Starting /dee2/code/volunteer_pipeline.sh SRR13347970 current disk space = 3052387901440 free memory = 1412080188 SRR13347970 SRAfilesize 0663502e35065c20fe3473e6722b49a1 SRR13347970.sra SRR13347970.sra file validated SRR13347970 is paired end SRR13347970 is conventional basespace SRR13347970 read1 length is 51-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347970_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5695 37.0 37.0 37.0 37.0 37.0 2 36.436 37.0 37.0 37.0 37.0 37.0 3 36.4995 37.0 37.0 37.0 37.0 37.0 4 36.622 37.0 37.0 37.0 37.0 37.0 5 36.5335 37.0 37.0 37.0 37.0 37.0 6 36.512 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.2455 37.0 37.0 37.0 37.0 37.0 9 36.626 37.0 37.0 37.0 37.0 37.0 10-14 36.447500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.522 37.0 37.0 37.0 37.0 37.0 20-24 36.4315 37.0 37.0 37.0 37.0 37.0 25-29 36.436299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4317 37.0 37.0 37.0 37.0 37.0 35-39 36.249700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3631 37.0 37.0 37.0 37.0 37.0 45-49 36.112 37.0 37.0 37.0 37.0 37.0 50-54 35.926654545924436 37.0 37.0 37.0 34.6 37.0 55-59 35.94962677094411 37.0 37.0 37.0 37.0 37.0 60-64 35.31729658872337 37.0 37.0 37.0 34.6 37.0 65-69 36.111032246698564 37.0 37.0 37.0 37.0 37.0 70-74 36.17906201470136 37.0 37.0 37.0 37.0 37.0 75-79 36.01750843622559 37.0 37.0 37.0 34.6 37.0 80-84 36.13109068487213 37.0 37.0 37.0 37.0 37.0 85-89 36.01273583662059 37.0 37.0 37.0 37.0 37.0 90-94 35.93393312127189 37.0 37.0 37.0 37.0 37.0 95-99 36.05154888419119 37.0 37.0 37.0 37.0 37.0 100-104 35.388083873711764 37.0 37.0 37.0 31.8 37.0 105-109 35.74606567278885 37.0 37.0 37.0 34.6 37.0 110-114 36.076969854857325 37.0 37.0 37.0 37.0 37.0 115-119 35.94772061010307 37.0 37.0 37.0 37.0 37.0 120-124 35.536023819551914 37.0 37.0 37.0 34.6 37.0 125-129 35.65928810985619 37.0 37.0 37.0 34.6 37.0 130-134 35.98882580480087 37.0 37.0 37.0 37.0 37.0 135-139 34.34828733551251 37.0 34.6 37.0 29.4 37.0 140-144 35.36294919393847 37.0 37.0 37.0 34.6 37.0 145-149 35.68268528510693 37.0 37.0 37.0 34.6 37.0 150 36.537993920972646 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 2.0 28 4.0 29 12.0 30 25.0 31 29.0 32 58.0 33 117.0 34 186.0 35 746.0 36 2718.0 37 102.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.225 10.274999999999999 11.95 34.55 2 27.975 7.575 30.75 33.7 3 26.200000000000003 8.95 23.7 41.15 4 31.900000000000002 12.55 21.05 34.5 5 31.075000000000003 18.15 25.3 25.474999999999998 6 28.999999999999996 25.2 22.925 22.875 7 20.45 26.700000000000003 35.575 17.275 8 19.900000000000002 25.55 32.300000000000004 22.25 9 22.775000000000002 24.45 32.800000000000004 19.975 10-14 23.47 27.46 26.075 22.994999999999997 15-19 23.865 26.029999999999998 25.88 24.224999999999998 20-24 24.015 26.02 26.229999999999997 23.735 25-29 23.625 25.735000000000003 26.545 24.095 30-34 23.805 25.66 26.195 24.34 35-39 23.14 25.515 26.334999999999997 25.009999999999998 40-44 23.86 25.145 26.57 24.425 45-49 23.56 26.07 25.77 24.6 50-54 24.232116058029014 25.962981490745374 25.727863931965985 24.07703851925963 55-59 24.001603447411934 25.94077266122163 25.65515859097059 24.40246530039585 60-64 24.24135852090032 26.185691318327976 25.8189308681672 23.754019292604504 65-69 23.424740397217462 26.08629902207884 25.657828410121986 24.831132170581714 70-74 23.340937896070976 25.34854245880862 26.479087452471482 24.831432192648922 75-79 24.50091668364229 25.412507639030352 26.01344469342025 24.07313098390711 80-84 24.348671751036495 25.331422429236834 25.85350872703076 24.46639709269591 85-89 24.16834287482593 25.97864768683274 25.277219041724692 24.57579039661664 90-94 24.316599106122023 25.85490073796903 25.50670408481447 24.321796071094482 95-99 24.222525740701826 25.86677873502837 25.99285564194159 23.91783988232822 100-104 24.09254935257907 25.291870091275737 26.257694756951818 24.357885799193376 105-109 23.964544721998386 25.61375235025517 25.919957023905454 24.501745903840987 110-114 24.71989557271837 25.63363428695747 25.535733710431852 24.11073642989231 115-119 24.10437859354268 25.54732419283503 26.11123396727112 24.237063246351173 120-124 24.363039293398256 25.68225569018231 25.331219567432907 24.623485448986525 125-129 24.739325449991263 25.246111725985905 25.816974427681018 24.197588396341818 130-134 24.107467021662835 26.080116180563962 25.535519787002297 24.276897010770906 135-139 24.76394309454866 25.494145788744802 26.211758781316885 23.53015233538965 140-144 24.194712326969757 25.762645148592796 26.608935248966738 23.43370727547071 145-149 24.17269049671729 26.745805424762914 25.127660985476492 23.953843093043307 150 27.119216480918606 25.295508274231675 24.349881796690305 23.235393448159407 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 5.5 29 9.5 30 10.5 31 13.5 32 22.0 33 31.0 34 37.5 35 44.5 36 54.0 37 69.0 38 80.5 39 90.5 40 111.0 41 148.0 42 157.0 43 172.5 44 194.5 45 188.0 46 199.0 47 191.5 48 190.5 49 183.0 50 160.0 51 154.0 52 149.0 53 136.0 54 127.0 55 126.0 56 116.5 57 103.0 58 106.0 59 102.0 60 84.0 61 88.5 62 80.0 63 64.0 64 57.5 65 53.0 66 37.5 67 30.0 68 26.0 69 13.5 70 10.0 71 4.5 72 4.0 73 4.5 74 3.5 75 2.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 2.0 52-53 3.0 54-55 2.0 56-57 3.0 58-59 7.0 60-61 0.0 62-63 8.0 64-65 6.0 66-67 3.0 68-69 11.0 70-71 11.0 72-73 8.0 74-75 7.0 76-77 4.0 78-79 9.0 80-81 9.0 82-83 9.0 84-85 15.0 86-87 10.0 88-89 10.0 90-91 12.0 92-93 21.0 94-95 13.0 96-97 20.0 98-99 9.0 100-101 21.0 102-103 12.0 104-105 23.0 106-107 19.0 108-109 16.0 110-111 16.0 112-113 27.0 114-115 24.0 116-117 24.0 118-119 32.0 120-121 45.0 122-123 36.0 124-125 32.0 126-127 53.0 128-129 56.0 130-131 48.0 132-133 46.0 134-135 46.0 136-137 68.0 138-139 50.0 140-141 52.0 142-143 24.0 144-145 0.0 146-147 2.0 148-149 55.0 150-151 2961.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.74737125909948 86.0 2 6.68643839309787 12.4 3 0.5392289026691831 1.5 4 0.026961445133459154 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGTTT 10 0.008138317 136.75 2 GCCCGTT 10 0.008138317 136.75 1 >>END_MODULE SRR13347970 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347970_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7835 37.0 37.0 37.0 37.0 37.0 2 36.175 37.0 37.0 37.0 37.0 37.0 3 31.963 37.0 25.0 37.0 11.0 37.0 4 36.2515 37.0 37.0 37.0 37.0 37.0 5 36.4135 37.0 37.0 37.0 37.0 37.0 6 36.383 37.0 37.0 37.0 37.0 37.0 7 34.117 37.0 37.0 37.0 25.0 37.0 8 36.4255 37.0 37.0 37.0 37.0 37.0 9 36.3065 37.0 37.0 37.0 37.0 37.0 10-14 34.5514 37.0 37.0 37.0 27.0 37.0 15-19 36.032000000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.9807 37.0 37.0 37.0 34.6 37.0 25-29 36.062 37.0 37.0 37.0 34.6 37.0 30-34 35.6475 37.0 37.0 37.0 31.8 37.0 35-39 34.4171 37.0 34.6 37.0 24.2 37.0 40-44 36.1695 37.0 37.0 37.0 37.0 37.0 45-49 35.841699999999996 37.0 37.0 37.0 34.6 37.0 50-54 35.636493685594296 37.0 37.0 37.0 34.6 37.0 55-59 35.819116304091274 37.0 37.0 37.0 34.6 37.0 60-64 34.33489980421465 37.0 34.6 37.0 29.4 37.0 65-69 36.04473472006537 37.0 37.0 37.0 37.0 37.0 70-74 35.246950299573925 37.0 37.0 37.0 32.2 37.0 75-79 35.66475390791702 37.0 37.0 37.0 34.6 37.0 80-84 36.125328396160924 37.0 37.0 37.0 37.0 37.0 85-89 36.07288676302568 37.0 37.0 37.0 37.0 37.0 90-94 35.084110693080184 37.0 37.0 37.0 32.2 37.0 95-99 35.22407586621115 37.0 37.0 37.0 31.8 37.0 100-104 35.76792541802473 37.0 37.0 37.0 37.0 37.0 105-109 35.81872752825533 37.0 37.0 37.0 37.0 37.0 110-114 35.51543959634785 37.0 37.0 37.0 34.6 37.0 115-119 35.68873754474076 37.0 37.0 37.0 37.0 37.0 120-124 35.46348581881521 37.0 37.0 37.0 32.2 37.0 125-129 35.883383327927916 37.0 37.0 37.0 37.0 37.0 130-134 35.58016468847921 37.0 37.0 37.0 34.6 37.0 135-139 35.26435833625852 37.0 37.0 37.0 32.2 37.0 140-144 35.77724812537277 37.0 37.0 37.0 37.0 37.0 145-149 35.824202015182415 37.0 37.0 37.0 37.0 37.0 150 36.336971350613915 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 0.0 26 3.0 27 3.0 28 6.0 29 14.0 30 22.0 31 44.0 32 87.0 33 152.0 34 491.0 35 1395.0 36 1743.0 37 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.424999999999997 26.275 12.5 29.799999999999997 2 23.75 29.4 27.6 19.25 3 21.349999999999998 26.974999999999998 30.075000000000003 21.6 4 25.35 28.625 22.825 23.200000000000003 5 26.950000000000003 30.475 21.05 21.525 6 22.2 35.55 21.15 21.099999999999998 7 21.325 23.9 32.75 22.025 8 21.85 22.6 26.75 28.799999999999997 9 22.3 22.425 30.025000000000002 25.25 10-14 23.549999999999997 27.500000000000004 24.495 24.455 15-19 23.435 26.505000000000003 25.45 24.610000000000003 20-24 24.015 25.455 26.26 24.27 25-29 23.765 26.22 25.319999999999997 24.695 30-34 23.45 26.08 26.529999999999998 23.94 35-39 23.35 26.355 25.705 24.59 40-44 23.835 25.724999999999998 25.745 24.695 45-49 23.74 25.89 25.740000000000002 24.63 50-54 24.005205465739028 25.772060663696884 25.927223584764004 24.29551028580009 55-59 24.269460177434716 25.798205603729134 25.552603879504787 24.379730339331363 60-64 24.007238363325627 26.49039911531115 25.01759324419423 24.484769277168997 65-69 24.509457755359396 25.538461538461537 25.94199243379571 24.010088272383353 70-74 24.41076587764205 26.027674996198492 25.0747630391809 24.48679608697856 75-79 24.46683972107701 26.08540744133964 25.087799664070847 24.359953173512498 80-84 24.347158218125962 25.965181771633382 25.90373783922171 23.783922171018943 85-89 24.49716348633316 25.80711707065498 25.435791645177925 24.259927797833935 90-94 24.815354207843544 25.79319671278477 25.439508998231563 23.951940081140123 95-99 24.765764817349194 26.044846825981683 25.50268449310454 23.68670386356459 100-104 24.803275202041682 26.281369629944706 25.29242875372182 23.62292641429179 105-109 24.385389208671796 26.015385443003925 25.466673839367367 24.132551508956908 110-114 24.338451486442338 26.11891538712839 25.329413045845584 24.213220080583685 115-119 24.593338497288926 26.12039393604072 24.892110213566447 24.394157353103907 120-124 24.348663343905756 26.087449025826913 25.657000453103763 23.906887177163572 125-129 24.4989512934048 25.833139128408295 25.221393614542066 24.44651596364484 130-134 24.511996132229406 26.391490904695715 24.928990149271772 24.167522813803107 135-139 24.371859296482413 26.243718592964825 25.16959798994975 24.214824120603016 140-144 24.63028399424159 26.560659599528858 24.198403350346815 24.61065305588274 145-149 25.109257052046086 27.022910872732087 23.87101046219044 23.996821613031386 150 27.012278308321964 27.012278308321964 23.976807639836288 21.99863574351978 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.5 26 3.0 27 1.5 28 4.0 29 6.0 30 11.0 31 19.5 32 32.0 33 37.0 34 32.0 35 43.0 36 57.5 37 72.5 38 90.5 39 111.0 40 142.5 41 166.5 42 171.0 43 175.5 44 203.5 45 219.5 46 193.0 47 181.5 48 179.0 49 160.5 50 140.5 51 125.5 52 129.0 53 138.5 54 130.5 55 113.5 56 112.0 57 111.0 58 107.0 59 103.5 60 98.5 61 82.0 62 64.5 63 56.0 64 49.5 65 46.0 66 39.5 67 29.0 68 16.5 69 12.5 70 10.0 71 6.0 72 5.0 73 2.0 74 1.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 7.0 55-59 9.0 60-64 15.0 65-69 14.0 70-74 20.0 75-79 18.0 80-84 28.0 85-89 26.0 90-94 48.0 95-99 36.0 100-104 42.0 105-109 45.0 110-114 52.0 115-119 68.0 120-124 95.0 125-129 121.0 130-134 112.0 135-139 142.0 140-144 79.0 145-149 91.0 150-151 2932.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07765201368781 90.3 2 4.5538299552513815 8.649999999999999 3 0.36851803106080544 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACAAG 10 0.008160596 136.62498 9 >>END_MODULE Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186217 spots for SRR13347970.sra Written 1186217 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra Read 1186204 spots for SRR13347970.sra Written 1186204 spots for SRR13347970.sra SRR ids: ['SRR13347970.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_liyrzikb SRR13347970.sra spots: 23724093 blocks: [[1, 1186204], [1186205, 2372408], [2372409, 3558612], [3558613, 4744816], [4744817, 5931020], [5931021, 7117224], [7117225, 8303428], [8303429, 9489632], [9489633, 10675836], [10675837, 11862040], [11862041, 13048244], [13048245, 14234448], [14234449, 15420652], [15420653, 16606856], [16606857, 17793060], [17793061, 18979264], [18979265, 20165468], [20165469, 21351672], [21351673, 22537876], [22537877, 23724093]] SRR13347970 file size 7591943 SRR13347970 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347970 SRR13347970_1.fastq SRR13347970_2.fastq Input file: SRR13347970_1.fastq Paired file: SRR13347970_2.fastq trimmed: SRR13347970-trimmed-pair1.fastq, SRR13347970-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:26:36 2025 >> started Tue Feb 11 23:27:19 2025 >> done (43.685s) 23724093 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 23724093 (100.00%) read pairs available; of these: 1292198 ( 5.45%) trimmed read pairs available after processing 22431895 (94.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 1 0.00% 48 6 0.00% 49 7 0.00% 50 4060 0.02% 51 4526 0.02% 52 5035 0.02% 53 5278 0.02% 54 5615 0.02% 55 5765 0.02% 56 5974 0.03% 57 6585 0.03% 58 7382 0.03% 59 8191 0.03% 60 9174 0.04% 61 10258 0.04% 62 11358 0.05% 63 11712 0.05% 64 12386 0.05% 65 12695 0.05% 66 13000 0.05% 67 13053 0.06% 68 13848 0.06% 69 15270 0.06% 70 16172 0.07% 71 17959 0.08% 72 19715 0.08% 73 20854 0.09% 74 21890 0.09% 75 22636 0.10% 76 22756 0.10% 77 22895 0.10% 78 23418 0.10% 79 24524 0.10% 80 25758 0.11% 81 27473 0.12% 82 29753 0.13% 83 31272 0.13% 84 33569 0.14% 85 34807 0.15% 86 35306 0.15% 87 35123 0.15% 88 35832 0.15% 89 36440 0.15% 90 38070 0.16% 91 40108 0.17% 92 42628 0.18% 93 45197 0.19% 94 48189 0.20% 95 49552 0.21% 96 50550 0.21% 97 51226 0.22% 98 51497 0.22% 99 52951 0.22% 100 61583 0.26% 101 63157 0.27% 102 65840 0.28% 103 69348 0.29% 104 72252 0.30% 105 74781 0.32% 106 77179 0.33% 107 78863 0.33% 108 79251 0.33% 109 79670 0.34% 110 81195 0.34% 111 83070 0.35% 112 86134 0.36% 113 90349 0.38% 114 94376 0.40% 115 97692 0.41% 116 99857 0.42% 117 102673 0.43% 118 104698 0.44% 119 105191 0.44% 120 106023 0.45% 121 109619 0.46% 122 112586 0.47% 123 116421 0.49% 124 120671 0.51% 125 125363 0.53% 126 129609 0.55% 127 133378 0.56% 128 134922 0.57% 129 136421 0.58% 130 137852 0.58% 131 140600 0.59% 132 144508 0.61% 133 147681 0.62% 134 152220 0.64% 135 156519 0.66% 136 162184 0.68% 137 166756 0.70% 138 168804 0.71% 139 171558 0.72% 140 172420 0.73% 141 173348 0.73% 142 171164 0.72% 143 178494 0.75% 144 183574 0.77% 145 188859 0.80% 146 192377 0.81% 147 196085 0.83% 148 205560 0.87% 149 906693 3.82% 150 15525363 65.44% 23724093 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=40 prefix-density=0.37 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=115.85 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=19.0 sequence=ATCATCATCATC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=30 prefix-density=0.53 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=45.00 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.2 sequence=CTTCACCATTAAACACTGCACTCAAAACTCTTGATACATCTTTATCTTCCTTTTTAAAGTATCCACCATGGGCTGGTTTGATAGCGACTCCGATCAGGCTCAGGCCTACGACCAGGTTGTGAACCGTCCCCACGAAGCCGAGTGGTCTCACGAACTTCTCGGAGGCGCTGCCGCCTTCGAGGCCGCCAAGGCGTACGAGAATCACGTCTCTCGGAACGGTCACCCCGACTCGCACGCCAAAGCAAAGGAGATTCTTGCAGGAGCCATAGGTGCCTTTGTGGACCGTGAGGTTGAGACTAGGGGCCTGGACTATGTCGATCGCGAGAAGGCAAAGCACCATGCTCAGCGACAGGCTGAGGAGC SRR13347970 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:28:56 Started mapping on | Feb 11 23:28:56 Finished on | Feb 11 23:52:25 Mapping speed, Million of reads per hour | 60.62 Number of input reads | 23724093 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 14492609 Uniquely mapped reads % | 61.09% Average mapped length | 280.88 Number of splices: Total | 13365431 Number of splices: Annotated (sjdb) | 13096941 Number of splices: GT/AG | 13150438 Number of splices: GC/AG | 171854 Number of splices: AT/AC | 12178 Number of splices: Non-canonical | 30961 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 543677 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 121225 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 35.73% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8689516 8689516 8689516 N_multimapping 543677 543677 543677 N_noFeature 502105 14336313 586663 N_ambiguous 130196 981 57775 UnstrandedReadsAssigned:13860308 PositiveStrandReadsAssigned:155315 NegativeStrandReadsAssigned:13848171 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR13347970 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347970-trimmed-pair1.fastq SRR13347970-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,724,093 reads, 14,282,646 reads pseudoaligned [quant] estimated average fragment length: 165.565 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR13347970.ke.tsv 34699 SRR13347970.se.tsv 87100 total ==> SRR13347970.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1853.44 2157 79.8103 Potri.005G024800.1.v4.1 1035 870.435 1001 78.8649 Potri.004G059700.1.v4.1 961 796.435 190 16.3602 Potri.007G009000.2.v4.1 1416 1251.44 0 0 Potri.003G141000.2.v4.1 2943 2778.44 487 12.0203 Potri.016G087400.1.v4.1 270 107.554 963.328 614.233 Potri.015G069301.1.v4.1 564 399.485 0 0 Potri.010G195200.1.v4.1 1773 1608.44 518 22.0858 Potri.012G127500.1.v4.1 977 812.435 3246 273.997 ==> SRR13347970.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 913 SRR13347970 completed mapping pipeline successfully