Starting /dee2/code/volunteer_pipeline.sh SRR13259398 current disk space = 3086306889728 free memory = 1582608056 SRR13259398 SRAfilesize c686d3cb8849a767b19d05ac14867fbb SRR13259398.sra SRR13259398.sra file validated SRR13259398 is paired end SRR13259398 is conventional basespace SRR13259398 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5675 37.0 37.0 37.0 37.0 37.0 2 36.572 37.0 37.0 37.0 37.0 37.0 3 36.5615 37.0 37.0 37.0 37.0 37.0 4 36.584 37.0 37.0 37.0 37.0 37.0 5 36.711 37.0 37.0 37.0 37.0 37.0 6 36.471 37.0 37.0 37.0 37.0 37.0 7 36.602 37.0 37.0 37.0 37.0 37.0 8 36.6095 37.0 37.0 37.0 37.0 37.0 9 36.7085 37.0 37.0 37.0 37.0 37.0 10-14 36.607600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.617000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.581500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4982 37.0 37.0 37.0 37.0 37.0 30-34 36.4957 37.0 37.0 37.0 37.0 37.0 35-39 36.5236 37.0 37.0 37.0 37.0 37.0 40-44 36.4119 37.0 37.0 37.0 37.0 37.0 45-49 36.4136 37.0 37.0 37.0 37.0 37.0 50-54 36.450399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.36845 37.0 37.0 37.0 37.0 37.0 60-64 36.36615 37.0 37.0 37.0 37.0 37.0 65-69 36.2965 37.0 37.0 37.0 37.0 37.0 70-74 36.3103 37.0 37.0 37.0 37.0 37.0 75-79 36.2631 37.0 37.0 37.0 37.0 37.0 80-84 36.260400000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1819 37.0 37.0 37.0 37.0 37.0 90-94 36.2007 37.0 37.0 37.0 37.0 37.0 95-99 36.1828 37.0 37.0 37.0 37.0 37.0 100-104 36.0965 37.0 37.0 37.0 37.0 37.0 105-109 36.0629 37.0 37.0 37.0 37.0 37.0 110-114 36.0955 37.0 37.0 37.0 37.0 37.0 115-119 35.984899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.999 37.0 37.0 37.0 37.0 37.0 125-129 35.87429999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6814 37.0 37.0 37.0 37.0 37.0 135-139 35.8085 37.0 37.0 37.0 37.0 37.0 140-144 35.831199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.583800000000004 37.0 37.0 37.0 37.0 37.0 150 35.5475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 2.0 26 2.0 27 8.0 28 16.0 29 22.0 30 29.0 31 25.0 32 59.0 33 51.0 34 89.0 35 283.0 36 3188.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.325 17.45 16.975 31.25 2 18.925 25.55 40.025 15.5 3 21.125 29.325000000000003 28.025 21.525 4 23.5 35.025 21.5 19.975 5 22.2 36.5 23.1 18.2 6 17.8 35.175 24.95 22.075 7 16.7 15.5 44.074999999999996 23.724999999999998 8 19.15 21.125 29.575000000000003 30.15 9 20.175 22.7 29.549999999999997 27.575 10-14 21.215 29.005 26.810000000000002 22.97 15-19 21.54 27.41 28.7 22.35 20-24 21.295 28.475 28.139999999999997 22.09 25-29 21.455 28.7 27.93 21.915000000000003 30-34 21.595 28.335 28.16 21.91 35-39 21.095 28.775000000000002 27.950000000000003 22.18 40-44 22.055 28.345 27.46 22.14 45-49 21.335 27.889999999999997 28.044999999999998 22.73 50-54 21.795 28.83 27.02 22.355 55-59 22.056102805140256 27.78138906945347 28.171408570428518 21.99109955497775 60-64 21.92609630481524 28.901445072253612 26.89134456722836 22.281114055702787 65-69 21.790000000000003 27.584999999999997 28.115000000000002 22.509999999999998 70-74 21.525 27.529999999999998 28.955 21.990000000000002 75-79 21.985 28.175 27.61 22.23 80-84 21.925 28.16 27.810000000000002 22.105 85-89 22.17 27.694999999999997 28.17 21.965 90-94 22.52 28.375 27.384999999999998 21.72 95-99 21.84 27.905 28.549999999999997 21.705 100-104 21.935 28.065 27.41 22.59 105-109 22.009999999999998 28.64 27.495000000000005 21.855 110-114 22.73 27.205000000000002 28.58 21.485000000000003 115-119 22.05 28.125 27.665 22.16 120-124 21.75 27.894999999999996 28.395 21.959999999999997 125-129 22.75 27.725 27.955000000000002 21.57 130-134 22.1 27.88 28.044999999999998 21.975 135-139 22.355 28.03 27.88 21.735 140-144 22.34 28.005000000000003 28.235 21.42 145-149 21.57 28.48 27.98 21.97 150 21.325 28.749999999999996 28.599999999999998 21.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 2.0 25 4.0 26 5.0 27 6.5 28 10.0 29 15.0 30 21.5 31 25.5 32 26.5 33 39.5 34 53.0 35 62.5 36 92.5 37 115.0 38 140.5 39 155.5 40 185.0 41 238.5 42 250.5 43 262.0 44 277.0 45 275.5 46 272.0 47 247.5 48 224.0 49 224.0 50 190.5 51 126.5 52 89.0 53 78.0 54 67.5 55 55.5 56 47.5 57 32.0 58 13.5 59 15.0 60 16.0 61 9.5 62 7.5 63 5.5 64 4.5 65 2.5 66 0.5 67 0.0 68 1.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 84.94528246081042 71.8 2 12.392783200236616 20.95 3 2.188701567583555 5.55 4 0.354924578527063 1.2 5 0.11830819284235432 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAGTGTGCGGTCACTCAGATGGTGCGGGGCTGGTATAATAGATTGCT 5 0.125 No Hit AAATTCTTGGCATATTTCTGGTGGTGCTTTGACAGACTAAAGGAAAAAGC 5 0.125 No Hit CTTCTTTCCTGGTAAAATTCTGAGCCAAAATTAAGGAGGGAACCCTCGAC 5 0.125 No Hit CTGCTAAGTACCTTAATCTTGATTGTTACCTCATACTTCGTGCCTCAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259398 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259398_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4315 37.0 37.0 37.0 37.0 37.0 2 36.42 37.0 37.0 37.0 37.0 37.0 3 36.4265 37.0 37.0 37.0 37.0 37.0 4 36.474 37.0 37.0 37.0 37.0 37.0 5 36.4505 37.0 37.0 37.0 37.0 37.0 6 36.496 37.0 37.0 37.0 37.0 37.0 7 36.4025 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.536 37.0 37.0 37.0 37.0 37.0 10-14 36.4951 37.0 37.0 37.0 37.0 37.0 15-19 36.4739 37.0 37.0 37.0 37.0 37.0 20-24 36.474000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4272 37.0 37.0 37.0 37.0 37.0 30-34 36.3461 37.0 37.0 37.0 37.0 37.0 35-39 36.3454 37.0 37.0 37.0 37.0 37.0 40-44 36.3745 37.0 37.0 37.0 37.0 37.0 45-49 36.235400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.240700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2249 37.0 37.0 37.0 37.0 37.0 60-64 36.087599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1552 37.0 37.0 37.0 37.0 37.0 70-74 36.1654 37.0 37.0 37.0 37.0 37.0 75-79 36.0862 37.0 37.0 37.0 37.0 37.0 80-84 36.000800000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8834 37.0 37.0 37.0 37.0 37.0 90-94 35.8295 37.0 37.0 37.0 37.0 37.0 95-99 35.8622 37.0 37.0 37.0 37.0 37.0 100-104 35.8041 37.0 37.0 37.0 37.0 37.0 105-109 35.8125 37.0 37.0 37.0 37.0 37.0 110-114 35.6448 37.0 37.0 37.0 37.0 37.0 115-119 35.6454 37.0 37.0 37.0 37.0 37.0 120-124 35.464 37.0 37.0 37.0 34.6 37.0 125-129 35.53660000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.4834 37.0 37.0 37.0 37.0 37.0 135-139 35.3102 37.0 37.0 37.0 32.2 37.0 140-144 35.4478 37.0 37.0 37.0 37.0 37.0 145-149 35.255700000000004 37.0 37.0 37.0 27.4 37.0 150 35.232 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 7.0 26 4.0 27 6.0 28 11.0 29 20.0 30 25.0 31 35.0 32 54.0 33 55.0 34 126.0 35 684.0 36 2832.0 37 131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.525 18.475 16.8 32.2 2 20.549999999999997 26.025 37.35 16.075 3 19.175 31.55 27.85 21.425 4 23.0 35.025 21.65 20.325 5 22.35 37.375 20.825 19.45 6 17.25 35.775 24.55 22.425 7 15.825 15.825 44.7 23.65 8 19.775000000000002 22.375 28.775000000000002 29.075 9 20.625 22.375 29.5 27.500000000000004 10-14 21.285 29.29 26.435 22.99 15-19 21.68 28.405 27.994999999999997 21.92 20-24 20.95 28.395 27.935 22.720000000000002 25-29 21.63 28.084999999999997 28.035 22.25 30-34 21.425 28.660000000000004 28.065 21.85 35-39 21.5 28.43 27.99 22.08 40-44 21.525 28.77 27.495000000000005 22.21 45-49 21.310000000000002 28.76 27.345000000000002 22.585 50-54 21.285 28.575 27.834999999999997 22.305 55-59 21.404999999999998 29.04 26.945000000000004 22.61 60-64 21.36 29.01 27.41 22.220000000000002 65-69 22.365 28.79 27.04 21.805 70-74 21.555 28.875 27.595 21.975 75-79 22.065 28.189999999999998 28.07 21.675 80-84 21.535 28.38 27.605 22.48 85-89 21.72 28.21 27.74 22.33 90-94 21.89 28.349999999999998 27.62 22.14 95-99 21.834999999999997 28.27 27.855 22.040000000000003 100-104 21.385 28.29 27.615000000000002 22.71 105-109 21.68 28.87 27.634999999999998 21.815 110-114 21.884999999999998 28.349999999999998 27.845 21.92 115-119 21.72 28.355000000000004 28.125 21.8 120-124 22.005 28.105000000000004 28.235 21.654999999999998 125-129 21.785 28.470000000000002 27.794999999999998 21.95 130-134 21.645 28.125 27.965 22.264999999999997 135-139 21.69 28.365000000000002 27.91 22.035 140-144 21.965 28.310000000000002 27.92 21.805 145-149 21.425 27.815 28.38 22.38 150 21.224999999999998 28.875 28.050000000000004 21.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 0.5 24 1.5 25 3.5 26 4.5 27 6.0 28 8.0 29 12.0 30 21.5 31 34.0 32 40.5 33 48.5 34 68.0 35 79.5 36 86.5 37 106.5 38 132.5 39 164.0 40 200.0 41 218.5 42 237.5 43 246.5 44 256.5 45 278.0 46 272.5 47 261.0 48 236.0 49 191.0 50 176.0 51 145.0 52 93.5 53 75.5 54 61.0 55 53.5 56 45.0 57 34.5 58 27.0 59 17.5 60 11.0 61 10.5 62 11.0 63 6.5 64 3.5 65 3.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.5 #Duplication Level Percentage of deduplicated Percentage of total 1 84.8224852071006 71.675 2 12.603550295857987 21.3 3 2.100591715976331 5.325 4 0.35502958579881655 1.2 5 0.1183431952662722 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGGGTTTGGTGATCTTGAGGATTTTAGGGAAGGAAAGTTGTGGGCAT 5 0.125 No Hit TGAGCATGGGATGTTTCTTGATATGGCAACCACTGTTATTGTTGCAGGTG 5 0.125 No Hit CTTCACCAACTTTTCTTTTAAATCATTGGTGAGATTCACACTCCCAATTT 5 0.125 No Hit CAGCCTTCTCCCCAGCAATTTGTGCTAGAGTATTTCCAAGAATCTCCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGTCT 10 0.006973645 144.0 1 >>END_MODULE Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204528 spots for SRR13259398.sra Written 1204528 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra Read 1204527 spots for SRR13259398.sra Written 1204527 spots for SRR13259398.sra SRR ids: ['SRR13259398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y7vgtwh7 SRR13259398.sra spots: 24090541 blocks: [[1, 1204527], [1204528, 2409054], [2409055, 3613581], [3613582, 4818108], [4818109, 6022635], [6022636, 7227162], [7227163, 8431689], [8431690, 9636216], [9636217, 10840743], [10840744, 12045270], [12045271, 13249797], [13249798, 14454324], [14454325, 15658851], [15658852, 16863378], [16863379, 18067905], [18067906, 19272432], [19272433, 20476959], [20476960, 21681486], [21681487, 22886013], [22886014, 24090541]] SRR13259398 file size 8118267 SRR13259398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259398 SRR13259398_1.fastq SRR13259398_2.fastq Input file: SRR13259398_1.fastq Paired file: SRR13259398_2.fastq trimmed: SRR13259398-trimmed-pair1.fastq, SRR13259398-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:14:06 2025 >> started Fri Feb 14 05:14:35 2025 >> done (29.166s) 24090541 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 27 ( 0.00%) empty read pairs filtered out after trimming by size control 24090514 (100.00%) read pairs available; of these: 7512 ( 0.03%) trimmed read pairs available after processing 24083002 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 34 1 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 1 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 1 0.00% 65 0 0.00% 66 2 0.00% 67 0 0.00% 68 3 0.00% 69 2 0.00% 70 5 0.00% 71 3 0.00% 72 6 0.00% 73 3 0.00% 74 5 0.00% 75 3 0.00% 76 5 0.00% 77 9 0.00% 78 1 0.00% 79 6 0.00% 80 6 0.00% 81 8 0.00% 82 7 0.00% 83 7 0.00% 84 5 0.00% 85 7 0.00% 86 10 0.00% 87 10 0.00% 88 10 0.00% 89 12 0.00% 90 9 0.00% 91 11 0.00% 92 14 0.00% 93 13 0.00% 94 21 0.00% 95 31 0.00% 96 31 0.00% 97 27 0.00% 98 31 0.00% 99 26 0.00% 100 19 0.00% 101 35 0.00% 102 38 0.00% 103 33 0.00% 104 42 0.00% 105 37 0.00% 106 51 0.00% 107 46 0.00% 108 66 0.00% 109 58 0.00% 110 61 0.00% 111 45 0.00% 112 62 0.00% 113 56 0.00% 114 64 0.00% 115 87 0.00% 116 76 0.00% 117 82 0.00% 118 73 0.00% 119 71 0.00% 120 85 0.00% 121 93 0.00% 122 99 0.00% 123 100 0.00% 124 97 0.00% 125 118 0.00% 126 130 0.00% 127 124 0.00% 128 117 0.00% 129 148 0.00% 130 140 0.00% 131 154 0.00% 132 148 0.00% 133 155 0.00% 134 183 0.00% 135 184 0.00% 136 195 0.00% 137 199 0.00% 138 181 0.00% 139 214 0.00% 140 224 0.00% 141 262 0.00% 142 260 0.00% 143 270 0.00% 144 249 0.00% 145 311 0.00% 146 335 0.00% 147 375 0.00% 148 395 0.00% 149 504 0.00% 150 24083002 99.97% 24090514 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=9.41 fanout-score-rank=10 prefix-density=0.29 prefix-fanout=4.6 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=203.33 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=22.9 sequence=GCAGCAGCAACAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=9.66 fanout-score-rank=14 prefix-density=0.28 prefix-fanout=4.7 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=175.77 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=27.6 sequence=CAGCAGCAGCAA SRR13259398 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:15:17 Started mapping on | Feb 14 05:15:17 Finished on | Feb 14 05:17:08 Mapping speed, Million of reads per hour | 781.31 Number of input reads | 24090514 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22895607 Uniquely mapped reads % | 95.04% Average mapped length | 298.38 Number of splices: Total | 22634819 Number of splices: Annotated (sjdb) | 22226765 Number of splices: GT/AG | 22239846 Number of splices: GC/AG | 328507 Number of splices: AT/AC | 18234 Number of splices: Non-canonical | 48232 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527136 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 67224 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667771 667771 667771 N_multimapping 527136 527136 527136 N_noFeature 717507 11715783 11716041 N_ambiguous 316346 67926 67733 UnstrandedReadsAssigned:21861754 PositiveStrandReadsAssigned:11111898 NegativeStrandReadsAssigned:11111833 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259398 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259398-trimmed-pair1.fastq SRR13259398-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,090,514 reads, 22,337,554 reads pseudoaligned [quant] estimated average fragment length: 248.019 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR13259398.ke.tsv 34699 SRR13259398.se.tsv 87100 total ==> SRR13259398.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.98 1379 31.2515 Potri.005G024800.1.v4.1 1035 787.981 854 43.4973 Potri.004G059700.1.v4.1 961 713.986 7 0.393485 Potri.007G009000.2.v4.1 1416 1168.98 0 0 Potri.003G141000.2.v4.1 2943 2695.98 1034.95 15.4071 Potri.016G087400.1.v4.1 270 50.2164 880 703.327 Potri.015G069301.1.v4.1 564 317.117 0 0 Potri.010G195200.1.v4.1 1773 1525.98 253.718 6.67303 Potri.012G127500.1.v4.1 977 729.981 2573 141.465 ==> SRR13259398.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR13259398 completed mapping pipeline successfully