Starting /dee2/code/volunteer_pipeline.sh SRR13259401 current disk space = 3085936074752 free memory = 1582631744 SRR13259401 SRAfilesize 6b598681cdf6a63851dc0082986d3e2c SRR13259401.sra SRR13259401.sra file validated SRR13259401 is paired end SRR13259401 is conventional basespace SRR13259401 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6645 37.0 37.0 37.0 37.0 37.0 2 36.685 37.0 37.0 37.0 37.0 37.0 3 36.7155 37.0 37.0 37.0 37.0 37.0 4 36.598 37.0 37.0 37.0 37.0 37.0 5 36.701 37.0 37.0 37.0 37.0 37.0 6 36.61 37.0 37.0 37.0 37.0 37.0 7 36.6725 37.0 37.0 37.0 37.0 37.0 8 36.6615 37.0 37.0 37.0 37.0 37.0 9 36.685 37.0 37.0 37.0 37.0 37.0 10-14 36.6706 37.0 37.0 37.0 37.0 37.0 15-19 36.658300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6266 37.0 37.0 37.0 37.0 37.0 25-29 36.572 37.0 37.0 37.0 37.0 37.0 30-34 36.5261 37.0 37.0 37.0 37.0 37.0 35-39 36.4623 37.0 37.0 37.0 37.0 37.0 40-44 36.4532 37.0 37.0 37.0 37.0 37.0 45-49 36.4626 37.0 37.0 37.0 37.0 37.0 50-54 36.4491 37.0 37.0 37.0 37.0 37.0 55-59 36.333000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3797 37.0 37.0 37.0 37.0 37.0 65-69 36.3279 37.0 37.0 37.0 37.0 37.0 70-74 36.2949 37.0 37.0 37.0 37.0 37.0 75-79 36.2748 37.0 37.0 37.0 37.0 37.0 80-84 36.27310000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.229299999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.21679999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.249100000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.14 37.0 37.0 37.0 37.0 37.0 105-109 36.1577 37.0 37.0 37.0 37.0 37.0 110-114 36.139300000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.041900000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0136 37.0 37.0 37.0 37.0 37.0 125-129 35.8914 37.0 37.0 37.0 37.0 37.0 130-134 35.638 37.0 37.0 37.0 37.0 37.0 135-139 35.807 37.0 37.0 37.0 37.0 37.0 140-144 35.882400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.627300000000005 37.0 37.0 37.0 37.0 37.0 150 35.5685 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 3.0 23 1.0 24 3.0 25 3.0 26 3.0 27 9.0 28 14.0 29 18.0 30 15.0 31 29.0 32 41.0 33 51.0 34 94.0 35 297.0 36 3189.0 37 229.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.95 17.925 22.1 31.025000000000002 2 21.349999999999998 25.35 35.725 17.575 3 21.6 29.675 29.375 19.35 4 23.275000000000002 35.175 20.424999999999997 21.125 5 23.1 38.675 21.55 16.675 6 18.15 37.275000000000006 23.925 20.65 7 17.1 17.150000000000002 43.6 22.15 8 19.675 22.05 28.349999999999998 29.925 9 22.0 22.75 27.474999999999998 27.775 10-14 20.305 29.78 27.0 22.915 15-19 21.685 28.375 27.834999999999997 22.105 20-24 21.115000000000002 29.165000000000003 28.060000000000002 21.66 25-29 21.279999999999998 28.99 27.845 21.884999999999998 30-34 20.825 28.475 28.335 22.365 35-39 21.6 29.165000000000003 27.61 21.625 40-44 20.775 29.049999999999997 27.810000000000002 22.365 45-49 21.935 28.985 27.205000000000002 21.875 50-54 21.39 28.689999999999998 27.939999999999998 21.98 55-59 22.002200220022004 28.297829782978294 27.477747774777477 22.22222222222222 60-64 21.922192219221923 28.5028502850285 27.952795279527955 21.62216221622162 65-69 22.075 28.060000000000002 28.035 21.83 70-74 21.95 28.525 28.060000000000002 21.465 75-79 21.465 27.250000000000004 28.605000000000004 22.68 80-84 21.73 28.835 27.165 22.27 85-89 21.93 28.99 26.85 22.23 90-94 21.895 28.65 27.735 21.72 95-99 22.32 27.96 28.525 21.195 100-104 22.295 27.544999999999998 28.205000000000002 21.955 105-109 22.009999999999998 28.125 27.845 22.02 110-114 21.965 27.794999999999998 28.01 22.23 115-119 22.785 27.785 27.63 21.8 120-124 21.955 28.28 27.99 21.775 125-129 21.86 27.72 27.98 22.439999999999998 130-134 21.68 28.175 28.025 22.12 135-139 21.85 27.794999999999998 28.435 21.92 140-144 22.040000000000003 27.565 28.625 21.77 145-149 22.61 28.37 26.96 22.06 150 22.0 28.325 27.224999999999998 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 3.5 26 6.0 27 9.5 28 11.5 29 13.0 30 26.5 31 41.5 32 50.0 33 49.0 34 58.0 35 73.5 36 83.5 37 115.0 38 136.5 39 170.5 40 205.5 41 210.0 42 242.0 43 272.0 44 266.5 45 274.0 46 262.5 47 252.0 48 249.0 49 205.0 50 158.0 51 125.0 52 98.5 53 77.0 54 65.0 55 44.0 56 33.0 57 27.5 58 21.0 59 17.0 60 6.5 61 5.0 62 6.0 63 5.0 64 3.5 65 2.5 66 2.0 67 1.5 68 3.5 69 4.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 81.17245657568239 65.425 2 14.764267990074442 23.799999999999997 3 3.101736972704715 7.5 4 0.8374689826302729 2.7 5 0.09305210918114144 0.375 6 0.0 0.0 7 0.0 0.0 8 0.031017369727047148 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 8 0.2 No Hit CTGGCCTTATTGAGCTGCTCCACACACCTTCTGACACCATCTAGCAAGTC 5 0.125 No Hit AGGAACTCGGGAAAATCAATTGTACCATTTCCATCAGCATCAACCTCGTT 5 0.125 No Hit CCAGTTTCTTCATAAGTTCTCTTCACAATTACCCAATCAGGGTTAATACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0125 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCACT 10 0.006973645 144.0 6 TTCTGCA 10 0.006973645 144.0 2 TCTGCAT 10 0.006973645 144.0 3 ATCGGTG 10 0.006973645 144.0 8 AGTGCAC 10 0.006973645 144.0 5 CTGCATC 10 0.006973645 144.0 4 GCATCGG 10 0.006973645 144.0 6 CTTCTGC 10 0.006973645 144.0 1 CATCGGT 10 0.006973645 144.0 7 AATGGCA 20 0.006139246 28.8 80-84 >>END_MODULE SRR13259401 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4595 37.0 37.0 37.0 37.0 37.0 2 36.4805 37.0 37.0 37.0 37.0 37.0 3 36.4185 37.0 37.0 37.0 37.0 37.0 4 36.524 37.0 37.0 37.0 37.0 37.0 5 36.5265 37.0 37.0 37.0 37.0 37.0 6 36.438 37.0 37.0 37.0 37.0 37.0 7 36.463 37.0 37.0 37.0 37.0 37.0 8 36.557 37.0 37.0 37.0 37.0 37.0 9 36.569 37.0 37.0 37.0 37.0 37.0 10-14 36.513200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4865 37.0 37.0 37.0 37.0 37.0 20-24 36.5156 37.0 37.0 37.0 37.0 37.0 25-29 36.412800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.409000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.384699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3743 37.0 37.0 37.0 37.0 37.0 45-49 36.3003 37.0 37.0 37.0 37.0 37.0 50-54 36.2472 37.0 37.0 37.0 37.0 37.0 55-59 36.181 37.0 37.0 37.0 37.0 37.0 60-64 36.142 37.0 37.0 37.0 37.0 37.0 65-69 36.118399999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.128 37.0 37.0 37.0 37.0 37.0 75-79 36.0794 37.0 37.0 37.0 37.0 37.0 80-84 36.0121 37.0 37.0 37.0 37.0 37.0 85-89 35.8925 37.0 37.0 37.0 37.0 37.0 90-94 35.9176 37.0 37.0 37.0 37.0 37.0 95-99 35.8255 37.0 37.0 37.0 37.0 37.0 100-104 35.882099999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8808 37.0 37.0 37.0 37.0 37.0 110-114 35.7504 37.0 37.0 37.0 37.0 37.0 115-119 35.752300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5908 37.0 37.0 37.0 37.0 37.0 125-129 35.64790000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5045 37.0 37.0 37.0 37.0 37.0 135-139 35.3968 37.0 37.0 37.0 32.2 37.0 140-144 35.408 37.0 37.0 37.0 34.6 37.0 145-149 35.3716 37.0 37.0 37.0 32.2 37.0 150 35.4295 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 1.0 21 3.0 22 2.0 23 5.0 24 1.0 25 4.0 26 7.0 27 5.0 28 7.0 29 12.0 30 19.0 31 32.0 32 40.0 33 51.0 34 137.0 35 658.0 36 2904.0 37 109.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.625 17.849999999999998 21.625 31.900000000000002 2 21.975 25.324999999999996 35.15 17.549999999999997 3 21.099999999999998 31.55 27.224999999999998 20.125 4 24.125 34.675 20.724999999999998 20.474999999999998 5 22.400000000000002 36.199999999999996 21.375 20.025000000000002 6 16.775000000000002 39.074999999999996 22.875 21.275 7 17.25 17.25 43.675000000000004 21.825 8 20.0 22.400000000000002 27.35 30.25 9 21.099999999999998 23.75 28.4 26.75 10-14 20.82 29.880000000000003 27.025 22.275 15-19 21.455 28.439999999999998 28.105000000000004 22.0 20-24 21.625 28.48 27.725 22.17 25-29 20.91 28.65 28.095 22.345000000000002 30-34 20.96 28.535 28.549999999999997 21.955 35-39 20.979999999999997 28.494999999999997 28.285 22.24 40-44 21.634999999999998 27.87 28.060000000000002 22.435 45-49 22.06 28.425 27.625 21.89 50-54 21.05 28.884999999999998 27.935 22.13 55-59 21.825 28.53 27.55 22.095000000000002 60-64 21.11 28.98 27.52 22.39 65-69 21.935 28.365000000000002 27.775 21.925 70-74 22.425 28.535 27.455000000000002 21.584999999999997 75-79 21.395 28.794999999999998 27.82 21.990000000000002 80-84 21.52 28.63 27.805000000000003 22.045 85-89 21.995 27.474999999999998 27.994999999999997 22.535 90-94 22.189999999999998 28.02 27.755000000000003 22.035 95-99 21.89 28.294999999999998 28.48 21.335 100-104 21.65 27.85 28.060000000000002 22.439999999999998 105-109 21.91 27.800000000000004 27.994999999999997 22.295 110-114 21.82 28.799999999999997 27.49 21.89 115-119 21.615000000000002 28.325 28.155 21.905 120-124 22.040000000000003 28.065 27.73 22.165000000000003 125-129 22.18 27.815 28.110000000000003 21.895 130-134 22.075 28.305000000000003 27.975 21.645 135-139 21.78 28.01 28.13 22.08 140-144 22.515 27.67 28.025 21.790000000000003 145-149 21.675 28.294999999999998 28.1 21.93 150 21.5 28.199999999999996 29.15 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 3.0 21 3.5 22 1.0 23 2.5 24 3.5 25 2.0 26 3.0 27 5.0 28 7.0 29 11.0 30 21.0 31 33.0 32 41.5 33 46.0 34 57.0 35 82.0 36 99.0 37 124.0 38 157.0 39 179.0 40 200.0 41 218.0 42 224.5 43 265.0 44 272.5 45 257.5 46 261.0 47 238.5 48 221.0 49 195.5 50 161.0 51 137.5 52 113.0 53 87.0 54 70.5 55 48.5 56 33.5 57 26.0 58 21.0 59 16.0 60 13.5 61 7.5 62 4.5 63 5.5 64 4.0 65 2.0 66 2.0 67 3.5 68 2.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.05 #Duplication Level Percentage of deduplicated Percentage of total 1 81.61628624305985 66.14999999999999 2 14.373843306600865 23.3 3 3.115360888340531 7.575 4 0.8019740900678594 2.6 5 0.09253547193090685 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATGCTACACTAAACTAGGAGCTCTGCCTGAGGGATTGAAGGATGCAGA 5 0.125 No Hit TAGGCCTCCATGTCAATCCTCTGTGGCCTTCCAATCCTTGAATGTGTGTA 5 0.125 No Hit CGGATGACCAGATCTCTGAGTTCAAGGAAGCTTTCAGTTTGTTCGATAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0125 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.037500000000000006 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATAGG 10 0.006973645 144.0 6 TAGGAGT 10 0.006973645 144.0 9 ATAGGAG 10 0.006973645 144.0 8 CGGCTAT 10 0.006973645 144.0 3 CACGGCT 10 0.006973645 144.0 1 >>END_MODULE Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1109009 spots for SRR13259401.sra Written 1109009 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra Read 1108997 spots for SRR13259401.sra Written 1108997 spots for SRR13259401.sra SRR ids: ['SRR13259401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iluy4uk_ SRR13259401.sra spots: 22179952 blocks: [[1, 1108997], [1108998, 2217994], [2217995, 3326991], [3326992, 4435988], [4435989, 5544985], [5544986, 6653982], [6653983, 7762979], [7762980, 8871976], [8871977, 9980973], [9980974, 11089970], [11089971, 12198967], [12198968, 13307964], [13307965, 14416961], [14416962, 15525958], [15525959, 16634955], [16634956, 17743952], [17743953, 18852949], [18852950, 19961946], [19961947, 21070943], [21070944, 22179952]] SRR13259401 file size 7472697 SRR13259401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259401 SRR13259401_1.fastq SRR13259401_2.fastq Input file: SRR13259401_1.fastq Paired file: SRR13259401_2.fastq trimmed: SRR13259401-trimmed-pair1.fastq, SRR13259401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:35:04 2025 >> started Fri Feb 14 05:35:28 2025 >> done (23.814s) 22179952 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 39 ( 0.00%) empty read pairs filtered out after trimming by size control 22179913 (100.00%) read pairs available; of these: 8504 ( 0.04%) trimmed read pairs available after processing 22171409 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 2 0.00% 45 1 0.00% 46 0 0.00% 47 4 0.00% 48 1 0.00% 49 2 0.00% 50 3 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 1 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 1 0.00% 71 1 0.00% 72 5 0.00% 73 6 0.00% 74 1 0.00% 75 4 0.00% 76 9 0.00% 77 6 0.00% 78 7 0.00% 79 9 0.00% 80 4 0.00% 81 5 0.00% 82 4 0.00% 83 7 0.00% 84 5 0.00% 85 9 0.00% 86 8 0.00% 87 9 0.00% 88 3 0.00% 89 8 0.00% 90 12 0.00% 91 9 0.00% 92 18 0.00% 93 14 0.00% 94 13 0.00% 95 16 0.00% 96 27 0.00% 97 38 0.00% 98 24 0.00% 99 29 0.00% 100 30 0.00% 101 29 0.00% 102 34 0.00% 103 32 0.00% 104 32 0.00% 105 51 0.00% 106 47 0.00% 107 41 0.00% 108 55 0.00% 109 48 0.00% 110 54 0.00% 111 64 0.00% 112 63 0.00% 113 54 0.00% 114 77 0.00% 115 83 0.00% 116 86 0.00% 117 70 0.00% 118 87 0.00% 119 93 0.00% 120 92 0.00% 121 97 0.00% 122 100 0.00% 123 118 0.00% 124 108 0.00% 125 136 0.00% 126 130 0.00% 127 162 0.00% 128 150 0.00% 129 157 0.00% 130 166 0.00% 131 157 0.00% 132 161 0.00% 133 177 0.00% 134 216 0.00% 135 201 0.00% 136 227 0.00% 137 227 0.00% 138 235 0.00% 139 255 0.00% 140 251 0.00% 141 272 0.00% 142 304 0.00% 143 302 0.00% 144 328 0.00% 145 361 0.00% 146 362 0.00% 147 445 0.00% 148 528 0.00% 149 612 0.00% 150 22171409 99.96% 22179913 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=38.56 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.5 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=23 prefix-density=0.50 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=38.21 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.6 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT SRR13259401 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:36:09 Started mapping on | Feb 14 05:36:13 Finished on | Feb 14 05:38:04 Mapping speed, Million of reads per hour | 719.35 Number of input reads | 22179913 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21053689 Uniquely mapped reads % | 94.92% Average mapped length | 298.28 Number of splices: Total | 20397028 Number of splices: Annotated (sjdb) | 20012571 Number of splices: GT/AG | 20075611 Number of splices: GC/AG | 261414 Number of splices: AT/AC | 16667 Number of splices: Non-canonical | 43336 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 591045 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 73226 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535179 535179 535179 N_multimapping 591045 591045 591045 N_noFeature 561190 10724551 10768268 N_ambiguous 234347 56432 56430 UnstrandedReadsAssigned:20258152 PositiveStrandReadsAssigned:10272706 NegativeStrandReadsAssigned:10228991 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259401-trimmed-pair1.fastq SRR13259401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,179,913 reads, 20,674,557 reads pseudoaligned [quant] estimated average fragment length: 240.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR13259401.ke.tsv 34699 SRR13259401.se.tsv 87100 total ==> SRR13259401.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.26 2848 60.9995 Potri.005G024800.1.v4.1 1035 795.26 1159 55.508 Potri.004G059700.1.v4.1 961 721.26 21 1.10894 Potri.007G009000.2.v4.1 1416 1176.26 0 0 Potri.003G141000.2.v4.1 2943 2703.26 1067 15.0334 Potri.016G087400.1.v4.1 270 52.7953 1444 1041.73 Potri.015G069301.1.v4.1 564 324.358 0 0 Potri.010G195200.1.v4.1 1773 1533.26 942.827 23.4206 Potri.012G127500.1.v4.1 977 737.26 5230 270.186 ==> SRR13259401.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 401 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 341 SRR13259401 completed mapping pipeline successfully