Starting /dee2/code/volunteer_pipeline.sh SRR13259402 current disk space = 3086864277504 free memory = 1446315616 SRR13259402 SRAfilesize b5834fd2fa216b2167497092d400cb62 SRR13259402.sra SRR13259402.sra file validated SRR13259402 is paired end SRR13259402 is conventional basespace SRR13259402 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6335 37.0 37.0 37.0 37.0 37.0 2 36.653 37.0 37.0 37.0 37.0 37.0 3 36.662 37.0 37.0 37.0 37.0 37.0 4 36.6585 37.0 37.0 37.0 37.0 37.0 5 36.669 37.0 37.0 37.0 37.0 37.0 6 36.583 37.0 37.0 37.0 37.0 37.0 7 36.573 37.0 37.0 37.0 37.0 37.0 8 36.595 37.0 37.0 37.0 37.0 37.0 9 36.678 37.0 37.0 37.0 37.0 37.0 10-14 36.6519 37.0 37.0 37.0 37.0 37.0 15-19 36.64829999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5704 37.0 37.0 37.0 37.0 37.0 25-29 36.5135 37.0 37.0 37.0 37.0 37.0 30-34 36.4484 37.0 37.0 37.0 37.0 37.0 35-39 36.5043 37.0 37.0 37.0 37.0 37.0 40-44 36.4277 37.0 37.0 37.0 37.0 37.0 45-49 36.438300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.462900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.32055 37.0 37.0 37.0 37.0 37.0 60-64 36.35895 37.0 37.0 37.0 37.0 37.0 65-69 36.2642 37.0 37.0 37.0 37.0 37.0 70-74 36.281400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2094 37.0 37.0 37.0 37.0 37.0 80-84 36.218 37.0 37.0 37.0 37.0 37.0 85-89 36.21 37.0 37.0 37.0 37.0 37.0 90-94 36.19070000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1244 37.0 37.0 37.0 37.0 37.0 100-104 36.0241 37.0 37.0 37.0 37.0 37.0 105-109 36.0528 37.0 37.0 37.0 37.0 37.0 110-114 35.971900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.920100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.832 37.0 37.0 37.0 37.0 37.0 125-129 35.7995 37.0 37.0 37.0 37.0 37.0 130-134 35.5987 37.0 37.0 37.0 37.0 37.0 135-139 35.642999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.769999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.57 37.0 37.0 37.0 37.0 37.0 150 35.475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 4.0 21 0.0 22 1.0 23 1.0 24 4.0 25 5.0 26 5.0 27 11.0 28 9.0 29 14.0 30 26.0 31 37.0 32 39.0 33 54.0 34 102.0 35 302.0 36 3189.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.325000000000003 16.175 21.2 32.300000000000004 2 21.575 25.624999999999996 34.300000000000004 18.5 3 22.35 31.075000000000003 27.175 19.400000000000002 4 23.125 34.975 20.525 21.375 5 22.175 37.5 21.525 18.8 6 18.375 38.824999999999996 22.575 20.225 7 15.9 17.974999999999998 43.525000000000006 22.6 8 20.724999999999998 22.225 27.975 29.075 9 22.375 21.4 29.299999999999997 26.924999999999997 10-14 21.7 29.125 26.314999999999998 22.86 15-19 21.845 28.294999999999998 27.744999999999997 22.115000000000002 20-24 21.54 29.395 26.919999999999998 22.145 25-29 21.19 29.23 27.375 22.205 30-34 21.38 29.360000000000003 27.255000000000003 22.005 35-39 21.42 29.439999999999998 27.04 22.1 40-44 21.33 28.134999999999998 28.125 22.41 45-49 21.995 27.794999999999998 27.750000000000004 22.46 50-54 21.85 28.79 27.655 21.705 55-59 22.158323748562285 27.98419762964445 27.344101615242288 22.513377006550982 60-64 22.178326749012353 27.924188628294246 27.804170625593837 22.093313997099564 65-69 22.11 27.82 27.32 22.75 70-74 21.94 28.065 27.91 22.085 75-79 22.515 28.395 27.500000000000004 21.59 80-84 21.8 27.99 28.065 22.145 85-89 21.95 28.194999999999997 27.05 22.805 90-94 22.650000000000002 28.175 27.315 21.86 95-99 22.0 27.905 27.49 22.605 100-104 21.66 27.875 27.35 23.115 105-109 22.34 28.205000000000002 27.595 21.86 110-114 22.115000000000002 28.255000000000003 27.785 21.845 115-119 21.925 28.235 27.485 22.355 120-124 21.865000000000002 27.815 28.035 22.285 125-129 22.155 27.735 27.92 22.189999999999998 130-134 22.12 27.915 27.700000000000003 22.264999999999997 135-139 22.18 27.450000000000003 27.625 22.745 140-144 22.6 27.665 27.96 21.775 145-149 22.400000000000002 27.58 28.349999999999998 21.67 150 22.15 26.075 28.849999999999998 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 3.0 24 7.0 25 7.0 26 6.0 27 7.5 28 12.5 29 16.5 30 18.0 31 31.5 32 44.5 33 43.0 34 48.5 35 70.5 36 96.5 37 123.5 38 151.0 39 165.0 40 195.5 41 214.5 42 227.5 43 260.0 44 269.0 45 259.0 46 244.5 47 212.5 48 182.5 49 183.0 50 173.0 51 140.5 52 104.5 53 84.5 54 75.5 55 63.5 56 44.5 57 31.5 58 36.0 59 31.5 60 15.5 61 13.5 62 14.5 63 13.5 64 11.0 65 8.5 66 7.5 67 4.0 68 5.5 69 6.0 70 3.5 71 0.5 72 0.5 73 2.5 74 3.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.015 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.225 #Duplication Level Percentage of deduplicated Percentage of total 1 85.50894690525081 72.875 2 12.114989733059549 20.65 3 1.9947198591962452 5.1 4 0.32267527134056906 1.0999999999999999 5 0.02933411557641537 0.125 6 0.02933411557641537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATTCCAACAGACAGCACCCGCAGAAAGGGTGGCAGAAGGGGAAGAAGG 6 0.15 No Hit CAAGTACACTCCCAAATCCTGCAGACCTCAAAATCCTTACTGCGCACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCAGG 10 0.006973645 144.0 6 >>END_MODULE SRR13259402 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6035 37.0 37.0 37.0 37.0 37.0 2 36.444 37.0 37.0 37.0 37.0 37.0 3 36.4665 37.0 37.0 37.0 37.0 37.0 4 36.384 37.0 37.0 37.0 37.0 37.0 5 36.3985 37.0 37.0 37.0 37.0 37.0 6 36.411 37.0 37.0 37.0 37.0 37.0 7 36.413 37.0 37.0 37.0 37.0 37.0 8 36.5335 37.0 37.0 37.0 37.0 37.0 9 36.527 37.0 37.0 37.0 37.0 37.0 10-14 36.5201 37.0 37.0 37.0 37.0 37.0 15-19 36.5092 37.0 37.0 37.0 37.0 37.0 20-24 36.470299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4313 37.0 37.0 37.0 37.0 37.0 30-34 36.419000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3849 37.0 37.0 37.0 37.0 37.0 40-44 36.33 37.0 37.0 37.0 37.0 37.0 45-49 36.287 37.0 37.0 37.0 37.0 37.0 50-54 36.2401 37.0 37.0 37.0 37.0 37.0 55-59 36.1731 37.0 37.0 37.0 37.0 37.0 60-64 36.1356 37.0 37.0 37.0 37.0 37.0 65-69 36.1531 37.0 37.0 37.0 37.0 37.0 70-74 36.142700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0321 37.0 37.0 37.0 37.0 37.0 80-84 36.0041 37.0 37.0 37.0 37.0 37.0 85-89 35.847699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8726 37.0 37.0 37.0 37.0 37.0 95-99 35.8121 37.0 37.0 37.0 37.0 37.0 100-104 35.7841 37.0 37.0 37.0 37.0 37.0 105-109 35.7778 37.0 37.0 37.0 37.0 37.0 110-114 35.738600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6605 37.0 37.0 37.0 37.0 37.0 120-124 35.4731 37.0 37.0 37.0 34.6 37.0 125-129 35.479400000000005 37.0 37.0 37.0 32.2 37.0 130-134 35.4403 37.0 37.0 37.0 37.0 37.0 135-139 35.3363 37.0 37.0 37.0 29.8 37.0 140-144 35.443999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.278299999999994 37.0 37.0 37.0 32.2 37.0 150 35.3105 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 2.0 24 4.0 25 4.0 26 2.0 27 11.0 28 18.0 29 13.0 30 23.0 31 26.0 32 25.0 33 65.0 34 133.0 35 750.0 36 2836.0 37 81.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.85 16.2 21.25 34.699999999999996 2 22.425 25.775 33.4 18.4 3 21.475 32.925 25.35 20.25 4 26.200000000000003 33.225 19.5 21.075 5 23.825 36.65 21.3 18.224999999999998 6 16.725 38.525 23.3 21.45 7 16.475 17.9 42.275 23.35 8 19.675 21.349999999999998 29.849999999999998 29.125 9 19.900000000000002 24.2 27.650000000000002 28.249999999999996 10-14 21.39 29.744999999999997 26.58 22.285 15-19 22.155 28.265 27.365000000000002 22.215 20-24 21.990000000000002 28.470000000000002 27.935 21.605 25-29 21.44 29.13 27.455000000000002 21.975 30-34 21.12 28.68 27.560000000000002 22.64 35-39 21.34 28.665000000000003 27.650000000000002 22.345000000000002 40-44 21.435000000000002 28.87 27.495000000000005 22.2 45-49 21.884999999999998 27.889999999999997 28.000000000000004 22.225 50-54 22.005 29.255 26.27 22.470000000000002 55-59 21.97 28.54 27.405 22.085 60-64 21.990000000000002 28.42 27.41 22.18 65-69 21.995 28.07 27.875 22.06 70-74 22.43 29.304999999999996 26.479999999999997 21.785 75-79 22.205 28.52 26.85 22.425 80-84 21.87 28.470000000000002 27.025 22.634999999999998 85-89 22.27 28.799999999999997 26.6 22.33 90-94 22.59 27.950000000000003 27.415 22.045 95-99 22.17 28.33 27.29 22.21 100-104 21.785 28.79 27.310000000000002 22.115000000000002 105-109 21.82 28.52 26.900000000000002 22.759999999999998 110-114 22.32 28.050000000000004 27.36 22.27 115-119 21.755 28.015 27.79 22.439999999999998 120-124 22.645 27.845 27.775 21.735 125-129 22.55 27.310000000000002 27.705000000000002 22.435 130-134 23.06 27.155 27.415 22.37 135-139 21.875 27.68 28.215 22.23 140-144 21.685 27.644999999999996 28.37 22.3 145-149 22.37 27.625 27.900000000000002 22.105 150 22.95 26.450000000000003 28.349999999999998 22.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 2.5 23 4.0 24 6.0 25 6.5 26 6.0 27 7.5 28 13.0 29 18.0 30 22.5 31 27.5 32 39.5 33 51.0 34 65.0 35 79.0 36 84.5 37 105.5 38 130.0 39 149.0 40 189.0 41 215.5 42 232.0 43 260.0 44 265.0 45 259.0 46 242.0 47 223.0 48 223.0 49 200.0 50 152.5 51 115.5 52 93.5 53 90.0 54 86.0 55 66.5 56 56.0 57 45.5 58 28.0 59 21.5 60 14.0 61 11.5 62 15.5 63 15.5 64 9.0 65 6.5 66 6.0 67 3.5 68 4.0 69 6.0 70 4.5 71 2.5 72 3.0 73 1.5 74 2.0 75 2.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.45 #Duplication Level Percentage of deduplicated Percentage of total 1 85.66413107080164 73.2 2 12.112346401404329 20.7 3 1.8431831480397893 4.725 4 0.32182562902282036 1.0999999999999999 5 0.029256875365710942 0.125 6 0.029256875365710942 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCAGAGCATAAAAGTCACAAACAAAACTCCATATCGTTAAGTTTCTAC 6 0.15 No Hit GTGGCTGTAGAATGTTCAGAATTGAAGATTCTTCTTTGCTTTTGGTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGCTT 10 0.006973645 144.0 2 >>END_MODULE Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135772 spots for SRR13259402.sra Written 1135772 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra Read 1135764 spots for SRR13259402.sra Written 1135764 spots for SRR13259402.sra SRR ids: ['SRR13259402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aiplilxk SRR13259402.sra spots: 22715288 blocks: [[1, 1135764], [1135765, 2271528], [2271529, 3407292], [3407293, 4543056], [4543057, 5678820], [5678821, 6814584], [6814585, 7950348], [7950349, 9086112], [9086113, 10221876], [10221877, 11357640], [11357641, 12493404], [12493405, 13629168], [13629169, 14764932], [14764933, 15900696], [15900697, 17036460], [17036461, 18172224], [18172225, 19307988], [19307989, 20443752], [20443753, 21579516], [21579517, 22715288]] SRR13259402 file size 7653582 SRR13259402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259402 SRR13259402_1.fastq SRR13259402_2.fastq Input file: SRR13259402_1.fastq Paired file: SRR13259402_2.fastq trimmed: SRR13259402-trimmed-pair1.fastq, SRR13259402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:57:38 2025 >> started Fri Feb 14 04:58:03 2025 >> done (24.852s) 22715288 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 88 ( 0.00%) empty read pairs filtered out after trimming by size control 22715200 (100.00%) read pairs available; of these: 9027 ( 0.04%) trimmed read pairs available after processing 22706173 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 2 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 1 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 2 0.00% 46 1 0.00% 47 0 0.00% 48 2 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 1 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 1 0.00% 69 2 0.00% 70 5 0.00% 71 6 0.00% 72 4 0.00% 73 4 0.00% 74 2 0.00% 75 4 0.00% 76 5 0.00% 77 8 0.00% 78 1 0.00% 79 10 0.00% 80 11 0.00% 81 11 0.00% 82 5 0.00% 83 12 0.00% 84 6 0.00% 85 11 0.00% 86 10 0.00% 87 8 0.00% 88 7 0.00% 89 7 0.00% 90 6 0.00% 91 15 0.00% 92 10 0.00% 93 26 0.00% 94 29 0.00% 95 20 0.00% 96 26 0.00% 97 18 0.00% 98 33 0.00% 99 33 0.00% 100 34 0.00% 101 38 0.00% 102 35 0.00% 103 39 0.00% 104 48 0.00% 105 49 0.00% 106 48 0.00% 107 37 0.00% 108 48 0.00% 109 66 0.00% 110 70 0.00% 111 69 0.00% 112 67 0.00% 113 79 0.00% 114 93 0.00% 115 81 0.00% 116 86 0.00% 117 93 0.00% 118 104 0.00% 119 108 0.00% 120 110 0.00% 121 107 0.00% 122 114 0.00% 123 143 0.00% 124 133 0.00% 125 159 0.00% 126 153 0.00% 127 151 0.00% 128 175 0.00% 129 150 0.00% 130 198 0.00% 131 177 0.00% 132 188 0.00% 133 207 0.00% 134 228 0.00% 135 223 0.00% 136 222 0.00% 137 234 0.00% 138 216 0.00% 139 239 0.00% 140 267 0.00% 141 281 0.00% 142 287 0.00% 143 359 0.00% 144 286 0.00% 145 362 0.00% 146 402 0.00% 147 442 0.00% 148 559 0.00% 149 588 0.00% 150 22706173 99.96% 22715200 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=9.92 fanout-score-rank=8 prefix-density=0.36 prefix-fanout=4.9 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=64.22 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.2 sequence=ATGAAGATTACTAACTTTCTAGTGCTCTCCTTTCTTCTCTTTGCCTTCACGGCAACTTCAATATTTCCTCGTGCCGTTCATGCTGAAGCAGTGATCGATGTCTTCGGTGATGAGGTTAGAACTGGTGATCGTTATATCATCGGAGCCGCTTCGAATGACTTTGCGGTCACTTCCAGCCGTATCATATGCAATTCAGATGTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=9.62 fanout-score-rank=7 prefix-density=0.37 prefix-fanout=4.8 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=72.11 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.1 sequence=AGAGAAATTGAAGTGAACTTTATTGCACCATAATATCGTTTGATATAATTAGTCGCGGAAATACATCGTTTCCATTTTACTATTATTGGCCAAATGACATGGCTTATTTATCACGCAAACATTCCTGCATACCAAACCCCAGAGTCACAGCTAGTAAGGACGCTGGCCAACGTAGTTGCCGGGGGGGGAATAGTTGCAACTGATGACTGTACCGCCATTGCTGCACCTTGCTTTAGCACAACCTAAACGAACCGAGTTGCGCCAAACCACCTGAGTATAATGCCTGCATTCTCCACCAACACATGAATTGGAGTTGTAATCATACTTTGGTTTCTCATCAACCCACAATTTCACCGCAGCGCTGCCTGTAAGATCACCACTACCTCCTGCAAGGTTCTCGCCATAAGGCCCACCAGAATGCACAAGTCTGCAATCGCCCGTGAGCCGTTTAA SRR13259402 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:58:49 Started mapping on | Feb 14 04:58:50 Finished on | Feb 14 05:02:25 Mapping speed, Million of reads per hour | 380.35 Number of input reads | 22715200 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20525454 Uniquely mapped reads % | 90.36% Average mapped length | 298.25 Number of splices: Total | 17766059 Number of splices: Annotated (sjdb) | 17406565 Number of splices: GT/AG | 17450975 Number of splices: GC/AG | 244732 Number of splices: AT/AC | 14506 Number of splices: Non-canonical | 55846 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 714703 % of reads mapped to multiple loci | 3.15% Number of reads mapped to too many loci | 157211 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1475043 1475043 1475043 N_multimapping 714703 714703 714703 N_noFeature 573557 10421720 10454399 N_ambiguous 344067 60813 61061 UnstrandedReadsAssigned:19607830 PositiveStrandReadsAssigned:10042921 NegativeStrandReadsAssigned:10009994 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259402-trimmed-pair1.fastq SRR13259402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,715,200 reads, 20,457,983 reads pseudoaligned [quant] estimated average fragment length: 245.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR13259402.ke.tsv 34699 SRR13259402.se.tsv 87100 total ==> SRR13259402.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.54 1422 27.5429 Potri.005G024800.1.v4.1 1035 790.545 2024 87.9499 Potri.004G059700.1.v4.1 961 716.559 9 0.431461 Potri.007G009000.2.v4.1 1416 1171.54 0 0 Potri.003G141000.2.v4.1 2943 2698.54 917 11.6732 Potri.016G087400.1.v4.1 270 51.6222 1451.53 965.919 Potri.015G069301.1.v4.1 564 319.657 0 0 Potri.010G195200.1.v4.1 1773 1528.54 1346.96 30.2711 Potri.012G127500.1.v4.1 977 732.55 999 46.8468 ==> SRR13259402.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 78 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 463 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 26 SRR13259402 completed mapping pipeline successfully