Starting /dee2/code/volunteer_pipeline.sh SRR13347972 current disk space = 3052069613568 free memory = 936188080 SRR13347972 SRAfilesize 1db1d5da4282b5eea03b6a893af58e72 SRR13347972.sra SRR13347972.sra file validated SRR13347972 is paired end SRR13347972 is conventional basespace SRR13347972 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347972_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.459 37.0 37.0 37.0 37.0 37.0 2 36.4575 37.0 37.0 37.0 37.0 37.0 3 36.535 37.0 37.0 37.0 37.0 37.0 4 36.6315 37.0 37.0 37.0 37.0 37.0 5 36.468 37.0 37.0 37.0 37.0 37.0 6 36.667 37.0 37.0 37.0 37.0 37.0 7 36.5195 37.0 37.0 37.0 37.0 37.0 8 36.193 37.0 37.0 37.0 37.0 37.0 9 36.596 37.0 37.0 37.0 37.0 37.0 10-14 36.380700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4945 37.0 37.0 37.0 37.0 37.0 20-24 36.4362 37.0 37.0 37.0 37.0 37.0 25-29 36.4399 37.0 37.0 37.0 37.0 37.0 30-34 36.417 37.0 37.0 37.0 37.0 37.0 35-39 36.3014 37.0 37.0 37.0 37.0 37.0 40-44 36.3811 37.0 37.0 37.0 37.0 37.0 45-49 36.0964 37.0 37.0 37.0 37.0 37.0 50-54 35.9662363534653 37.0 37.0 37.0 34.6 37.0 55-59 35.95942905049805 37.0 37.0 37.0 37.0 37.0 60-64 35.32744501468328 37.0 37.0 37.0 34.6 37.0 65-69 36.17327059699103 37.0 37.0 37.0 37.0 37.0 70-74 36.15935396837996 37.0 37.0 37.0 37.0 37.0 75-79 35.958332759998775 37.0 37.0 37.0 34.6 37.0 80-84 36.14220658603849 37.0 37.0 37.0 37.0 37.0 85-89 36.019967296778134 37.0 37.0 37.0 37.0 37.0 90-94 36.00071339513337 37.0 37.0 37.0 37.0 37.0 95-99 36.01701452734053 37.0 37.0 37.0 37.0 37.0 100-104 35.37145326469582 37.0 37.0 37.0 31.8 37.0 105-109 35.89746531637351 37.0 37.0 37.0 34.6 37.0 110-114 36.022484955676475 37.0 37.0 37.0 37.0 37.0 115-119 35.92722222647068 37.0 37.0 37.0 37.0 37.0 120-124 35.572567407970425 37.0 37.0 37.0 34.6 37.0 125-129 35.73456536852187 37.0 37.0 37.0 34.6 37.0 130-134 35.99102095201097 37.0 37.0 37.0 37.0 37.0 135-139 34.44483769279475 37.0 34.6 37.0 29.4 37.0 140-144 35.33300588429835 37.0 37.0 37.0 34.6 37.0 145-149 35.69152237522566 37.0 37.0 37.0 34.6 37.0 150 36.48002708192281 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 1.0 28 2.0 29 10.0 30 23.0 31 34.0 32 67.0 33 98.0 34 189.0 35 763.0 36 2749.0 37 63.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.325 11.65 12.15 34.875 2 28.275 8.625 29.975 33.125 3 26.125 10.674999999999999 23.925 39.275 4 31.45 12.9 20.8 34.849999999999994 5 32.025 18.275 24.775 24.925 6 27.950000000000003 26.25 24.15 21.65 7 18.775 26.075 36.875 18.275 8 19.525000000000002 26.200000000000003 31.5 22.775000000000002 9 21.8 23.875 32.824999999999996 21.5 10-14 22.82 26.974999999999998 27.575 22.63 15-19 23.599999999999998 26.25 26.974999999999998 23.175 20-24 22.855 26.169999999999998 26.955000000000002 24.02 25-29 23.380000000000003 26.645000000000003 26.305 23.669999999999998 30-34 23.849999999999998 26.029999999999998 26.88 23.24 35-39 23.13 26.1 26.279999999999998 24.490000000000002 40-44 23.06 26.68 26.085 24.175 45-49 22.765 26.479999999999997 26.245 24.51 50-54 23.167742258242033 26.85477012356796 25.96428035419481 24.0132072639952 55-59 23.310116751014682 26.371699153179335 26.38673147266623 23.93145262313975 60-64 23.366127898805342 26.774420238931835 26.101797008332493 23.75765485393033 65-69 23.74672840748943 25.99657741091202 26.323736661968994 23.932957519629554 70-74 23.527333299681995 26.268234819039925 25.94013426884054 24.264297612437534 75-79 22.97947808462123 25.893083354446418 27.048391183177095 24.07904737775526 80-84 23.291577553722377 26.204297789998982 26.789897138201447 23.714227518077198 85-89 22.945943173658836 26.62837214073238 26.325777002769513 24.099907682839266 90-94 23.715456006636597 26.20936382018976 26.77451132887437 23.30066884429927 95-99 23.941222776174232 26.544214117029654 26.4917344528995 23.022828653896614 100-104 23.430028689831047 25.953671235787905 26.878121347359475 23.73817872702157 105-109 23.314439946018894 26.83940620782726 25.954116059379217 23.89203778677463 110-114 23.14158562716334 26.59743970111532 26.800725234877206 23.46024943684413 115-119 23.515930687534937 26.478479597540527 26.55114589155953 23.454443823365008 120-124 23.595247661137577 26.987315617287493 26.24691499741721 23.170521724157723 125-129 23.268845110298457 25.923085997404744 26.925799221422675 23.88226967087413 130-134 23.938931297709924 26.01526717557252 26.595419847328245 23.450381679389313 135-139 23.262609579468936 27.004192605768008 26.642103925803585 23.09109388895947 140-144 22.928213248878333 26.464766429136976 26.39878595935603 24.208234362628662 145-149 23.96506899540031 26.291580561295913 26.44490367308846 23.29844677021532 150 26.134055517941775 26.878808395396074 24.407582938388625 22.579553148273526 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 3.0 28 5.0 29 4.0 30 7.0 31 14.0 32 16.0 33 26.0 34 38.0 35 39.0 36 52.0 37 66.5 38 78.5 39 99.0 40 129.5 41 167.5 42 186.5 43 181.5 44 192.0 45 209.5 46 226.0 47 223.5 48 208.0 49 202.0 50 188.0 51 181.0 52 169.0 53 152.0 54 139.5 55 129.0 56 115.5 57 98.5 58 92.0 59 85.0 60 76.0 61 61.0 62 44.5 63 40.0 64 33.5 65 22.5 66 15.0 67 10.0 68 6.5 69 6.0 70 3.5 71 4.5 72 4.0 73 0.5 74 0.0 75 1.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 5.0 55-59 8.0 60-64 9.0 65-69 10.0 70-74 16.0 75-79 18.0 80-84 18.0 85-89 37.0 90-94 53.0 95-99 40.0 100-104 61.0 105-109 54.0 110-114 68.0 115-119 81.0 120-124 87.0 125-129 106.0 130-134 128.0 135-139 122.0 140-144 77.0 145-149 48.0 150-151 2954.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.61057173678533 85.85000000000001 2 6.930960086299892 12.85 3 0.4314994606256742 1.2 4 0.026968716289104636 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGGCA 10 0.008162827 136.6125 1 >>END_MODULE SRR13347972 read2 length is 51-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347972_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.742 37.0 37.0 37.0 37.0 37.0 2 36.077 37.0 37.0 37.0 37.0 37.0 3 31.8955 37.0 25.0 37.0 11.0 37.0 4 36.3725 37.0 37.0 37.0 37.0 37.0 5 36.3415 37.0 37.0 37.0 37.0 37.0 6 36.373 37.0 37.0 37.0 37.0 37.0 7 34.091 37.0 37.0 37.0 25.0 37.0 8 36.4255 37.0 37.0 37.0 37.0 37.0 9 36.235 37.0 37.0 37.0 37.0 37.0 10-14 34.5261 37.0 37.0 37.0 27.0 37.0 15-19 36.0818 37.0 37.0 37.0 37.0 37.0 20-24 36.024800000000006 37.0 37.0 37.0 34.6 37.0 25-29 36.0686 37.0 37.0 37.0 34.6 37.0 30-34 35.663 37.0 37.0 37.0 34.6 37.0 35-39 34.3737 37.0 37.0 37.0 24.2 37.0 40-44 36.192099999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.8322 37.0 37.0 37.0 34.6 37.0 50-54 35.64672588882157 37.0 37.0 37.0 34.6 37.0 55-59 35.85788245425707 37.0 37.0 37.0 34.6 37.0 60-64 34.31884449341776 37.0 34.6 37.0 29.4 37.0 65-69 36.12048076640181 37.0 37.0 37.0 37.0 37.0 70-74 35.23563519709251 37.0 37.0 37.0 32.2 37.0 75-79 35.65028786367127 37.0 37.0 37.0 34.6 37.0 80-84 36.190647215973954 37.0 37.0 37.0 37.0 37.0 85-89 36.10556775689271 37.0 37.0 37.0 37.0 37.0 90-94 35.069445245776755 37.0 37.0 37.0 32.2 37.0 95-99 35.2805325851633 37.0 34.6 37.0 31.8 37.0 100-104 35.80723039615221 37.0 37.0 37.0 37.0 37.0 105-109 35.84925711626414 37.0 37.0 37.0 37.0 37.0 110-114 35.562904540603526 37.0 37.0 37.0 34.6 37.0 115-119 35.77371156150309 37.0 37.0 37.0 37.0 37.0 120-124 35.58153585063047 37.0 37.0 37.0 32.2 37.0 125-129 35.86716443393969 37.0 37.0 37.0 37.0 37.0 130-134 35.647455205608985 37.0 37.0 37.0 34.6 37.0 135-139 35.283853762534 37.0 37.0 37.0 34.6 37.0 140-144 35.93777679677744 37.0 37.0 37.0 37.0 37.0 145-149 35.87478841158841 37.0 37.0 37.0 37.0 37.0 150 36.155102040816324 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 3.0 28 6.0 29 9.0 30 19.0 31 40.0 32 70.0 33 184.0 34 501.0 35 1345.0 36 1785.0 37 36.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.775000000000002 27.0 13.825000000000001 28.4 2 23.525 29.075 28.025 19.375 3 20.25 28.299999999999997 31.35 20.1 4 24.275 28.475 22.075 25.174999999999997 5 25.525 31.674999999999997 23.875 18.925 6 20.825 36.75 22.225 20.200000000000003 7 21.525 23.200000000000003 35.099999999999994 20.175 8 21.925 23.75 28.349999999999998 25.974999999999998 9 21.65 23.175 30.875000000000004 24.3 10-14 22.41 28.01 24.97 24.610000000000003 15-19 23.39 27.025 26.179999999999996 23.405 20-24 22.715 26.575 27.05 23.66 25-29 23.515 26.450000000000003 26.26 23.775 30-34 22.795 26.775 26.445 23.985 35-39 23.625 27.134999999999998 25.759999999999998 23.48 40-44 23.255 26.8 26.424999999999997 23.52 45-49 23.505000000000003 26.634999999999998 26.22 23.64 50-54 23.54265699274456 26.95521641230923 25.604203152364274 23.897923442581938 55-59 23.964497041420117 26.80774245311403 26.241099187644167 22.98666131782168 60-64 22.980711271850513 26.652601969057667 26.522001205545507 23.844685553546313 65-69 23.787482390823104 26.836385590662104 26.69048098208895 22.685651036425842 70-74 23.43269279265648 26.943057446915823 26.428607454481263 23.195642305946436 75-79 23.40932117527862 26.545086119554206 26.42857142857143 23.617021276595747 80-84 24.42736434897689 25.94421256235366 25.521734704265498 24.10668838440395 85-89 23.814649648880003 26.0853964836742 26.403198523758263 23.696755343687528 90-94 23.801121029686527 26.562175627984224 25.705833506331743 23.93086983599751 95-99 24.071252167516157 26.41479691030424 25.82102884766959 23.692922074510008 100-104 24.64623896159166 26.29003085434621 26.093201404404727 22.97052877965741 105-109 24.310885309696246 26.272835369149284 25.770187006810076 23.646092314344394 110-114 24.267782426778243 26.783748073111653 25.423915437128386 23.52455406298172 115-119 24.619175627240146 26.394489247311824 25.95206093189964 23.034274193548388 120-124 24.080671110089636 26.373247529303605 25.982532751091703 23.563548609515053 125-129 24.27465579388997 26.141937008804582 25.22011463688471 24.363292560420728 130-134 24.272260273972606 26.999755381604697 25.580968688845402 23.1470156555773 135-139 24.48370083243312 26.12950371735401 25.86897121433564 23.51782423587723 140-144 23.942453639543324 26.720781363426383 25.268923645482744 24.067841351547546 145-149 24.77351452171596 27.71116440181188 24.407140953903543 23.108180122568612 150 25.408163265306122 28.367346938775512 23.91156462585034 22.312925170068027 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 0.5 28 2.5 29 4.5 30 9.5 31 14.0 32 19.5 33 27.0 34 43.0 35 62.0 36 57.0 37 66.0 38 98.0 39 119.0 40 151.0 41 178.5 42 197.0 43 234.0 44 237.5 45 209.5 46 216.5 47 222.5 48 200.5 49 199.0 50 189.0 51 163.0 52 154.5 53 128.0 54 116.0 55 115.5 56 95.5 57 85.0 58 85.5 59 78.5 60 61.0 61 52.5 62 39.0 63 28.0 64 26.5 65 21.5 66 14.5 67 8.0 68 6.0 69 6.0 70 4.0 71 1.5 72 1.5 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 2.0 52-53 6.0 54-55 3.0 56-57 2.0 58-59 4.0 60-61 1.0 62-63 2.0 64-65 3.0 66-67 4.0 68-69 3.0 70-71 4.0 72-73 7.0 74-75 8.0 76-77 5.0 78-79 11.0 80-81 6.0 82-83 6.0 84-85 9.0 86-87 22.0 88-89 14.0 90-91 26.0 92-93 18.0 94-95 20.0 96-97 15.0 98-99 20.0 100-101 18.0 102-103 20.0 104-105 35.0 106-107 17.0 108-109 24.0 110-111 32.0 112-113 26.0 114-115 19.0 116-117 30.0 118-119 38.0 120-121 37.0 122-123 35.0 124-125 41.0 126-127 42.0 128-129 44.0 130-131 50.0 132-133 50.0 134-135 50.0 136-137 53.0 138-139 42.0 140-141 50.0 142-143 23.0 144-145 0.0 146-147 0.0 148-149 63.0 150-151 2940.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99736703528173 90.2 2 4.6866771985255395 8.9 3 0.315955766192733 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra Read 1221735 spots for SRR13347972.sra Written 1221735 spots for SRR13347972.sra SRR ids: ['SRR13347972.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bh2nc_ef SRR13347972.sra spots: 24434700 blocks: [[1, 1221735], [1221736, 2443470], [2443471, 3665205], [3665206, 4886940], [4886941, 6108675], [6108676, 7330410], [7330411, 8552145], [8552146, 9773880], [9773881, 10995615], [10995616, 12217350], [12217351, 13439085], [13439086, 14660820], [14660821, 15882555], [15882556, 17104290], [17104291, 18326025], [18326026, 19547760], [19547761, 20769495], [20769496, 21991230], [21991231, 23212965], [23212966, 24434700]] SRR13347972 file size 7848107 SRR13347972 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347972 SRR13347972_1.fastq SRR13347972_2.fastq Input file: SRR13347972_1.fastq Paired file: SRR13347972_2.fastq trimmed: SRR13347972-trimmed-pair1.fastq, SRR13347972-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:50:33 2025 >> started Tue Feb 11 23:50:59 2025 >> done (25.461s) 24434700 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24434700 (100.00%) read pairs available; of these: 1249623 ( 5.11%) trimmed read pairs available after processing 23185077 (94.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 43 2 0.00% 44 1 0.00% 45 1 0.00% 46 2 0.00% 47 3 0.00% 48 1 0.00% 49 11 0.00% 50 3611 0.01% 51 3975 0.02% 52 4508 0.02% 53 4978 0.02% 54 4998 0.02% 55 5066 0.02% 56 5693 0.02% 57 5971 0.02% 58 6700 0.03% 59 7632 0.03% 60 8423 0.03% 61 9615 0.04% 62 10361 0.04% 63 11048 0.05% 64 11577 0.05% 65 11797 0.05% 66 11934 0.05% 67 12539 0.05% 68 13046 0.05% 69 13837 0.06% 70 15112 0.06% 71 16757 0.07% 72 18220 0.07% 73 19496 0.08% 74 20361 0.08% 75 21362 0.09% 76 21764 0.09% 77 21579 0.09% 78 22596 0.09% 79 23278 0.10% 80 24692 0.10% 81 26607 0.11% 82 28701 0.12% 83 30133 0.12% 84 31898 0.13% 85 33367 0.14% 86 33471 0.14% 87 33919 0.14% 88 34377 0.14% 89 35160 0.14% 90 37090 0.15% 91 39027 0.16% 92 40893 0.17% 93 43891 0.18% 94 46255 0.19% 95 48173 0.20% 96 49047 0.20% 97 50035 0.20% 98 49940 0.20% 99 51285 0.21% 100 59586 0.24% 101 61480 0.25% 102 64443 0.26% 103 67741 0.28% 104 69886 0.29% 105 72958 0.30% 106 75353 0.31% 107 75789 0.31% 108 76845 0.31% 109 77256 0.32% 110 78770 0.32% 111 81529 0.33% 112 83880 0.34% 113 87180 0.36% 114 90155 0.37% 115 94216 0.39% 116 97390 0.40% 117 99069 0.41% 118 100086 0.41% 119 101248 0.41% 120 103432 0.42% 121 105823 0.43% 122 108557 0.44% 123 112737 0.46% 124 116377 0.48% 125 119769 0.49% 126 124466 0.51% 127 127834 0.52% 128 129877 0.53% 129 131884 0.54% 130 133143 0.54% 131 135019 0.55% 132 139231 0.57% 133 142028 0.58% 134 146609 0.60% 135 150005 0.61% 136 155398 0.64% 137 159616 0.65% 138 162823 0.67% 139 164312 0.67% 140 166982 0.68% 141 167629 0.69% 142 165410 0.68% 143 172293 0.71% 144 177793 0.73% 145 182656 0.75% 146 186704 0.76% 147 190459 0.78% 148 200118 0.82% 149 950819 3.89% 150 16454221 67.34% 24434700 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=2.8 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=74.77 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.1 sequence=TTGATCTTGGCAACAGACCCAATATGGCAGACGGTGTATTCACTAAATGTGGAACCGCCAACAAAAT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=31 prefix-density=0.40 prefix-fanout=2.2 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=66.55 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.9 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR13347972 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:52:11 Started mapping on | Feb 11 23:52:12 Finished on | Feb 12 00:06:37 Mapping speed, Million of reads per hour | 101.69 Number of input reads | 24434700 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 16020569 Uniquely mapped reads % | 65.56% Average mapped length | 282.23 Number of splices: Total | 14966812 Number of splices: Annotated (sjdb) | 14670890 Number of splices: GT/AG | 14732988 Number of splices: GC/AG | 187939 Number of splices: AT/AC | 12890 Number of splices: Non-canonical | 32995 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 558817 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 66653 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 31.65% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7857229 7857229 7857229 N_multimapping 558817 558817 558817 N_noFeature 529268 15853282 623999 N_ambiguous 137396 1198 63987 UnstrandedReadsAssigned:15353905 PositiveStrandReadsAssigned:166089 NegativeStrandReadsAssigned:15332583 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR13347972 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347972-trimmed-pair1.fastq SRR13347972-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,434,700 reads, 15,743,817 reads pseudoaligned [quant] estimated average fragment length: 168.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR13347972.ke.tsv 34699 SRR13347972.se.tsv 87100 total ==> SRR13347972.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1850.37 2311 82.6932 Potri.005G024800.1.v4.1 1035 867.369 625 47.7094 Potri.004G059700.1.v4.1 961 793.369 208 17.3587 Potri.007G009000.2.v4.1 1416 1248.37 0 0 Potri.003G141000.2.v4.1 2943 2775.37 636.223 15.1781 Potri.016G087400.1.v4.1 270 105.071 938.333 591.29 Potri.015G069301.1.v4.1 564 396.429 0 0 Potri.010G195200.1.v4.1 1773 1605.37 390 16.0849 Potri.012G127500.1.v4.1 977 809.369 2999 245.334 ==> SRR13347972.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1218 SRR13347972 completed mapping pipeline successfully