Starting /dee2/code/volunteer_pipeline.sh SRR13259403 current disk space = 3086241366016 free memory = 1491400580 SRR13259403 SRAfilesize 35e9b37f8552cea1ae3c86b4e4e4bb69 SRR13259403.sra SRR13259403.sra file validated SRR13259403 is paired end SRR13259403 is conventional basespace SRR13259403 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6735 37.0 37.0 37.0 37.0 37.0 2 36.523 37.0 37.0 37.0 37.0 37.0 3 36.6245 37.0 37.0 37.0 37.0 37.0 4 36.5805 37.0 37.0 37.0 37.0 37.0 5 36.703 37.0 37.0 37.0 37.0 37.0 6 36.6005 37.0 37.0 37.0 37.0 37.0 7 36.62 37.0 37.0 37.0 37.0 37.0 8 36.7345 37.0 37.0 37.0 37.0 37.0 9 36.618 37.0 37.0 37.0 37.0 37.0 10-14 36.6294 37.0 37.0 37.0 37.0 37.0 15-19 36.6435 37.0 37.0 37.0 37.0 37.0 20-24 36.582100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5083 37.0 37.0 37.0 37.0 37.0 30-34 36.479200000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3861 37.0 37.0 37.0 37.0 37.0 40-44 36.3957 37.0 37.0 37.0 37.0 37.0 45-49 36.3825 37.0 37.0 37.0 37.0 37.0 50-54 36.380900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.31315 37.0 37.0 37.0 37.0 37.0 60-64 36.275549999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.192899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.25129999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1609 37.0 37.0 37.0 37.0 37.0 80-84 36.2484 37.0 37.0 37.0 37.0 37.0 85-89 36.135400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1344 37.0 37.0 37.0 37.0 37.0 95-99 36.0841 37.0 37.0 37.0 37.0 37.0 100-104 36.01270000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.95909999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.016600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8934 37.0 37.0 37.0 37.0 37.0 120-124 35.851099999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.7791 37.0 37.0 37.0 37.0 37.0 130-134 35.5995 37.0 37.0 37.0 37.0 37.0 135-139 35.6806 37.0 37.0 37.0 37.0 37.0 140-144 35.7403 37.0 37.0 37.0 37.0 37.0 145-149 35.524699999999996 37.0 37.0 37.0 37.0 37.0 150 35.405 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 0.0 18 1.0 19 4.0 20 2.0 21 2.0 22 2.0 23 1.0 24 2.0 25 1.0 26 6.0 27 9.0 28 18.0 29 18.0 30 30.0 31 32.0 32 40.0 33 71.0 34 105.0 35 293.0 36 3129.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.65 16.575 22.625 32.15 2 22.275 23.875 35.5 18.35 3 22.375 31.075000000000003 26.075 20.474999999999998 4 23.375 36.4 20.3 19.925 5 23.125 36.425000000000004 22.3 18.15 6 18.5 38.05 23.825 19.625 7 18.2 16.6 42.4 22.8 8 21.05 20.45 27.35 31.15 9 20.349999999999998 22.625 29.125 27.900000000000002 10-14 21.740000000000002 29.110000000000003 26.96 22.189999999999998 15-19 22.075 27.889999999999997 27.544999999999998 22.49 20-24 21.905 28.694999999999997 27.529999999999998 21.87 25-29 22.415 29.125 27.0 21.46 30-34 21.634999999999998 28.999999999999996 27.22 22.145 35-39 21.215 28.560000000000002 27.68 22.545 40-44 22.215 28.28 27.400000000000002 22.105 45-49 22.650000000000002 27.715 27.625 22.009999999999998 50-54 21.865000000000002 28.68 26.765 22.689999999999998 55-59 22.266113305665282 28.456422821141057 27.44637231861593 21.83109155457773 60-64 21.731086554327717 28.546427321366068 27.43637181859093 22.286114305715284 65-69 21.58 28.275 27.084999999999997 23.06 70-74 22.655 28.02 27.315 22.009999999999998 75-79 22.264999999999997 28.4 27.565 21.77 80-84 22.259999999999998 28.199999999999996 27.025 22.515 85-89 22.25 27.605 27.944999999999997 22.2 90-94 22.82 28.03 27.46 21.69 95-99 21.945 28.32 28.110000000000003 21.625 100-104 22.43 27.98 27.485 22.105 105-109 22.14 27.935 27.755000000000003 22.17 110-114 22.755 27.639999999999997 27.805000000000003 21.8 115-119 22.365 27.68 27.834999999999997 22.12 120-124 22.23 27.97 27.855 21.945 125-129 21.755 28.055000000000003 27.834999999999997 22.355 130-134 22.195 27.97 28.025 21.81 135-139 22.445 27.675 28.134999999999998 21.745 140-144 22.98 27.105 28.384999999999998 21.529999999999998 145-149 22.305 27.644999999999996 28.18 21.87 150 21.775 27.1 27.775 23.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.0 22 0.5 23 2.5 24 2.5 25 4.5 26 10.0 27 13.0 28 15.5 29 21.0 30 24.5 31 31.0 32 40.5 33 52.5 34 68.0 35 90.0 36 107.5 37 116.5 38 142.0 39 146.0 40 170.0 41 212.0 42 228.5 43 244.5 44 236.5 45 230.5 46 245.0 47 227.5 48 203.0 49 182.0 50 149.0 51 134.0 52 107.5 53 89.0 54 73.0 55 51.5 56 46.5 57 44.5 58 40.0 59 29.0 60 21.0 61 19.0 62 18.5 63 17.0 64 14.0 65 13.5 66 10.5 67 5.5 68 4.0 69 4.0 70 6.5 71 5.0 72 3.5 73 7.0 74 6.5 75 2.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.6 #Duplication Level Percentage of deduplicated Percentage of total 1 83.94138755980862 70.175 2 13.187799043062201 22.05 3 2.3923444976076556 6.0 4 0.3289473684210526 1.0999999999999999 5 0.08971291866028708 0.375 6 0.05980861244019139 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTGGCCTTCCACCAGTGCCCCGAAATGCAGGCTGGTAATCTGCTGGTG 6 0.15 No Hit GAGAGAGGGAGATCAATGAAAGTTAAGACATGGAAACCCTCTCTGGAGAG 6 0.15 No Hit GGGGCAGGCATATTTGAATGAATAAGCAATCATCCTTGAATTTTACCTAC 5 0.125 No Hit CCCAGACTAAATTGTAAGGTTTCTTTTTGTCTAACCTCTCTGTTTCTGGT 5 0.125 No Hit GGCTTTTCTGAGTTTTGACCTCACAGCAAAAAAAAAAAAGGCTGTAAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259403 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259403_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3655 37.0 37.0 37.0 37.0 37.0 2 36.3845 37.0 37.0 37.0 37.0 37.0 3 36.3845 37.0 37.0 37.0 37.0 37.0 4 36.445 37.0 37.0 37.0 37.0 37.0 5 36.383 37.0 37.0 37.0 37.0 37.0 6 36.4475 37.0 37.0 37.0 37.0 37.0 7 36.462 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.543 37.0 37.0 37.0 37.0 37.0 10-14 36.4433 37.0 37.0 37.0 37.0 37.0 15-19 36.431599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.36 37.0 37.0 37.0 37.0 37.0 25-29 36.392700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2895 37.0 37.0 37.0 37.0 37.0 35-39 36.3163 37.0 37.0 37.0 37.0 37.0 40-44 36.278 37.0 37.0 37.0 37.0 37.0 45-49 36.261399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1817 37.0 37.0 37.0 37.0 37.0 55-59 36.135 37.0 37.0 37.0 37.0 37.0 60-64 36.020199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.069100000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0584 37.0 37.0 37.0 37.0 37.0 75-79 35.944 37.0 37.0 37.0 37.0 37.0 80-84 35.910399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7783 37.0 37.0 37.0 37.0 37.0 90-94 35.825199999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7923 37.0 37.0 37.0 37.0 37.0 100-104 35.717000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.7078 37.0 37.0 37.0 37.0 37.0 110-114 35.613699999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.68300000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.442499999999995 37.0 37.0 37.0 34.6 37.0 125-129 35.4623 37.0 37.0 37.0 32.2 37.0 130-134 35.319900000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.3063 37.0 37.0 37.0 32.2 37.0 140-144 35.3276 37.0 37.0 37.0 29.8 37.0 145-149 35.083 37.0 37.0 37.0 25.0 37.0 150 35.2535 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 3.0 21 1.0 22 1.0 23 5.0 24 8.0 25 3.0 26 10.0 27 11.0 28 9.0 29 17.0 30 18.0 31 41.0 32 45.0 33 69.0 34 131.0 35 723.0 36 2808.0 37 93.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.875 17.525 21.375 31.225 2 21.325 24.825 36.225 17.625 3 21.775 31.65 27.950000000000003 18.625 4 23.849999999999998 34.675 20.45 21.025 5 23.549999999999997 34.65 21.475 20.325 6 17.25 39.375 21.7 21.675 7 18.45 17.275 42.875 21.4 8 21.349999999999998 22.400000000000002 27.725 28.525 9 21.7 24.2 28.299999999999997 25.8 10-14 21.555 29.37 26.66 22.415 15-19 21.33 28.175 27.725 22.770000000000003 20-24 22.56 29.609999999999996 26.369999999999997 21.46 25-29 21.595 28.625 27.229999999999997 22.55 30-34 21.58 28.4 28.105000000000004 21.915000000000003 35-39 21.59 28.84 27.11 22.46 40-44 22.475 28.275 27.634999999999998 21.615000000000002 45-49 21.4 29.005 27.400000000000002 22.195 50-54 21.654999999999998 28.735 27.560000000000002 22.05 55-59 22.189999999999998 28.1 27.334999999999997 22.375 60-64 21.855 27.955000000000002 27.93 22.259999999999998 65-69 22.295 28.105000000000004 27.089999999999996 22.509999999999998 70-74 22.115000000000002 28.53 27.315 22.040000000000003 75-79 21.790000000000003 28.49 27.045 22.675 80-84 22.650000000000002 27.985 27.48 21.884999999999998 85-89 21.845 28.499999999999996 27.865000000000002 21.790000000000003 90-94 22.05 28.384999999999998 26.995 22.57 95-99 21.9 28.485 27.305 22.31 100-104 22.14 28.144999999999996 27.589999999999996 22.125 105-109 21.62 27.675 28.305000000000003 22.400000000000002 110-114 21.995 28.025 27.48 22.5 115-119 21.790000000000003 28.475 27.18 22.555 120-124 21.855 27.435 28.02 22.689999999999998 125-129 22.075 27.79 26.99 23.145 130-134 22.395 28.360000000000003 27.22 22.025 135-139 22.285 27.839999999999996 27.72 22.155 140-144 22.08 27.765 27.855 22.3 145-149 22.23 27.13 28.244999999999997 22.395 150 21.325 26.674999999999997 28.199999999999996 23.799999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 2.0 24 5.5 25 5.0 26 4.0 27 9.0 28 11.5 29 16.5 30 25.0 31 31.0 32 46.5 33 59.5 34 71.5 35 89.5 36 98.5 37 109.0 38 126.0 39 149.0 40 183.5 41 223.5 42 246.5 43 237.5 44 229.5 45 241.0 46 250.5 47 224.0 48 201.5 49 190.0 50 156.5 51 130.5 52 111.5 53 94.5 54 77.5 55 63.5 56 46.5 57 38.0 58 37.0 59 31.5 60 21.0 61 12.5 62 13.0 63 11.0 64 9.5 65 8.5 66 5.5 67 6.5 68 7.0 69 3.5 70 3.5 71 3.5 72 2.0 73 1.5 74 2.0 75 1.5 76 2.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 84.49404761904762 70.975 2 12.767857142857142 21.45 3 2.1726190476190474 5.475 4 0.3869047619047619 1.3 5 0.11904761904761905 0.5 6 0.05952380952380953 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTGAGGACGTACCTGAATCTTCCATCAGAAATTGTTCCTGCCACCTTG 6 0.15 No Hit ATAACTCTTCGTAAGCAAAAGCGTAATTACATGTACATTTGGGTCATGAC 6 0.15 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GTGCTATGAGCAATGCTACTGATAATGCATCAGAATTGAAGAAGTCCCTT 5 0.125 No Hit GCCAAAGAATGACTTTAATTTTGAGAAGAGGGATTGGATGACTGTTTGTC 5 0.125 No Hit CAAACATGTAATCTGTCTCAAGAATGTCTTAATTATTCCTCAAGATTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.006139246 28.8 75-79 AAAAAAA 30 0.0015031899 23.999998 10-14 >>END_MODULE Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314794 spots for SRR13259403.sra Written 1314794 spots for SRR13259403.sra Read 1314812 spots for SRR13259403.sra Written 1314812 spots for SRR13259403.sra SRR ids: ['SRR13259403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_80ebaklw SRR13259403.sra spots: 26295898 blocks: [[1, 1314794], [1314795, 2629588], [2629589, 3944382], [3944383, 5259176], [5259177, 6573970], [6573971, 7888764], [7888765, 9203558], [9203559, 10518352], [10518353, 11833146], [11833147, 13147940], [13147941, 14462734], [14462735, 15777528], [15777529, 17092322], [17092323, 18407116], [18407117, 19721910], [19721911, 21036704], [21036705, 22351498], [22351499, 23666292], [23666293, 24981086], [24981087, 26295898]] SRR13259403 file size 8863437 SRR13259403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259403 SRR13259403_1.fastq SRR13259403_2.fastq Input file: SRR13259403_1.fastq Paired file: SRR13259403_2.fastq trimmed: SRR13259403-trimmed-pair1.fastq, SRR13259403-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:19:22 2025 >> started Fri Feb 14 05:19:53 2025 >> done (30.484s) 26295898 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 99 ( 0.00%) empty read pairs filtered out after trimming by size control 26295799 (100.00%) read pairs available; of these: 10284 ( 0.04%) trimmed read pairs available after processing 26285515 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 2 0.00% 36 0 0.00% 37 0 0.00% 38 2 0.00% 39 1 0.00% 40 0 0.00% 41 1 0.00% 42 1 0.00% 43 0 0.00% 44 1 0.00% 45 2 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 1 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 1 0.00% 67 0 0.00% 68 3 0.00% 69 2 0.00% 70 2 0.00% 71 4 0.00% 72 6 0.00% 73 7 0.00% 74 3 0.00% 75 5 0.00% 76 8 0.00% 77 10 0.00% 78 5 0.00% 79 8 0.00% 80 9 0.00% 81 5 0.00% 82 7 0.00% 83 12 0.00% 84 5 0.00% 85 6 0.00% 86 7 0.00% 87 10 0.00% 88 8 0.00% 89 3 0.00% 90 5 0.00% 91 15 0.00% 92 13 0.00% 93 20 0.00% 94 25 0.00% 95 32 0.00% 96 27 0.00% 97 27 0.00% 98 30 0.00% 99 37 0.00% 100 36 0.00% 101 29 0.00% 102 40 0.00% 103 33 0.00% 104 43 0.00% 105 50 0.00% 106 54 0.00% 107 52 0.00% 108 65 0.00% 109 52 0.00% 110 49 0.00% 111 62 0.00% 112 82 0.00% 113 71 0.00% 114 81 0.00% 115 86 0.00% 116 82 0.00% 117 105 0.00% 118 111 0.00% 119 121 0.00% 120 123 0.00% 121 115 0.00% 122 146 0.00% 123 136 0.00% 124 139 0.00% 125 143 0.00% 126 138 0.00% 127 157 0.00% 128 170 0.00% 129 187 0.00% 130 178 0.00% 131 202 0.00% 132 259 0.00% 133 249 0.00% 134 235 0.00% 135 260 0.00% 136 297 0.00% 137 276 0.00% 138 256 0.00% 139 293 0.00% 140 313 0.00% 141 357 0.00% 142 384 0.00% 143 399 0.00% 144 385 0.00% 145 453 0.00% 146 523 0.00% 147 537 0.00% 148 596 0.00% 149 689 0.00% 150 26285515 99.96% 26295799 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=25 prefix-density=0.23 prefix-fanout=2.1 sequence=GAGACTGAGAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=77.54 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=AGAAATTGAAGTGAACTTTATTGCACCATAATATCGTTTGATATAATTAGTCGCGGAAATACATCGTTTCCATTTTACTATTATTGGCCAAATGACATGGCTTATTTATCACGCAAACATTCCTGCATACCAAACCCCAGAGTCACAGCTAGTAAGGACGCTGGCCAACGTAGTTGCCGGGGGGGGAATAGTTGCAACTGATGACTGTACCGCCATTGCTGCACCTTGCTTTAGCACAACCTAAACGAACCGAGTTGCGCCAAACCACCTGAGTATAATGCCTGCATTCTCCACCAACACATGAATTGGAGTTGTAATCATACTTTGGTTTCTCATCAACCCACAATTTCACCGCAGCGCTGCCTGTAAGATCACCACTACCTCCTGCAAGGTTCTCGCCATAAGGCCCACCAGAATGCACAAGTCTGCAATCGCCCGTGAGCCGTTTAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=2.1 sequence=GAGACTGAGAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=121.94 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.8 sequence=AGAAATTGAAGTGAACTTTATTGCACCATAATATCGTTTGATATAATTAGTCGCGGAAATACATCGTTTCCATTTTACTATTATTGGCCAAATGACATGGCTTATTTATCACGCAAACATTCCTGCATACCAAACCCCAGAGTCACAGCTAGTAAGGACGCTGGCCAACGTAGTTGCCGGGGGGGGAATAGTTGCAACTGATGACTGTACCGCCATTGCTGCACCTTGCTTTAGCACAACCTAAACGAACCGAGTTGCGCCAAACCACCTGAGTATAATGCCTGCATTCTCCACCAACACATGAATTGGAGTTGTAATCATACTTTGGTTTCTCATCAACCCACAATTTCACCGCAGCGCTGCCTGTAAGATCACCACTACCTCCTGCAAGGTTCTCGCCATAAGGCCCACCAGAATGCACAAGTCTGCAATCGCCCGTGAGCCGTTTAA SRR13259403 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:21:41 Started mapping on | Feb 14 05:21:41 Finished on | Feb 14 05:27:50 Mapping speed, Million of reads per hour | 256.54 Number of input reads | 26295799 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22988980 Uniquely mapped reads % | 87.42% Average mapped length | 298.20 Number of splices: Total | 20031852 Number of splices: Annotated (sjdb) | 19615319 Number of splices: GT/AG | 19669737 Number of splices: GC/AG | 281130 Number of splices: AT/AC | 16829 Number of splices: Non-canonical | 64156 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 764322 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 133962 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.95% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2542497 2542497 2542497 N_multimapping 764322 764322 764322 N_noFeature 707496 11704428 11735161 N_ambiguous 395533 69785 69770 UnstrandedReadsAssigned:21885951 PositiveStrandReadsAssigned:11214767 NegativeStrandReadsAssigned:11184049 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259403 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259403-trimmed-pair1.fastq SRR13259403-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,295,799 reads, 22,826,029 reads pseudoaligned [quant] estimated average fragment length: 241.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52401 SRR13259403.ke.tsv 34699 SRR13259403.se.tsv 87100 total ==> SRR13259403.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.22 1362 22.7916 Potri.005G024800.1.v4.1 1035 794.219 2214 82.9041 Potri.004G059700.1.v4.1 961 720.224 14 0.578095 Potri.007G009000.2.v4.1 1416 1175.22 0 0 Potri.003G141000.2.v4.1 2943 2702.22 1087.66 11.9704 Potri.016G087400.1.v4.1 270 52.1023 1631 930.971 Potri.015G069301.1.v4.1 564 323.33 0 0 Potri.010G195200.1.v4.1 1773 1532.22 1047.95 20.3403 Potri.012G127500.1.v4.1 977 736.224 1187 47.949 ==> SRR13259403.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 505 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR13259403 completed mapping pipeline successfully