.0 6 36.5805 37.0 37.0 37.0 37.0 37.0 7 36.554 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.6335 37.0 37.0 37.0 37.0 37.0 10-14 36.6277 37.0 37.0 37.0 37.0 37.0 15-19 36.603500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.552 37.0 37.0 37.0 37.0 37.0 25-29 36.469100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.439 37.0 37.0 37.0 37.0 37.0 35-39 36.410799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4265 37.0 37.0 37.0 37.0 37.0 45-49 36.3685 37.0 37.0 37.0 37.0 37.0 50-54 36.3831 37.0 37.0 37.0 37.0 37.0 55-59 36.33625 37.0 37.0 37.0 37.0 37.0 60-64 36.284749999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1875 37.0 37.0 37.0 37.0 37.0 70-74 36.22279999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1775 37.0 37.0 37.0 37.0 37.0 80-84 36.1606 37.0 37.0 37.0 37.0 37.0 85-89 36.1702 37.0 37.0 37.0 37.0 37.0 90-94 36.089 37.0 37.0 37.0 37.0 37.0 95-99 36.0514 37.0 37.0 37.0 37.0 37.0 100-104 35.987100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.984 37.0 37.0 37.0 37.0 37.0 110-114 35.9551 37.0 37.0 37.0 37.0 37.0 115-119 35.888600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.8543 37.0 37.0 37.0 37.0 37.0 125-129 35.8117 37.0 37.0 37.0 37.0 37.0 130-134 35.5432 37.0 37.0 37.0 37.0 37.0 135-139 35.6973 37.0 37.0 37.0 37.0 37.0 140-144 35.7551 37.0 37.0 37.0 37.0 37.0 145-149 35.5173 37.0 37.0 37.0 37.0 37.0 150 35.417 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 1.0 25 5.0 26 3.0 27 10.0 28 17.0 29 24.0 30 23.0 31 47.0 32 51.0 33 57.0 34 109.0 35 299.0 36 3147.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.625 17.75 17.974999999999998 30.65 2 20.875 24.15 38.550000000000004 16.425 3 21.349999999999998 29.2 28.1 21.349999999999998 4 22.7 34.925 21.85 20.525 5 23.925 36.35 21.05 18.675 6 17.575 37.075 23.674999999999997 21.675 7 17.45 16.525000000000002 42.65 23.375 8 18.925 21.425 28.7 30.95 9 19.900000000000002 22.925 30.0 27.175 10-14 21.985 29.044999999999998 26.325 22.645 15-19 21.825 27.400000000000002 27.66 23.115 20-24 21.675 28.415000000000003 27.615000000000002 22.295 25-29 22.165000000000003 28.415000000000003 27.529999999999998 21.89 30-34 21.279999999999998 28.299999999999997 27.625 22.795 35-39 21.54 28.660000000000004 27.26 22.54 40-44 20.925 28.799999999999997 27.655 22.62 45-49 21.15 28.785 27.495000000000005 22.57 50-54 21.445 28.27 28.205000000000002 22.08 55-59 21.811090554527727 28.191409570478527 28.0114005700285 21.986099304965247 60-64 21.711085554277716 28.676433821691084 27.411370568528426 22.201110055502777 65-69 22.12 27.639999999999997 28.125 22.115000000000002 70-74 21.92 28.449999999999996 27.62 22.009999999999998 75-79 22.36 28.335 27.365000000000002 21.94 80-84 22.33 27.685 27.735 22.25 85-89 22.165000000000003 28.02 27.634999999999998 22.18 90-94 22.34 28.095 27.555000000000003 22.009999999999998 95-99 21.87 28.26 28.04 21.83 100-104 22.49 28.375 27.22 21.915000000000003 105-109 22.14 28.035 28.16 21.665 110-114 22.065 28.625 27.01 22.3 115-119 21.965 29.020000000000003 27.51 21.505 120-124 22.42 28.095 26.985 22.5 125-129 22.355 28.305000000000003 27.875 21.465 130-134 22.97 28.199999999999996 27.245 21.584999999999997 135-139 22.545 27.465 28.425 21.565 140-144 22.09 28.13 27.41 22.37 145-149 21.975 27.810000000000002 28.439999999999998 21.775 150 21.975 27.474999999999998 29.25 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 4.5 26 5.0 27 8.0 28 9.5 29 11.5 30 13.0 31 16.5 32 28.0 33 32.0 34 46.0 35 75.0 36 97.0 37 110.5 38 129.5 39 164.0 40 197.5 41 218.5 42 249.5 43 260.5 44 263.5 45 271.5 46 261.5 47 258.5 48 237.0 49 207.0 50 182.5 51 144.0 52 105.5 53 83.0 54 75.5 55 61.5 56 39.5 57 27.5 58 26.5 59 19.5 60 11.0 61 8.5 62 10.0 63 8.5 64 4.0 65 3.5 66 1.0 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.225 #Duplication Level Percentage of deduplicated Percentage of total 1 85.27427398063948 72.675 2 12.408330888823702 21.15 3 2.0533880903490758 5.25 4 0.23467292461132297 0.8 5 0.02933411557641537 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAATTTTCTTATGGTAATGATTATTGGAAAAGTTATTGTTACAGTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTGAA 10 0.006973645 144.0 5 >>END_MODULE SRR13259397 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.295 37.0 37.0 37.0 37.0 37.0 2 36.2205 37.0 37.0 37.0 37.0 37.0 3 36.3485 37.0 37.0 37.0 37.0 37.0 4 36.4765 37.0 37.0 37.0 37.0 37.0 5 36.5045 37.0 37.0 37.0 37.0 37.0 6 36.3265 37.0 37.0 37.0 37.0 37.0 7 36.3115 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.531 37.0 37.0 37.0 37.0 37.0 10-14 36.433899999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.4287 37.0 37.0 37.0 37.0 37.0 20-24 36.4127 37.0 37.0 37.0 37.0 37.0 25-29 36.368 37.0 37.0 37.0 37.0 37.0 30-34 36.3062 37.0 37.0 37.0 37.0 37.0 35-39 36.2555 37.0 37.0 37.0 37.0 37.0 40-44 36.2514 37.0 37.0 37.0 37.0 37.0 45-49 36.228500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.185399999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.131099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.10379999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.090500000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.08749999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9799 37.0 37.0 37.0 37.0 37.0 80-84 35.9394 37.0 37.0 37.0 37.0 37.0 85-89 35.844 37.0 37.0 37.0 37.0 37.0 90-94 35.740199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7689 37.0 37.0 37.0 37.0 37.0 100-104 35.7693 37.0 37.0 37.0 37.0 37.0 105-109 35.726600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6908 37.0 37.0 37.0 37.0 37.0 115-119 35.6839 37.0 37.0 37.0 37.0 37.0 120-124 35.4533 37.0 37.0 37.0 37.0 37.0 125-129 35.458800000000004 37.0 37.0 37.0 34.6 37.0 130-134 35.3283 37.0 37.0 37.0 32.2 37.0 135-139 35.2353 37.0 37.0 37.0 29.8 37.0 140-144 35.3879 37.0 37.0 37.0 32.2 37.0 145-149 35.26180000000001 37.0 37.0 37.0 29.8 37.0 150 35.2855 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 3.0 24 11.0 25 7.0 26 4.0 27 8.0 28 16.0 29 17.0 30 22.0 31 26.0 32 46.0 33 71.0 34 162.0 35 754.0 36 2764.0 37 87.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.1 17.424999999999997 17.9 30.575000000000003 2 19.875 25.374999999999996 37.7 17.05 3 21.925 30.4 27.3 20.375 4 22.2 36.35 22.0 19.45 5 22.775000000000002 36.05 22.225 18.95 6 18.075 36.525 24.15 21.25 7 17.224999999999998 16.400000000000002 43.225 23.150000000000002 8 19.8 21.725 29.25 29.225 9 19.75 23.0 30.25 27.0 10-14 21.005 28.634999999999998 26.56 23.799999999999997 15-19 21.43 28.000000000000004 28.03 22.54 20-24 22.305 27.694999999999997 27.67 22.33 25-29 20.835 28.375 28.005000000000003 22.785 30-34 21.759999999999998 29.25 27.400000000000002 21.59 35-39 21.865000000000002 28.375 27.38 22.38 40-44 22.065 28.265 28.084999999999997 21.584999999999997 45-49 22.305 28.175 27.465 22.055 50-54 21.16 28.23 27.805000000000003 22.805 55-59 22.07 28.525 27.224999999999998 22.18 60-64 21.42 28.955 27.37 22.255 65-69 22.095000000000002 27.91 27.965 22.03 70-74 21.790000000000003 28.345 27.455000000000002 22.41 75-79 21.5 28.18 27.884999999999998 22.435 80-84 21.8 28.084999999999997 27.465 22.650000000000002 85-89 21.715 28.310000000000002 27.384999999999998 22.59 90-94 21.745 28.37 27.839999999999996 22.045 95-99 22.09 28.235 27.955000000000002 21.72 100-104 21.895 27.97 27.944999999999997 22.189999999999998 105-109 22.31 28.02 27.505000000000003 22.165000000000003 110-114 21.740000000000002 27.27 28.549999999999997 22.439999999999998 115-119 21.59 28.599999999999998 27.700000000000003 22.11 120-124 21.745 27.83 27.950000000000003 22.475 125-129 21.759999999999998 27.425 28.389999999999997 22.425 130-134 21.985 27.725 28.139999999999997 22.15 135-139 21.84 27.76 28.744999999999997 21.654999999999998 140-144 21.895 28.110000000000003 27.500000000000004 22.495 145-149 22.205 28.005000000000003 28.005000000000003 21.785 150 21.85 27.675 28.425 22.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.5 26 3.0 27 5.5 28 9.0 29 9.5 30 17.0 31 25.0 32 28.0 33 40.0 34 55.5 35 66.0 36 82.5 37 110.5 38 135.5 39 165.0 40 197.5 41 220.5 42 248.5 43 270.5 44 293.0 45 291.5 46 261.5 47 239.0 48 219.5 49 199.5 50 176.5 51 135.5 52 101.5 53 88.0 54 61.0 55 49.5 56 50.5 57 39.5 58 28.0 59 17.5 60 11.5 61 5.5 62 5.0 63 6.0 64 2.5 65 2.0 66 1.5 67 2.5 68 3.0 69 5.0 70 4.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.225 #Duplication Level Percentage of deduplicated Percentage of total 1 85.45027867409797 72.82499999999999 2 12.085655617483134 20.599999999999998 3 2.1707245526547374 5.55 4 0.26400704018773835 0.8999999999999999 5 0.02933411557641537 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAGCAGGCATGACAAGAAAAGTGAGGAAAAGAATATCCCAAGAAAATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0125 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.006139246 28.8 10-14 >>END_MODULE Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298447 spots for SRR13259397.sra Written 1298447 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra Read 1298433 spots for SRR13259397.sra Written 1298433 spots for SRR13259397.sra SRR ids: ['SRR13259397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qgoplloa SRR13259397.sra spots: 25968674 blocks: [[1, 1298433], [1298434, 2596866], [2596867, 3895299], [3895300, 5193732], [5193733, 6492165], [6492166, 7790598], [7790599, 9089031], [9089032, 10387464], [10387465, 11685897], [11685898, 12984330], [12984331, 14282763], [14282764, 15581196], [15581197, 16879629], [16879630, 18178062], [18178063, 19476495], [19476496, 20774928], [20774929, 22073361], [22073362, 23371794], [23371795, 24670227], [24670228, 25968674]] SRR13259397 file size 8752871 SRR13259397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259397 SRR13259397_1.fastq SRR13259397_2.fastq Input file: SRR13259397_1.fastq Paired file: SRR13259397_2.fastq trimmed: SRR13259397-trimmed-pair1.fastq, SRR13259397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:30:56 2025 >> started Fri Feb 14 04:31:40 2025 >> done (44.108s) 25968674 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 42 ( 0.00%) empty read pairs filtered out after trimming by size control 25968632 (100.00%) read pairs available; of these: 11657 ( 0.04%) trimmed read pairs available after processing 25956975 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 2 0.00% 41 2 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 2 0.00% 47 2 0.00% 48 1 0.00% 49 2 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 4 0.00% 68 2 0.00% 69 3 0.00% 70 7 0.00% 71 8 0.00% 72 1 0.00% 73 5 0.00% 74 5 0.00% 75 8 0.00% 76 6 0.00% 77 11 0.00% 78 9 0.00% 79 9 0.00% 80 11 0.00% 81 7 0.00% 82 11 0.00% 83 8 0.00% 84 11 0.00% 85 11 0.00% 86 15 0.00% 87 11 0.00% 88 15 0.00% 89 16 0.00% 90 16 0.00% 91 28 0.00% 92 35 0.00% 93 33 0.00% 94 27 0.00% 95 39 0.00% 96 31 0.00% 97 40 0.00% 98 37 0.00% 99 52 0.00% 100 41 0.00% 101 57 0.00% 102 47 0.00% 103 59 0.00% 104 64 0.00% 105 63 0.00% 106 52 0.00% 107 73 0.00% 108 89 0.00% 109 81 0.00% 110 93 0.00% 111 83 0.00% 112 82 0.00% 113 104 0.00% 114 97 0.00% 115 110 0.00% 116 113 0.00% 117 111 0.00% 118 127 0.00% 119 126 0.00% 120 158 0.00% 121 144 0.00% 122 170 0.00% 123 194 0.00% 124 155 0.00% 125 158 0.00% 126 165 0.00% 127 176 0.00% 128 191 0.00% 129 198 0.00% 130 216 0.00% 131 224 0.00% 132 220 0.00% 133 279 0.00% 134 288 0.00% 135 292 0.00% 136 295 0.00% 137 317 0.00% 138 285 0.00% 139 348 0.00% 140 358 0.00% 141 366 0.00% 142 403 0.00% 143 482 0.00% 144 413 0.00% 145 496 0.00% 146 518 0.00% 147 595 0.00% 148 628 0.00% 149 701 0.00% 150 25956975 99.96% 25968632 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.24 fanout-score-rank=13 prefix-density=0.33 prefix-fanout=4.2 sequence=TGCAAGTGCGGCAGCGGCTGTGGAGGATGCAAGATGTACCCTGACATGAGCTCCTCAGAGACGATCACCAACGAAACTCTGGTTCTTGGTGTGGCACCAGAGAAGGGTCACTTTGCGGGAGCTGCTGAGACGGTCGTGGGAGCCGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=194.07 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=27.6 sequence=CAGCAGCAGCAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.97 fanout-score-rank=17 prefix-density=0.28 prefix-fanout=3.4 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=254.72 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=26.6 sequence=AGCAGCAGCAGC SRR13259397 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:32:29 Started mapping on | Feb 14 04:32:30 Finished on | Feb 14 04:35:13 Mapping speed, Million of reads per hour | 573.54 Number of input reads | 25968632 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24547999 Uniquely mapped reads % | 94.53% Average mapped length | 298.29 Number of splices: Total | 24073941 Number of splices: Annotated (sjdb) | 23632434 Number of splices: GT/AG | 23664715 Number of splices: GC/AG | 341208 Number of splices: AT/AC | 19243 Number of splices: Non-canonical | 48775 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 669625 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 106746 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751008 751008 751008 N_multimapping 669625 669625 669625 N_noFeature 768140 12554551 12567208 N_ambiguous 325957 66040 66044 UnstrandedReadsAssigned:23453902 PositiveStrandReadsAssigned:11927408 NegativeStrandReadsAssigned:11914747 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259397-trimmed-pair1.fastq SRR13259397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,968,632 reads, 24,106,339 reads pseudoaligned [quant] estimated average fragment length: 238.246 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR13259397.ke.tsv 34699 SRR13259397.se.tsv 87100 total ==> SRR13259397.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.75 1635 32.9507 Potri.005G024800.1.v4.1 1035 797.754 1223 55.0184 Potri.004G059700.1.v4.1 961 723.754 16 0.793376 Potri.007G009000.2.v4.1 1416 1178.75 0 0 Potri.003G141000.2.v4.1 2943 2705.75 1200 15.9163 Potri.016G087400.1.v4.1 270 53.5292 1030 690.552 Potri.015G069301.1.v4.1 564 326.906 0 0 Potri.010G195200.1.v4.1 1773 1535.75 583.946 13.6459 Potri.012G127500.1.v4.1 977 739.754 1241 60.2053 ==> SRR13259397.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 24 SRR13259397 completed mapping pipeline successfully