Starting /dee2/code/volunteer_pipeline.sh SRR13259400 current disk space = 3085856010240 free memory = 1578316404 SRR13259400 SRAfilesize 310878e265170634eae654a2b3a6c977 SRR13259400.sra SRR13259400.sra file validated SRR13259400 is paired end SRR13259400 is conventional basespace SRR13259400 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.608 37.0 37.0 37.0 37.0 37.0 2 36.622 37.0 37.0 37.0 37.0 37.0 3 36.6775 37.0 37.0 37.0 37.0 37.0 4 36.56 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.646 37.0 37.0 37.0 37.0 37.0 8 36.6275 37.0 37.0 37.0 37.0 37.0 9 36.6585 37.0 37.0 37.0 37.0 37.0 10-14 36.6155 37.0 37.0 37.0 37.0 37.0 15-19 36.5982 37.0 37.0 37.0 37.0 37.0 20-24 36.54559999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.479699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.46379999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.434799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4202 37.0 37.0 37.0 37.0 37.0 45-49 36.4169 37.0 37.0 37.0 37.0 37.0 50-54 36.4375 37.0 37.0 37.0 37.0 37.0 55-59 36.36245 37.0 37.0 37.0 37.0 37.0 60-64 36.331450000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.269600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.303200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2512 37.0 37.0 37.0 37.0 37.0 80-84 36.2447 37.0 37.0 37.0 37.0 37.0 85-89 36.2566 37.0 37.0 37.0 37.0 37.0 90-94 36.1357 37.0 37.0 37.0 37.0 37.0 95-99 36.168499999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0378 37.0 37.0 37.0 37.0 37.0 105-109 36.0937 37.0 37.0 37.0 37.0 37.0 110-114 36.06660000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.9593 37.0 37.0 37.0 37.0 37.0 120-124 35.9675 37.0 37.0 37.0 37.0 37.0 125-129 35.8905 37.0 37.0 37.0 37.0 37.0 130-134 35.6473 37.0 37.0 37.0 37.0 37.0 135-139 35.7278 37.0 37.0 37.0 37.0 37.0 140-144 35.818799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.605799999999995 37.0 37.0 37.0 37.0 37.0 150 35.6955 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 0.0 20 0.0 21 1.0 22 1.0 23 3.0 24 3.0 25 4.0 26 4.0 27 2.0 28 18.0 29 19.0 30 28.0 31 34.0 32 38.0 33 56.0 34 94.0 35 283.0 36 3215.0 37 194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.65 16.675 22.825 31.85 2 20.549999999999997 24.2 38.2 17.05 3 20.7 29.049999999999997 29.125 21.125 4 22.900000000000002 34.65 21.425 21.025 5 22.400000000000002 37.1 22.25 18.25 6 17.150000000000002 38.125 23.325000000000003 21.4 7 17.125 16.825000000000003 43.1 22.95 8 19.35 23.25 27.775 29.625 9 19.575 23.75 28.749999999999996 27.925 10-14 20.74 28.249999999999996 27.905 23.105 15-19 21.675 28.189999999999998 27.88 22.255 20-24 21.805 28.585 27.515 22.095000000000002 25-29 21.415 29.2 27.435 21.95 30-34 21.345 29.145 27.42 22.09 35-39 21.834999999999997 28.945 27.505000000000003 21.715 40-44 21.61 28.660000000000004 27.655 22.075 45-49 21.195 29.110000000000003 27.525 22.17 50-54 21.82 28.38 28.035 21.765 55-59 21.791089554477725 28.86144307215361 27.43637181859093 21.911095554777738 60-64 21.646082304115204 28.14140707035352 27.341367068353417 22.87114355717786 65-69 21.925 28.43 27.589999999999996 22.055 70-74 21.755 27.955000000000002 28.1 22.189999999999998 75-79 21.715 28.84 27.224999999999998 22.220000000000002 80-84 21.709999999999997 28.384999999999998 27.794999999999998 22.11 85-89 22.14 27.82 27.584999999999997 22.455 90-94 21.5 28.660000000000004 27.405 22.435 95-99 22.685 28.105000000000004 27.755000000000003 21.455 100-104 21.615000000000002 28.915000000000003 27.49 21.98 105-109 22.525000000000002 27.67 28.065 21.740000000000002 110-114 21.85 28.12 27.935 22.095000000000002 115-119 21.8 27.860000000000003 27.900000000000002 22.439999999999998 120-124 22.13 28.244999999999997 28.139999999999997 21.485000000000003 125-129 21.735 28.189999999999998 27.92 22.155 130-134 22.17 27.834999999999997 28.055000000000003 21.94 135-139 21.785 27.825 28.515 21.875 140-144 21.54 28.09 27.865000000000002 22.505 145-149 21.51 27.76 28.310000000000002 22.42 150 22.1 28.1 28.349999999999998 21.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 2.0 25 5.0 26 4.0 27 3.5 28 7.0 29 9.5 30 16.5 31 19.0 32 23.0 33 37.0 34 57.0 35 72.0 36 93.0 37 117.0 38 132.0 39 165.0 40 198.5 41 239.5 42 291.0 43 295.0 44 281.0 45 273.5 46 264.0 47 242.5 48 213.5 49 198.0 50 166.0 51 124.0 52 101.5 53 84.5 54 61.0 55 46.0 56 41.0 57 30.0 58 17.5 59 14.5 60 12.0 61 9.5 62 5.5 63 2.0 64 2.5 65 4.5 66 3.5 67 2.0 68 2.5 69 2.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.1 #Duplication Level Percentage of deduplicated Percentage of total 1 85.51703877790834 72.775 2 11.868390129259694 20.200000000000003 3 2.2326674500587544 5.7 4 0.35252643948296125 1.2 5 0.02937720329024677 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGAATCCAAACCTGATGTGGGCTCATCTAGTAGTAGCAAGCTTGGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0125 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCAG 10 0.006973645 144.0 6 AAACACT 10 0.006973645 144.0 4 GACATCT 10 0.006973645 144.0 3 CTCAGAA 10 0.006973645 144.0 8 CAGACAT 10 0.006973645 144.0 1 CTAAAAC 10 0.006973645 144.0 1 AAAACAC 10 0.006973645 144.0 3 AACACTC 10 0.006973645 144.0 5 >>END_MODULE SRR13259400 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259400_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3395 37.0 37.0 37.0 37.0 37.0 2 36.421 37.0 37.0 37.0 37.0 37.0 3 36.4795 37.0 37.0 37.0 37.0 37.0 4 36.3555 37.0 37.0 37.0 37.0 37.0 5 36.462 37.0 37.0 37.0 37.0 37.0 6 36.4805 37.0 37.0 37.0 37.0 37.0 7 36.4385 37.0 37.0 37.0 37.0 37.0 8 36.5925 37.0 37.0 37.0 37.0 37.0 9 36.453 37.0 37.0 37.0 37.0 37.0 10-14 36.4606 37.0 37.0 37.0 37.0 37.0 15-19 36.4746 37.0 37.0 37.0 37.0 37.0 20-24 36.4347 37.0 37.0 37.0 37.0 37.0 25-29 36.4409 37.0 37.0 37.0 37.0 37.0 30-34 36.404900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3601 37.0 37.0 37.0 37.0 37.0 40-44 36.3061 37.0 37.0 37.0 37.0 37.0 45-49 36.2903 37.0 37.0 37.0 37.0 37.0 50-54 36.238099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.23559999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.101600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.098400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1352 37.0 37.0 37.0 37.0 37.0 75-79 36.0246 37.0 37.0 37.0 37.0 37.0 80-84 36.004099999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.8645 37.0 37.0 37.0 37.0 37.0 90-94 35.8562 37.0 37.0 37.0 37.0 37.0 95-99 35.923700000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8264 37.0 37.0 37.0 37.0 37.0 105-109 35.8466 37.0 37.0 37.0 37.0 37.0 110-114 35.696 37.0 37.0 37.0 37.0 37.0 115-119 35.7429 37.0 37.0 37.0 37.0 37.0 120-124 35.514300000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.5725 37.0 37.0 37.0 37.0 37.0 130-134 35.467999999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.347500000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.427299999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.260200000000005 37.0 37.0 37.0 29.8 37.0 150 35.4105 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 1.0 24 3.0 25 3.0 26 9.0 27 5.0 28 17.0 29 14.0 30 20.0 31 31.0 32 39.0 33 65.0 34 131.0 35 681.0 36 2870.0 37 105.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4 19.3 22.650000000000002 28.65 2 21.75 25.6 34.425 18.224999999999998 3 21.5 30.95 27.85 19.7 4 23.35 34.175 21.875 20.599999999999998 5 23.9 35.55 21.6 18.95 6 17.45 38.025 22.825 21.7 7 15.950000000000001 17.424999999999997 43.875 22.75 8 20.175 21.2 28.375 30.25 9 19.900000000000002 23.275000000000002 28.825 28.000000000000004 10-14 20.77 29.255 26.695 23.28 15-19 20.599999999999998 28.115000000000002 28.465 22.82 20-24 21.685 28.410000000000004 27.58 22.325 25-29 21.39 28.470000000000002 28.235 21.905 30-34 21.81 28.494999999999997 28.03 21.665 35-39 21.7 28.18 27.98 22.14 40-44 21.9 28.59 27.439999999999998 22.07 45-49 21.654999999999998 28.9 27.384999999999998 22.06 50-54 21.27 28.744999999999997 27.83 22.155 55-59 21.38 28.560000000000002 27.54 22.52 60-64 22.29 28.199999999999996 27.650000000000002 21.86 65-69 21.72 27.83 28.04 22.41 70-74 21.915000000000003 28.42 27.61 22.055 75-79 21.955 28.325 27.334999999999997 22.384999999999998 80-84 21.425 28.275 28.139999999999997 22.16 85-89 21.884999999999998 28.57 27.205000000000002 22.34 90-94 21.595 28.525 27.77 22.11 95-99 22.435 27.224999999999998 28.115000000000002 22.225 100-104 21.855 28.28 27.529999999999998 22.335 105-109 21.955 28.525 27.515 22.005 110-114 21.884999999999998 28.185 27.855 22.075 115-119 22.375 27.944999999999997 27.955000000000002 21.725 120-124 22.23 27.505000000000003 28.294999999999998 21.97 125-129 21.925 28.060000000000002 27.994999999999997 22.02 130-134 22.355 28.000000000000004 28.04 21.605 135-139 21.55 27.860000000000003 29.065 21.525 140-144 22.355 27.700000000000003 28.549999999999997 21.395 145-149 22.055 27.73 28.24 21.975 150 21.9 26.974999999999998 28.599999999999998 22.525000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.0 24 3.0 25 3.5 26 6.5 27 7.5 28 6.5 29 10.0 30 14.5 31 21.0 32 26.5 33 35.5 34 57.0 35 73.5 36 90.5 37 115.0 38 128.0 39 159.0 40 204.0 41 219.0 42 260.5 43 300.5 44 286.0 45 266.5 46 251.5 47 249.0 48 235.5 49 212.5 50 182.0 51 138.5 52 101.5 53 80.5 54 72.5 55 50.0 56 32.0 57 24.5 58 13.5 59 9.0 60 12.0 61 10.5 62 4.5 63 2.0 64 5.0 65 5.0 66 1.5 67 1.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.86065573770492 73.32499999999999 2 11.563231850117097 19.75 3 2.224824355971897 5.7 4 0.32201405152224827 1.0999999999999999 5 0.02927400468384075 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTGTACCCACATCTAACTGTGACTGAAACTCTTCTGTTCACTGCACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0125 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.025 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0125 0.0 0.0 0.0 0.025 110-111 0.025 0.0 0.0 0.0 0.025 112-113 0.025 0.0 0.0 0.0 0.025 114-115 0.025 0.0 0.0 0.0 0.025 116-117 0.025 0.0 0.0 0.0 0.025 118-119 0.025 0.0 0.0 0.0 0.025 120-121 0.025 0.0 0.0 0.0 0.025 122-123 0.025 0.0 0.0 0.0 0.025 124-125 0.025 0.0 0.0 0.0 0.025 126-127 0.025 0.0 0.0 0.0 0.025 128-129 0.025 0.0 0.0 0.0 0.025 130-131 0.037500000000000006 0.0 0.0 0.0 0.025 132-133 0.05 0.0 0.0 0.0 0.025 134-135 0.05 0.0 0.0 0.0 0.025 136-137 0.05 0.0 0.0 0.0 0.025 138 0.05 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTAAA 10 0.006973645 144.0 9 GAGGACT 10 0.006973645 144.0 1 GAGCCTC 10 0.006973645 144.0 8 ACTTCTT 10 0.006973645 144.0 5 CGGGTGG 10 0.006973645 144.0 2 TCCGTTA 10 0.006973645 144.0 2 CCGGGTG 10 0.006973645 144.0 1 TCTTTAA 10 0.006973645 144.0 8 GTGGAGC 10 0.006973645 144.0 5 GGGTGGA 10 0.006973645 144.0 3 >>END_MODULE Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra Read 1116628 spots for SRR13259400.sra Written 1116628 spots for SRR13259400.sra Read 1116624 spots for SRR13259400.sra Written 1116624 spots for SRR13259400.sra SRR ids: ['SRR13259400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_53d8a52x SRR13259400.sra spots: 22332484 blocks: [[1, 1116624], [1116625, 2233248], [2233249, 3349872], [3349873, 4466496], [4466497, 5583120], [5583121, 6699744], [6699745, 7816368], [7816369, 8932992], [8932993, 10049616], [10049617, 11166240], [11166241, 12282864], [12282865, 13399488], [13399489, 14516112], [14516113, 15632736], [15632737, 16749360], [16749361, 17865984], [17865985, 18982608], [18982609, 20099232], [20099233, 21215856], [21215857, 22332484]] SRR13259400 file size 7524236 SRR13259400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259400 SRR13259400_1.fastq SRR13259400_2.fastq Input file: SRR13259400_1.fastq Paired file: SRR13259400_2.fastq trimmed: SRR13259400-trimmed-pair1.fastq, SRR13259400-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:39:50 2025 >> started Fri Feb 14 05:40:15 2025 >> done (25.367s) 22332484 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 91 ( 0.00%) empty read pairs filtered out after trimming by size control 22332393 (100.00%) read pairs available; of these: 7928 ( 0.04%) trimmed read pairs available after processing 22324465 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 3 0.00% 40 1 0.00% 41 0 0.00% 42 3 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 2 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 1 0.00% 71 0 0.00% 72 2 0.00% 73 2 0.00% 74 4 0.00% 75 0 0.00% 76 1 0.00% 77 4 0.00% 78 5 0.00% 79 5 0.00% 80 4 0.00% 81 4 0.00% 82 4 0.00% 83 9 0.00% 84 6 0.00% 85 3 0.00% 86 7 0.00% 87 9 0.00% 88 3 0.00% 89 7 0.00% 90 8 0.00% 91 17 0.00% 92 11 0.00% 93 17 0.00% 94 11 0.00% 95 12 0.00% 96 26 0.00% 97 24 0.00% 98 27 0.00% 99 40 0.00% 100 27 0.00% 101 33 0.00% 102 20 0.00% 103 29 0.00% 104 30 0.00% 105 43 0.00% 106 49 0.00% 107 41 0.00% 108 51 0.00% 109 42 0.00% 110 57 0.00% 111 70 0.00% 112 54 0.00% 113 60 0.00% 114 56 0.00% 115 58 0.00% 116 72 0.00% 117 76 0.00% 118 71 0.00% 119 87 0.00% 120 83 0.00% 121 88 0.00% 122 96 0.00% 123 108 0.00% 124 96 0.00% 125 134 0.00% 126 133 0.00% 127 108 0.00% 128 144 0.00% 129 139 0.00% 130 131 0.00% 131 153 0.00% 132 210 0.00% 133 172 0.00% 134 193 0.00% 135 221 0.00% 136 222 0.00% 137 217 0.00% 138 233 0.00% 139 239 0.00% 140 245 0.00% 141 272 0.00% 142 269 0.00% 143 305 0.00% 144 293 0.00% 145 320 0.00% 146 376 0.00% 147 404 0.00% 148 462 0.00% 149 545 0.00% 150 22324465 99.96% 22332393 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=23 prefix-density=0.40 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=36.83 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.8 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=19 prefix-density=0.41 prefix-fanout=2.1 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=35.21 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.1 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT SRR13259400 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:40:59 Started mapping on | Feb 14 05:40:59 Finished on | Feb 14 05:43:00 Mapping speed, Million of reads per hour | 664.43 Number of input reads | 22332393 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21262658 Uniquely mapped reads % | 95.21% Average mapped length | 298.31 Number of splices: Total | 20971961 Number of splices: Annotated (sjdb) | 20584082 Number of splices: GT/AG | 20638905 Number of splices: GC/AG | 271371 Number of splices: AT/AC | 17154 Number of splices: Non-canonical | 44531 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 534757 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 69387 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 534978 534978 534978 N_multimapping 534757 534757 534757 N_noFeature 567880 10841257 10872805 N_ambiguous 228336 55989 56494 UnstrandedReadsAssigned:20466442 PositiveStrandReadsAssigned:10365412 NegativeStrandReadsAssigned:10333359 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259400 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259400-trimmed-pair1.fastq SRR13259400-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,332,393 reads, 20,861,587 reads pseudoaligned [quant] estimated average fragment length: 241.736 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR13259400.ke.tsv 34699 SRR13259400.se.tsv 87100 total ==> SRR13259400.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.26 2073 45.5876 Potri.005G024800.1.v4.1 1035 794.264 780 38.3821 Potri.004G059700.1.v4.1 961 720.264 10 0.542635 Potri.007G009000.2.v4.1 1416 1175.26 0 0 Potri.003G141000.2.v4.1 2943 2702.26 1131 16.3581 Potri.016G087400.1.v4.1 270 52.0285 1368 1027.65 Potri.015G069301.1.v4.1 564 323.4 0 0 Potri.010G195200.1.v4.1 1773 1532.26 682 17.396 Potri.012G127500.1.v4.1 977 736.264 5447 289.15 ==> SRR13259400.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 234 SRR13259400 completed mapping pipeline successfully