Starting /dee2/code/volunteer_pipeline.sh SRR13259399 current disk space = 3086118596608 free memory = 1580638396 SRR13259399 SRAfilesize 86e9ce083cf0f306bc52b68ae62466a0 SRR13259399.sra SRR13259399.sra file validated SRR13259399 is paired end SRR13259399 is conventional basespace SRR13259399 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.626 37.0 37.0 37.0 37.0 37.0 2 36.6115 37.0 37.0 37.0 37.0 37.0 3 36.5715 37.0 37.0 37.0 37.0 37.0 4 36.5895 37.0 37.0 37.0 37.0 37.0 5 36.67 37.0 37.0 37.0 37.0 37.0 6 36.5435 37.0 37.0 37.0 37.0 37.0 7 36.702 37.0 37.0 37.0 37.0 37.0 8 36.617 37.0 37.0 37.0 37.0 37.0 9 36.675 37.0 37.0 37.0 37.0 37.0 10-14 36.5692 37.0 37.0 37.0 37.0 37.0 15-19 36.5998 37.0 37.0 37.0 37.0 37.0 20-24 36.5761 37.0 37.0 37.0 37.0 37.0 25-29 36.499100000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4307 37.0 37.0 37.0 37.0 37.0 35-39 36.433499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3632 37.0 37.0 37.0 37.0 37.0 45-49 36.388999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.375099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.30799999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.267100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.188900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1879 37.0 37.0 37.0 37.0 37.0 75-79 36.1136 37.0 37.0 37.0 37.0 37.0 80-84 36.1586 37.0 37.0 37.0 37.0 37.0 85-89 36.159000000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1144 37.0 37.0 37.0 37.0 37.0 95-99 36.045399999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.990300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.036 37.0 37.0 37.0 37.0 37.0 110-114 35.9773 37.0 37.0 37.0 37.0 37.0 115-119 35.9125 37.0 37.0 37.0 37.0 37.0 120-124 35.8908 37.0 37.0 37.0 37.0 37.0 125-129 35.7306 37.0 37.0 37.0 37.0 37.0 130-134 35.6252 37.0 37.0 37.0 37.0 37.0 135-139 35.673199999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.712599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5052 37.0 37.0 37.0 37.0 37.0 150 35.387 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 2.0 20 2.0 21 2.0 22 2.0 23 1.0 24 2.0 25 3.0 26 7.0 27 12.0 28 20.0 29 23.0 30 30.0 31 41.0 32 50.0 33 52.0 34 79.0 35 275.0 36 3174.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.249999999999996 15.75 21.275 34.725 2 21.875 24.45 35.199999999999996 18.475 3 22.900000000000002 29.925 27.825 19.35 4 24.75 34.699999999999996 22.2 18.35 5 24.55 34.35 21.975 19.125 6 18.575 37.7 23.175 20.549999999999997 7 16.75 17.25 42.575 23.425 8 20.225 21.675 27.025 31.075000000000003 9 19.900000000000002 22.625 30.8 26.674999999999997 10-14 21.895 28.084999999999997 27.334999999999997 22.685 15-19 21.185000000000002 28.43 28.155 22.23 20-24 21.445 28.544999999999998 27.200000000000003 22.81 25-29 21.185000000000002 28.28 27.855 22.68 30-34 21.945 28.88 27.48 21.695 35-39 21.925 29.044999999999998 27.505000000000003 21.525 40-44 21.349999999999998 28.749999999999996 27.615000000000002 22.285 45-49 21.665 28.389999999999997 27.605 22.34 50-54 22.08 28.105000000000004 27.83 21.985 55-59 22.197219721972196 27.807780778077806 27.917791779177918 22.077207720772076 60-64 21.342134213421343 28.54785478547855 27.93779377937794 22.172217221722175 65-69 21.875 28.485 27.055 22.585 70-74 22.35 28.849999999999998 27.150000000000002 21.65 75-79 21.61 28.46 28.09 21.84 80-84 22.439999999999998 28.144999999999996 27.389999999999997 22.025 85-89 22.2 28.605000000000004 27.015 22.18 90-94 21.43 27.534999999999997 28.360000000000003 22.675 95-99 22.505 27.36 28.03 22.105 100-104 23.044999999999998 27.944999999999997 27.415 21.595 105-109 22.384999999999998 27.834999999999997 28.095 21.685 110-114 21.98 27.650000000000002 28.08 22.29 115-119 22.075 28.084999999999997 28.24 21.6 120-124 21.895 28.29 28.02 21.795 125-129 21.485000000000003 28.345 28.22 21.95 130-134 22.16 27.639999999999997 28.53 21.67 135-139 22.615 27.01 28.084999999999997 22.29 140-144 22.225 27.955000000000002 28.23 21.59 145-149 22.345000000000002 28.345 27.615000000000002 21.695 150 21.375 27.400000000000002 28.15 23.075000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.0 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 2.0 26 4.5 27 8.5 28 12.5 29 17.5 30 22.5 31 24.5 32 29.5 33 44.0 34 53.5 35 66.0 36 89.5 37 104.5 38 125.5 39 169.5 40 208.0 41 231.5 42 242.0 43 255.5 44 273.0 45 289.0 46 269.5 47 234.0 48 223.0 49 178.5 50 138.0 51 135.0 52 124.5 53 91.0 54 61.5 55 45.0 56 35.5 57 36.0 58 29.5 59 21.0 60 15.5 61 14.0 62 13.5 63 10.0 64 8.5 65 6.5 66 5.5 67 3.5 68 2.5 69 3.0 70 2.0 71 1.0 72 1.5 73 1.0 74 1.5 75 1.0 76 1.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.575 #Duplication Level Percentage of deduplicated Percentage of total 1 83.87675740352977 70.1 2 13.221657194137002 22.1 3 2.3332336224947654 5.8500000000000005 4 0.5085252766975771 1.7000000000000002 5 0.05982650314089141 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGCCATTCAAGTTTCGTAAATGTTCGCACGCAAAGCATTTCTGAGATAT 5 0.125 No Hit GAAATGGTGATATGATCTAAAAGCAACATGGGAAGCTGGGGTCCCAGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGAT 10 0.006973645 144.0 1 >>END_MODULE SRR13259399 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259399_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.387 37.0 37.0 37.0 37.0 37.0 2 36.448 37.0 37.0 37.0 37.0 37.0 3 36.4245 37.0 37.0 37.0 37.0 37.0 4 36.384 37.0 37.0 37.0 37.0 37.0 5 36.4055 37.0 37.0 37.0 37.0 37.0 6 36.419 37.0 37.0 37.0 37.0 37.0 7 36.406 37.0 37.0 37.0 37.0 37.0 8 36.513 37.0 37.0 37.0 37.0 37.0 9 36.43 37.0 37.0 37.0 37.0 37.0 10-14 36.4553 37.0 37.0 37.0 37.0 37.0 15-19 36.469300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.397000000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.3695 37.0 37.0 37.0 37.0 37.0 30-34 36.36 37.0 37.0 37.0 37.0 37.0 35-39 36.31320000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.278800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.198699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.183299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.14149999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.0713 37.0 37.0 37.0 37.0 37.0 65-69 36.032900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0654 37.0 37.0 37.0 37.0 37.0 75-79 35.9897 37.0 37.0 37.0 37.0 37.0 80-84 35.9382 37.0 37.0 37.0 37.0 37.0 85-89 35.7495 37.0 37.0 37.0 37.0 37.0 90-94 35.8121 37.0 37.0 37.0 37.0 37.0 95-99 35.76520000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.768499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7572 37.0 37.0 37.0 37.0 37.0 110-114 35.6399 37.0 37.0 37.0 37.0 37.0 115-119 35.6726 37.0 37.0 37.0 37.0 37.0 120-124 35.4461 37.0 37.0 37.0 34.6 37.0 125-129 35.42550000000001 37.0 37.0 37.0 34.6 37.0 130-134 35.3728 37.0 37.0 37.0 29.8 37.0 135-139 35.282000000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.2886 37.0 37.0 37.0 27.4 37.0 145-149 35.1478 37.0 37.0 37.0 27.4 37.0 150 35.2845 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 7.0 24 4.0 25 7.0 26 7.0 27 14.0 28 9.0 29 17.0 30 26.0 31 38.0 32 43.0 33 65.0 34 151.0 35 677.0 36 2842.0 37 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.0 17.65 23.25 33.1 2 22.05 25.4 34.825 17.724999999999998 3 22.0 31.0 26.35 20.65 4 24.474999999999998 34.849999999999994 18.825 21.85 5 22.275 37.65 22.45 17.625 6 18.325 37.5 22.375 21.8 7 17.825 17.1 41.6 23.474999999999998 8 20.775 21.175 28.075 29.975 9 20.599999999999998 23.375 28.775000000000002 27.250000000000004 10-14 21.4 29.220000000000002 26.419999999999998 22.96 15-19 21.575 28.035 27.58 22.81 20-24 20.7 29.154999999999998 27.685 22.46 25-29 21.115000000000002 28.055000000000003 28.505000000000003 22.325 30-34 21.38 28.549999999999997 27.38 22.689999999999998 35-39 21.965 29.07 27.1 21.865000000000002 40-44 21.4 28.115000000000002 27.63 22.855 45-49 21.515 28.515 27.365000000000002 22.605 50-54 21.884999999999998 28.01 27.565 22.54 55-59 21.375 28.415000000000003 27.855 22.355 60-64 21.355 28.87 27.97 21.805 65-69 22.245 28.7 26.825 22.23 70-74 21.425 27.939999999999998 27.555000000000003 23.080000000000002 75-79 22.645 28.09 27.555000000000003 21.709999999999997 80-84 21.19 28.035 27.67 23.105 85-89 21.94 28.470000000000002 27.560000000000002 22.03 90-94 21.51 28.405 27.91 22.175 95-99 21.745 27.994999999999997 28.315 21.945 100-104 22.355 28.22 27.544999999999998 21.88 105-109 21.685 28.299999999999997 27.85 22.165000000000003 110-114 22.465 27.765 27.35 22.42 115-119 21.945 28.825 27.395000000000003 21.834999999999997 120-124 21.9 28.215 27.700000000000003 22.185 125-129 21.95 27.615000000000002 27.725 22.71 130-134 22.355 27.965 27.66 22.02 135-139 21.790000000000003 27.665 28.365000000000002 22.18 140-144 21.23 27.650000000000002 29.049999999999997 22.07 145-149 22.400000000000002 27.505000000000003 27.750000000000004 22.345000000000002 150 22.650000000000002 26.5 28.95 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 0.5 21 1.5 22 2.0 23 1.5 24 2.5 25 3.0 26 5.0 27 7.0 28 9.5 29 12.0 30 18.5 31 32.0 32 37.5 33 37.5 34 47.0 35 72.0 36 100.5 37 117.0 38 137.5 39 169.5 40 187.5 41 196.0 42 244.0 43 278.0 44 264.0 45 280.5 46 277.0 47 242.5 48 212.5 49 175.0 50 167.5 51 144.5 52 101.5 53 78.0 54 65.5 55 47.0 56 36.0 57 35.0 58 28.5 59 24.5 60 18.5 61 17.5 62 14.0 63 10.0 64 8.5 65 4.5 66 3.5 67 3.0 68 2.0 69 3.0 70 1.5 71 0.0 72 2.0 73 2.0 74 1.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.95 #Duplication Level Percentage of deduplicated Percentage of total 1 84.24657534246576 70.72500000000001 2 13.013698630136986 21.85 3 2.20369267421084 5.55 4 0.44669446098868376 1.5 5 0.08933889219773675 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGGAGATGTTCCTTTTGACTACTGGGAATGGTACTGTTGAAGTACTATC 5 0.125 No Hit CTTGGGATAGGCAAATCAGAGCAGCAGAACTCTACTGTGCCAAAGCACTT 5 0.125 No Hit ATAAGCTTGAGCACAGGGGTATCACTCTTTTTGGGAAGGTTTGTGTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGAGT 10 0.006973645 144.0 6 GTACTGA 10 0.006973645 144.0 4 GATCGTC 10 0.006973645 144.0 5 TTGACCC 10 0.006973645 144.0 5 ATCGTCC 10 0.006973645 144.0 6 TACCACC 10 0.006973645 144.0 6 >>END_MODULE Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362901 spots for SRR13259399.sra Written 1362901 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra Read 1362885 spots for SRR13259399.sra Written 1362885 spots for SRR13259399.sra SRR ids: ['SRR13259399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s9yau4as SRR13259399.sra spots: 27257716 blocks: [[1, 1362885], [1362886, 2725770], [2725771, 4088655], [4088656, 5451540], [5451541, 6814425], [6814426, 8177310], [8177311, 9540195], [9540196, 10903080], [10903081, 12265965], [12265966, 13628850], [13628851, 14991735], [14991736, 16354620], [16354621, 17717505], [17717506, 19080390], [19080391, 20443275], [20443276, 21806160], [21806161, 23169045], [23169046, 24531930], [24531931, 25894815], [25894816, 27257716]] SRR13259399 file size 9188426 SRR13259399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259399 SRR13259399_1.fastq SRR13259399_2.fastq Input file: SRR13259399_1.fastq Paired file: SRR13259399_2.fastq trimmed: SRR13259399-trimmed-pair1.fastq, SRR13259399-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:32:26 2025 >> started Fri Feb 14 05:32:56 2025 >> done (29.363s) 27257716 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 69 ( 0.00%) empty read pairs filtered out after trimming by size control 27257647 (100.00%) read pairs available; of these: 11601 ( 0.04%) trimmed read pairs available after processing 27246046 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 2 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 0 0.00% 49 4 0.00% 50 4 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 1 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 0 0.00% 65 1 0.00% 66 0 0.00% 67 1 0.00% 68 1 0.00% 69 2 0.00% 70 3 0.00% 71 5 0.00% 72 4 0.00% 73 7 0.00% 74 2 0.00% 75 6 0.00% 76 8 0.00% 77 4 0.00% 78 6 0.00% 79 6 0.00% 80 7 0.00% 81 5 0.00% 82 10 0.00% 83 12 0.00% 84 10 0.00% 85 7 0.00% 86 7 0.00% 87 8 0.00% 88 7 0.00% 89 11 0.00% 90 15 0.00% 91 15 0.00% 92 30 0.00% 93 20 0.00% 94 20 0.00% 95 23 0.00% 96 21 0.00% 97 27 0.00% 98 38 0.00% 99 29 0.00% 100 55 0.00% 101 42 0.00% 102 45 0.00% 103 43 0.00% 104 54 0.00% 105 58 0.00% 106 81 0.00% 107 68 0.00% 108 72 0.00% 109 71 0.00% 110 85 0.00% 111 76 0.00% 112 95 0.00% 113 97 0.00% 114 97 0.00% 115 112 0.00% 116 110 0.00% 117 117 0.00% 118 121 0.00% 119 114 0.00% 120 122 0.00% 121 152 0.00% 122 156 0.00% 123 155 0.00% 124 156 0.00% 125 204 0.00% 126 184 0.00% 127 185 0.00% 128 197 0.00% 129 207 0.00% 130 244 0.00% 131 236 0.00% 132 224 0.00% 133 269 0.00% 134 305 0.00% 135 291 0.00% 136 333 0.00% 137 318 0.00% 138 295 0.00% 139 336 0.00% 140 332 0.00% 141 381 0.00% 142 421 0.00% 143 420 0.00% 144 425 0.00% 145 458 0.00% 146 541 0.00% 147 612 0.00% 148 725 0.00% 149 699 0.00% 150 27246046 99.96% 27257647 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=19 prefix-density=0.41 prefix-fanout=2.1 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=39.39 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.5 sequence=TTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.40 fanout-score-rank=12 prefix-density=0.60 prefix-fanout=2.1 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=59.33 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.1 sequence=TTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCT SRR13259399 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:33:41 Started mapping on | Feb 14 05:33:41 Finished on | Feb 14 05:37:15 Mapping speed, Million of reads per hour | 458.54 Number of input reads | 27257647 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 25183812 Uniquely mapped reads % | 92.39% Average mapped length | 298.23 Number of splices: Total | 24193311 Number of splices: Annotated (sjdb) | 23703673 Number of splices: GT/AG | 23803926 Number of splices: GC/AG | 314937 Number of splices: AT/AC | 19593 Number of splices: Non-canonical | 54855 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 758123 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 86872 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1315712 1315712 1315712 N_multimapping 758123 758123 758123 N_noFeature 702191 12840964 12890054 N_ambiguous 289772 67309 68060 UnstrandedReadsAssigned:24191849 PositiveStrandReadsAssigned:12275539 NegativeStrandReadsAssigned:12225698 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259399 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259399-trimmed-pair1.fastq SRR13259399-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,257,647 reads, 24,774,764 reads pseudoaligned [quant] estimated average fragment length: 240.198 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR13259399.ke.tsv 34699 SRR13259399.se.tsv 87100 total ==> SRR13259399.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.8 3648.55 67.2088 Potri.005G024800.1.v4.1 1035 795.802 1609 66.2499 Potri.004G059700.1.v4.1 961 721.822 26 1.18026 Potri.007G009000.2.v4.1 1416 1176.8 0 0 Potri.003G141000.2.v4.1 2943 2703.8 1283 15.5484 Potri.016G087400.1.v4.1 270 53.0996 1460 900.939 Potri.015G069301.1.v4.1 564 324.954 0 0 Potri.010G195200.1.v4.1 1773 1533.8 1670 35.6764 Potri.012G127500.1.v4.1 977 737.822 3473 154.237 ==> SRR13259399.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 480 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 360 SRR13259399 completed mapping pipeline successfully