Starting /dee2/code/volunteer_pipeline.sh SRR13347971 current disk space = 3052109111296 free memory = 1398720652 SRR13347971 SRAfilesize 3ae58f187439d584603128e88ee69f67 SRR13347971.sra SRR13347971.sra file validated SRR13347971 is paired end SRR13347971 is conventional basespace SRR13347971 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347971_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55 37.0 37.0 37.0 37.0 37.0 2 36.399 37.0 37.0 37.0 37.0 37.0 3 36.532 37.0 37.0 37.0 37.0 37.0 4 36.52 37.0 37.0 37.0 37.0 37.0 5 36.51125 37.0 37.0 37.0 37.0 37.0 6 36.4165 37.0 37.0 37.0 37.0 37.0 7 36.5675 37.0 37.0 37.0 37.0 37.0 8 36.2685 37.0 37.0 37.0 37.0 37.0 9 36.58 37.0 37.0 37.0 37.0 37.0 10-14 36.3491 37.0 37.0 37.0 37.0 37.0 15-19 36.4782 37.0 37.0 37.0 37.0 37.0 20-24 36.405100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.41890000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.431 37.0 37.0 37.0 37.0 37.0 35-39 36.25169999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.367399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0558 37.0 37.0 37.0 37.0 37.0 50-54 35.91028434251773 37.0 37.0 37.0 34.6 37.0 55-59 35.94978247320931 37.0 37.0 37.0 37.0 37.0 60-64 35.35567695597878 37.0 37.0 37.0 34.6 37.0 65-69 36.150094452493214 37.0 37.0 37.0 37.0 37.0 70-74 36.233361726935655 37.0 37.0 37.0 37.0 37.0 75-79 35.969895649512345 37.0 37.0 37.0 34.6 37.0 80-84 36.116028250009734 37.0 37.0 37.0 37.0 37.0 85-89 35.96877062245619 37.0 37.0 37.0 37.0 37.0 90-94 35.98525901303184 37.0 37.0 37.0 37.0 37.0 95-99 36.07642506174243 37.0 37.0 37.0 37.0 37.0 100-104 35.41454556888989 37.0 37.0 37.0 31.8 37.0 105-109 35.836471389488985 37.0 37.0 37.0 34.6 37.0 110-114 35.98234897876929 37.0 37.0 37.0 37.0 37.0 115-119 35.89027943350402 37.0 37.0 37.0 37.0 37.0 120-124 35.52437071267492 37.0 37.0 37.0 34.6 37.0 125-129 35.70796002804144 37.0 37.0 37.0 34.6 37.0 130-134 36.02343618497845 37.0 37.0 37.0 37.0 37.0 135-139 34.44973471372091 37.0 34.6 37.0 29.4 37.0 140-144 35.33086913105018 37.0 37.0 37.0 34.6 37.0 145-149 35.76953601265493 37.0 37.0 37.0 34.6 37.0 150 36.55287009063444 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 3.0 29 12.0 30 22.0 31 41.0 32 51.0 33 106.0 34 219.0 35 773.0 36 2684.0 37 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 10.7 12.1 34.975 2 26.924999999999997 8.325000000000001 30.775000000000002 33.975 3 24.75 9.275 24.275 41.699999999999996 4 31.125000000000004 13.975000000000001 21.099999999999998 33.800000000000004 5 31.43285821455364 20.130032508127034 23.980995248812203 24.456114028507127 6 26.424999999999997 27.1 23.65 22.825 7 18.525 25.3 39.7 16.475 8 20.45 22.45 33.675 23.425 9 22.525000000000002 22.875 31.900000000000002 22.7 10-14 22.82 27.305 26.815 23.06 15-19 23.400000000000002 25.735000000000003 26.41 24.455 20-24 23.665 26.02 26.655 23.66 25-29 23.119999999999997 26.1 26.69 24.09 30-34 23.16 26.0 26.415 24.425 35-39 23.505000000000003 25.525 26.88 24.09 40-44 23.380000000000003 26.395000000000003 26.179999999999996 24.044999999999998 45-49 23.54 26.525 25.95 23.985 50-54 23.39637746422496 26.258380866606622 26.163314320024018 24.1819273491444 55-59 23.372262042002905 25.998696807177584 26.24429853140193 24.384742619417572 60-64 23.174778761061948 25.593322606596942 26.77996781979083 24.45193081255028 65-69 23.680492481582398 25.850237158139066 26.36492077908972 24.10434958118882 70-74 23.30899503092993 26.224520839671435 26.43241050603387 24.034073623364772 75-79 23.685954626561305 25.89854703033393 26.301300025490697 24.114198317614072 80-84 23.51401293501694 26.645108305102145 25.46966430551278 24.371214454368133 85-89 23.706427720515872 26.53959703734397 25.84036877816336 23.913606463976798 90-94 23.045611105312595 26.187245590230663 26.844796994050725 23.922346310406013 95-99 23.58774196951316 25.766126905427498 26.5256606361095 24.120470488949838 100-104 23.63908328436348 26.230033655643997 26.27277098135584 23.85811207863668 105-109 24.07547577854671 25.973183391003463 26.00562283737024 23.945717993079583 110-114 23.692020224225104 26.28599692240053 26.181578368872277 23.84040448450209 115-119 24.52502381886454 26.17272880121056 25.758000336266324 23.54424704365858 120-124 23.839347276488162 26.999540335555043 25.706734084118594 23.454378303838197 125-129 24.273969361802802 25.794049801857216 26.521559117525285 23.410421718814693 130-134 24.252390523174373 25.963822400877035 26.524148851939827 23.259638224008768 135-139 23.516386182462355 25.964823484752625 27.21751233708718 23.301277995697838 140-144 23.709381551362682 25.976153039832283 26.755765199161424 23.558700209643607 145-149 24.446061247437 26.503075600238112 25.887955552615914 23.162907599708976 150 24.06847935548842 25.142665323934203 27.861698556562605 22.927156764014768 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 3.0 28 4.0 29 3.5 30 5.0 31 11.5 32 16.0 33 21.5 34 34.5 35 47.0 36 61.0 37 72.0 38 77.0 39 101.5 40 121.5 41 146.0 42 180.5 43 196.0 44 196.0 45 194.0 46 196.5 47 207.0 48 222.0 49 199.5 50 192.5 51 184.5 52 149.0 53 147.0 54 128.0 55 118.0 56 136.5 57 116.0 58 93.5 59 88.5 60 85.0 61 67.0 62 51.5 63 45.0 64 32.5 65 26.0 66 22.5 67 16.5 68 10.5 69 8.5 70 6.0 71 5.0 72 4.0 73 4.5 74 2.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 7.0 55-59 11.0 60-64 11.0 65-69 20.0 70-74 22.0 75-79 20.0 80-84 34.0 85-89 27.0 90-94 38.0 95-99 47.0 100-104 40.0 105-109 61.0 110-114 65.0 115-119 79.0 120-124 100.0 125-129 94.0 130-134 103.0 135-139 127.0 140-144 68.0 145-149 47.0 150-151 2979.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.69541778975741 85.975 2 6.846361185983827 12.7 3 0.40431266846361186 1.125 4 0.05390835579514825 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTAAA 10 0.008346389 135.6 9 >>END_MODULE SRR13347971 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347971_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6365 37.0 37.0 37.0 37.0 37.0 2 36.2265 37.0 37.0 37.0 37.0 37.0 3 32.3845 37.0 37.0 37.0 11.0 37.0 4 36.305 37.0 37.0 37.0 37.0 37.0 5 36.264 37.0 37.0 37.0 37.0 37.0 6 36.359 37.0 37.0 37.0 37.0 37.0 7 34.1375 37.0 37.0 37.0 25.0 37.0 8 36.3525 37.0 37.0 37.0 37.0 37.0 9 36.3775 37.0 37.0 37.0 37.0 37.0 10-14 34.674099999999996 37.0 37.0 37.0 27.0 37.0 15-19 36.0658 37.0 37.0 37.0 37.0 37.0 20-24 36.0242 37.0 37.0 37.0 34.6 37.0 25-29 36.062799999999996 37.0 37.0 37.0 34.6 37.0 30-34 35.6977 37.0 37.0 37.0 34.6 37.0 35-39 34.4698 37.0 37.0 37.0 24.2 37.0 40-44 36.220800000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.836 37.0 37.0 37.0 34.6 37.0 50-54 35.65046450993658 37.0 37.0 37.0 34.6 37.0 55-59 35.87347320789428 37.0 37.0 37.0 34.6 37.0 60-64 34.464168791142846 37.0 34.6 37.0 29.4 37.0 65-69 36.042858537954295 37.0 37.0 37.0 37.0 37.0 70-74 35.249764214256594 37.0 37.0 37.0 32.2 37.0 75-79 35.67888079172148 37.0 37.0 37.0 34.6 37.0 80-84 36.127098912930194 37.0 37.0 37.0 37.0 37.0 85-89 36.10933321572251 37.0 37.0 37.0 37.0 37.0 90-94 35.09944585216401 37.0 37.0 37.0 32.2 37.0 95-99 35.26330090998171 37.0 37.0 37.0 31.8 37.0 100-104 35.798930458106916 37.0 37.0 37.0 34.6 37.0 105-109 35.8575503553265 37.0 37.0 37.0 37.0 37.0 110-114 35.490089893431374 37.0 37.0 37.0 34.6 37.0 115-119 35.74728579651031 37.0 37.0 37.0 37.0 37.0 120-124 35.52015042254337 37.0 37.0 37.0 32.2 37.0 125-129 35.81648192581049 37.0 37.0 37.0 37.0 37.0 130-134 35.63279785881116 37.0 37.0 37.0 37.0 37.0 135-139 35.192772335455395 37.0 37.0 37.0 32.2 37.0 140-144 35.84785810029829 37.0 37.0 37.0 37.0 37.0 145-149 35.83125814538788 37.0 37.0 37.0 37.0 37.0 150 36.26680244399186 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 2.0 28 10.0 29 14.0 30 14.0 31 37.0 32 79.0 33 180.0 34 496.0 35 1290.0 36 1812.0 37 65.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.7 26.724999999999998 13.125 29.45 2 23.025000000000002 29.375 28.475 19.125 3 19.925 27.425 31.35 21.3 4 23.75 29.275000000000002 23.1 23.875 5 23.5 32.975 23.849999999999998 19.675 6 22.15 36.275 21.45 20.125 7 19.950000000000003 24.0 35.225 20.825 8 19.8 24.65 28.199999999999996 27.35 9 22.35 22.3 28.95 26.400000000000002 10-14 23.565 27.73 24.735 23.97 15-19 23.48 25.990000000000002 26.355 24.175 20-24 23.549999999999997 26.305 26.13 24.015 25-29 23.745 26.765 26.57 22.919999999999998 30-34 23.28 26.895000000000003 26.205000000000002 23.62 35-39 22.99 27.685 25.480000000000004 23.845 40-44 23.235 26.505000000000003 26.11 24.15 45-49 23.74 26.174999999999997 26.455000000000002 23.630000000000003 50-54 23.52116905214693 26.23861475327795 26.43879491542388 23.801421279151235 55-59 23.249749247743228 26.725175526579743 26.1283851554664 23.89669007021063 60-64 23.67825343327129 26.218622667136177 25.41878364102822 24.684340258564312 65-69 23.766725574349913 26.498359000252464 26.417571320373646 23.317344105023984 70-74 24.681649840190754 25.995636953985084 25.58977220841155 23.732940997412612 75-79 24.676119555238195 26.155258594307867 25.731918800367236 23.436703050086706 80-84 23.84007390679532 26.129131595155 25.759597618558814 24.271196879490866 85-89 24.245248821914974 25.938584226606597 25.938584226606597 23.877582724871836 90-94 23.959475690636587 26.695911013629953 26.07969084547496 23.2649224502585 95-99 24.270921386306004 26.91779374471682 25.306424344885887 23.504860524091292 100-104 23.500775691435297 26.892419622318513 25.581768576472474 24.025036109773712 105-109 24.123733680047675 26.68616934828539 25.510591039601277 23.67950593206566 110-114 24.45092750591732 26.62519953762316 25.84906698959652 23.074805966862993 115-119 24.1493542953397 25.95732734418866 26.030320044918586 23.86299831555306 120-124 24.280947998159228 26.61067648412333 25.172572480441787 23.935803037275655 125-129 24.120603015075375 26.077446053798404 25.645876441028676 24.156074490097545 130-134 23.89149078523204 27.066480141110638 24.980232345964357 24.061796727692965 135-139 24.257925982063913 25.60944802324113 25.60313249968422 24.529493495010737 140-144 24.65959675307672 26.158680282796542 25.43205027494108 23.74967268918565 145-149 24.816553183050175 27.236067957955974 24.505850466054074 23.441528392939777 150 25.797691785471827 26.782077393075355 25.661914460285136 21.758316361167683 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 3.0 27 5.0 28 5.0 29 3.5 30 7.0 31 19.5 32 27.0 33 22.5 34 31.0 35 50.5 36 62.0 37 84.0 38 110.5 39 125.0 40 141.0 41 171.5 42 195.5 43 192.5 44 200.5 45 221.5 46 229.0 47 217.5 48 193.5 49 175.5 50 163.0 51 157.0 52 152.0 53 144.0 54 130.0 55 107.5 56 101.5 57 96.0 58 83.0 59 89.0 60 82.0 61 60.0 62 49.5 63 39.5 64 28.0 65 21.0 66 16.0 67 12.5 68 12.0 69 9.0 70 4.0 71 4.0 72 3.5 73 2.0 74 2.0 75 1.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 9.0 55-59 8.0 60-64 14.0 65-69 21.0 70-74 20.0 75-79 19.0 80-84 34.0 85-89 28.0 90-94 42.0 95-99 48.0 100-104 42.0 105-109 60.0 110-114 64.0 115-119 78.0 120-124 96.0 125-129 90.0 130-134 99.0 135-139 130.0 140-144 70.0 145-149 82.0 150-151 2946.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9433763497498 90.125 2 4.7669212536212795 9.049999999999999 3 0.28970239662891756 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162843 spots for SRR13347971.sra Written 1162843 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra Read 1162831 spots for SRR13347971.sra Written 1162831 spots for SRR13347971.sra SRR ids: ['SRR13347971.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_11x36dsu SRR13347971.sra spots: 23256632 blocks: [[1, 1162831], [1162832, 2325662], [2325663, 3488493], [3488494, 4651324], [4651325, 5814155], [5814156, 6976986], [6976987, 8139817], [8139818, 9302648], [9302649, 10465479], [10465480, 11628310], [11628311, 12791141], [12791142, 13953972], [13953973, 15116803], [15116804, 16279634], [16279635, 17442465], [17442466, 18605296], [18605297, 19768127], [19768128, 20930958], [20930959, 22093789], [22093790, 23256632]] SRR13347971 file size 7457598 SRR13347971 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347971 SRR13347971_1.fastq SRR13347971_2.fastq Input file: SRR13347971_1.fastq Paired file: SRR13347971_2.fastq trimmed: SRR13347971-trimmed-pair1.fastq, SRR13347971-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:46:30 2025 >> started Tue Feb 11 23:46:56 2025 >> done (25.606s) 23256632 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 23256632 (100.00%) read pairs available; of these: 1163904 ( 5.00%) trimmed read pairs available after processing 22092728 (95.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 1 0.00% 40 2 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 5 0.00% 48 1 0.00% 49 2 0.00% 50 3696 0.02% 51 4257 0.02% 52 4549 0.02% 53 4853 0.02% 54 5159 0.02% 55 5205 0.02% 56 5593 0.02% 57 6108 0.03% 58 6968 0.03% 59 7670 0.03% 60 8640 0.04% 61 9564 0.04% 62 10637 0.05% 63 11460 0.05% 64 11924 0.05% 65 11943 0.05% 66 12304 0.05% 67 12798 0.06% 68 13343 0.06% 69 14540 0.06% 70 15557 0.07% 71 17160 0.07% 72 18604 0.08% 73 20359 0.09% 74 20958 0.09% 75 21856 0.09% 76 22225 0.10% 77 22234 0.10% 78 22848 0.10% 79 23967 0.10% 80 25486 0.11% 81 26978 0.12% 82 28922 0.12% 83 30866 0.13% 84 32412 0.14% 85 33834 0.15% 86 34312 0.15% 87 34542 0.15% 88 35206 0.15% 89 35835 0.15% 90 37595 0.16% 91 39052 0.17% 92 41217 0.18% 93 43812 0.19% 94 45734 0.20% 95 48207 0.21% 96 49213 0.21% 97 49696 0.21% 98 49600 0.21% 99 51064 0.22% 100 59153 0.25% 101 60745 0.26% 102 63466 0.27% 103 66228 0.28% 104 68810 0.30% 105 71090 0.31% 106 72570 0.31% 107 73958 0.32% 108 74175 0.32% 109 75464 0.32% 110 76107 0.33% 111 78406 0.34% 112 80592 0.35% 113 83403 0.36% 114 86995 0.37% 115 90808 0.39% 116 93067 0.40% 117 94460 0.41% 118 96552 0.42% 119 97617 0.42% 120 98537 0.42% 121 100758 0.43% 122 104152 0.45% 123 107322 0.46% 124 110574 0.48% 125 113624 0.49% 126 117539 0.51% 127 121224 0.52% 128 122715 0.53% 129 124277 0.53% 130 127008 0.55% 131 127823 0.55% 132 131667 0.57% 133 135762 0.58% 134 138457 0.60% 135 142386 0.61% 136 146704 0.63% 137 151029 0.65% 138 153491 0.66% 139 155973 0.67% 140 156438 0.67% 141 157547 0.68% 142 155262 0.67% 143 161235 0.69% 144 165484 0.71% 145 170759 0.73% 146 173755 0.75% 147 176839 0.76% 148 186342 0.80% 149 891824 3.83% 150 15615883 67.15% 23256632 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.8 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=29.82 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=6.2 sequence=CCTTCCTTGTCCTG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=20 prefix-density=0.36 prefix-fanout=2.2 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=42.52 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=5.5 sequence=AGACCATCACCTTGGAGGTGGAGAGCTC SRR13347971 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:48:08 Started mapping on | Feb 11 23:48:09 Finished on | Feb 12 00:02:28 Mapping speed, Million of reads per hour | 97.47 Number of input reads | 23256632 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 14611082 Uniquely mapped reads % | 62.83% Average mapped length | 281.75 Number of splices: Total | 13536784 Number of splices: Annotated (sjdb) | 13267996 Number of splices: GT/AG | 13324856 Number of splices: GC/AG | 170756 Number of splices: AT/AC | 11306 Number of splices: Non-canonical | 29866 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 529721 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 507269 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 31.51% % of reads unmapped: other | 1.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8117472 8117472 8117472 N_multimapping 529721 529721 529721 N_noFeature 498376 14457074 586519 N_ambiguous 125153 1337 58282 UnstrandedReadsAssigned:13987553 PositiveStrandReadsAssigned:152671 NegativeStrandReadsAssigned:13966281 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR13347971 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347971-trimmed-pair1.fastq SRR13347971-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,256,632 reads, 14,762,065 reads pseudoaligned [quant] estimated average fragment length: 169.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR13347971.ke.tsv 34699 SRR13347971.se.tsv 87100 total ==> SRR13347971.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1849.95 2084 79.4268 Potri.005G024800.1.v4.1 1035 866.955 505 41.0701 Potri.004G059700.1.v4.1 961 792.967 170 15.1156 Potri.007G009000.2.v4.1 1416 1247.95 0 0 Potri.003G141000.2.v4.1 2943 2774.95 609.923 15.4971 Potri.016G087400.1.v4.1 270 104.899 863 580.054 Potri.015G069301.1.v4.1 564 396.024 0 0 Potri.010G195200.1.v4.1 1773 1604.95 369 16.2104 Potri.012G127500.1.v4.1 977 808.955 2683 233.844 ==> SRR13347971.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 921 SRR13347971 completed mapping pipeline successfully