Starting /dee2/code/volunteer_pipeline.sh SRR13347973 current disk space = 3051781140480 free memory = 1005997212 SRR13347973 SRAfilesize 5cbc6e4402ee669b13525c0eb5e872ab SRR13347973.sra SRR13347973.sra file validated SRR13347973 is paired end SRR13347973 is conventional basespace SRR13347973 read1 length is 51-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347973_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.531 37.0 37.0 37.0 37.0 37.0 2 36.445 37.0 37.0 37.0 37.0 37.0 3 36.5505 37.0 37.0 37.0 37.0 37.0 4 36.555 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.4875 37.0 37.0 37.0 37.0 37.0 7 36.538 37.0 37.0 37.0 37.0 37.0 8 36.3015 37.0 37.0 37.0 37.0 37.0 9 36.594 37.0 37.0 37.0 37.0 37.0 10-14 36.4009 37.0 37.0 37.0 37.0 37.0 15-19 36.495400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.429700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4781 37.0 37.0 37.0 37.0 37.0 30-34 36.4174 37.0 37.0 37.0 37.0 37.0 35-39 36.2647 37.0 37.0 37.0 37.0 37.0 40-44 36.2977 37.0 37.0 37.0 37.0 37.0 45-49 35.9699 37.0 37.0 37.0 37.0 37.0 50-54 35.88530588976407 37.0 37.0 37.0 34.6 37.0 55-59 35.965831308151934 37.0 37.0 37.0 34.6 37.0 60-64 35.14277438483852 37.0 37.0 37.0 31.8 37.0 65-69 36.11261260245899 37.0 37.0 37.0 37.0 37.0 70-74 36.055444193851976 37.0 37.0 37.0 37.0 37.0 75-79 35.87763660913332 37.0 37.0 37.0 34.6 37.0 80-84 36.16294745463422 37.0 37.0 37.0 37.0 37.0 85-89 35.96624986795223 37.0 37.0 37.0 34.6 37.0 90-94 35.842579384921905 37.0 37.0 37.0 32.2 37.0 95-99 36.074950459097344 37.0 37.0 37.0 37.0 37.0 100-104 35.318698531921555 37.0 34.6 37.0 31.8 37.0 105-109 35.66006243384062 37.0 37.0 37.0 34.6 37.0 110-114 36.02238551835112 37.0 37.0 37.0 37.0 37.0 115-119 35.887221926331016 37.0 37.0 37.0 37.0 37.0 120-124 35.4534927136023 37.0 37.0 37.0 34.6 37.0 125-129 35.564389637393575 37.0 37.0 37.0 34.6 37.0 130-134 36.05410998113844 37.0 37.0 37.0 37.0 37.0 135-139 34.129226134619756 37.0 34.6 37.0 29.4 37.0 140-144 35.137378833915434 37.0 37.0 37.0 31.8 37.0 145-149 35.63525735024875 37.0 37.0 37.0 34.6 37.0 150 36.47860434496379 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 11.0 29 15.0 30 18.0 31 39.0 32 47.0 33 99.0 34 196.0 35 944.0 36 2565.0 37 65.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5 10.575 11.825 35.099999999999994 2 27.650000000000002 8.375 29.549999999999997 34.425 3 23.375 10.525 23.825 42.275 4 29.575000000000003 15.8 19.55 35.075 5 30.65 19.85 24.95 24.55 6 27.85 27.650000000000002 22.7 21.8 7 20.474999999999998 25.724999999999998 37.45 16.35 8 18.875 25.0 32.824999999999996 23.3 9 20.575 23.3 33.375 22.75 10-14 22.689999999999998 27.51 27.16 22.64 15-19 22.655 26.14 26.919999999999998 24.285 20-24 23.325000000000003 26.145000000000003 26.565 23.965 25-29 22.52 26.145000000000003 27.305 24.03 30-34 23.14 25.945 26.424999999999997 24.490000000000002 35-39 23.305 26.634999999999998 26.095000000000002 23.965 40-44 22.965 26.245 27.015 23.775 45-49 22.97 26.565 26.655 23.810000000000002 50-54 22.57757757757758 26.79179179179179 26.76176176176176 23.86886886886887 55-59 23.801636299754055 25.76419213973799 26.220950660041158 24.213220900466798 60-64 23.371917463512833 27.141419224962256 25.797684952189233 23.68897835933568 65-69 23.38823767178658 25.899353274050117 26.682497978981406 24.029911075181893 70-74 23.34280783676784 26.31204953811796 26.697797177951475 23.647345447162724 75-79 23.409903011740685 26.2736089841756 27.161817253700864 23.15467075038285 80-84 23.559887150551422 26.62734034367787 26.324698640677095 23.488073865093615 85-89 22.803304078471864 26.639132679401133 26.46360351058338 24.093959731543624 90-94 22.689644400478993 26.43307127609726 25.995730723173843 24.88155360024991 95-99 23.391290644534326 26.642853390765353 26.159583968062194 23.806271996638127 100-104 23.165941182715788 26.489011572353753 26.99861981102028 23.34642743391018 105-109 23.225702466018376 26.073174662870034 26.599688389835062 24.101434481276527 110-114 23.130216573018384 26.616114778244505 26.741585292673616 23.5120833560635 115-119 23.492769744160178 26.295884315906566 26.573971078976637 23.63737486095662 120-124 23.401345035905617 26.792431323378548 26.3820813860709 23.424142254644934 125-129 23.133500671297647 26.02883661198996 26.60089895511062 24.23676376160177 130-134 23.426929294138777 26.366520984254326 26.444351314135183 23.762198407471715 135-139 23.289190021558362 27.034185401909454 26.947951955651373 22.728672620880815 140-144 23.731953494314553 26.753545419701037 26.389421234189342 23.125079851795068 145-149 24.07012096513358 26.521767255320526 26.64467300601591 22.76343877352998 150 23.403554970375247 25.806451612903224 26.662277814351548 24.12771560236998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 3.5 28 5.0 29 7.5 30 12.5 31 12.5 32 17.0 33 28.0 34 33.0 35 43.0 36 57.0 37 71.0 38 85.5 39 100.0 40 121.0 41 148.0 42 180.5 43 209.0 44 215.0 45 203.5 46 202.0 47 211.0 48 207.0 49 199.5 50 193.5 51 170.5 52 158.0 53 156.5 54 141.0 55 128.0 56 120.5 57 109.5 58 96.5 59 81.5 60 69.5 61 55.5 62 46.5 63 44.0 64 28.0 65 18.0 66 17.0 67 13.5 68 9.0 69 7.0 70 5.5 71 2.5 72 1.0 73 0.5 74 2.0 75 2.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 4.0 52-53 5.0 54-55 3.0 56-57 7.0 58-59 1.0 60-61 6.0 62-63 4.0 64-65 7.0 66-67 10.0 68-69 5.0 70-71 8.0 72-73 7.0 74-75 11.0 76-77 9.0 78-79 5.0 80-81 9.0 82-83 9.0 84-85 12.0 86-87 7.0 88-89 12.0 90-91 17.0 92-93 19.0 94-95 11.0 96-97 9.0 98-99 14.0 100-101 23.0 102-103 14.0 104-105 16.0 106-107 28.0 108-109 21.0 110-111 19.0 112-113 26.0 114-115 32.0 116-117 29.0 118-119 30.0 120-121 47.0 122-123 31.0 124-125 27.0 126-127 37.0 128-129 40.0 130-131 30.0 132-133 26.0 134-135 40.0 136-137 49.0 138-139 40.0 140-141 63.0 142-143 27.0 144-145 2.0 146-147 0.0 148-149 54.0 150-151 3038.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 92.84943335132218 86.02499999999999 2 6.368051807879114 11.799999999999999 3 0.7825148407987047 2.175 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13347973 read2 length is 51-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347973_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-150 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7725 37.0 37.0 37.0 37.0 37.0 2 36.163 37.0 37.0 37.0 37.0 37.0 3 30.718 37.0 25.0 37.0 11.0 37.0 4 36.342 37.0 37.0 37.0 37.0 37.0 5 36.294 37.0 37.0 37.0 37.0 37.0 6 36.2995 37.0 37.0 37.0 37.0 37.0 7 33.2915 37.0 37.0 37.0 25.0 37.0 8 36.454 37.0 37.0 37.0 37.0 37.0 9 36.203 37.0 37.0 37.0 37.0 37.0 10-14 34.1285 37.0 34.6 37.0 27.0 37.0 15-19 35.9677 37.0 37.0 37.0 34.6 37.0 20-24 35.8447 37.0 37.0 37.0 34.6 37.0 25-29 35.9283 37.0 37.0 37.0 34.6 37.0 30-34 35.383399999999995 37.0 37.0 37.0 31.8 37.0 35-39 33.656499999999994 37.0 34.6 37.0 21.4 37.0 40-44 36.131800000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.685900000000004 37.0 37.0 37.0 34.6 37.0 50-54 35.37857780369991 37.0 37.0 37.0 34.6 37.0 55-59 35.55436407202279 37.0 37.0 37.0 34.6 37.0 60-64 33.827136325801 37.0 31.8 37.0 29.4 37.0 65-69 35.9465112436087 37.0 37.0 37.0 37.0 37.0 70-74 34.843240446768206 37.0 37.0 37.0 32.2 37.0 75-79 35.41527935008267 37.0 37.0 37.0 34.6 37.0 80-84 36.06962328175807 37.0 37.0 37.0 37.0 37.0 85-89 36.07341880921676 37.0 37.0 37.0 37.0 37.0 90-94 34.67731761390543 37.0 37.0 37.0 24.6 37.0 95-99 34.923335222848564 37.0 34.6 37.0 31.8 37.0 100-104 35.67044449209528 37.0 37.0 37.0 34.6 37.0 105-109 35.61810830599527 37.0 37.0 37.0 34.6 37.0 110-114 35.39440734643914 37.0 37.0 37.0 32.2 37.0 115-119 35.542841833082505 37.0 37.0 37.0 32.2 37.0 120-124 35.32536555721374 37.0 37.0 37.0 32.2 37.0 125-129 35.689235141505876 37.0 37.0 37.0 37.0 37.0 130-134 35.3585527358569 37.0 37.0 37.0 32.2 37.0 135-139 34.94781679052784 37.0 37.0 37.0 29.4 37.0 140-144 35.73426592092316 37.0 37.0 37.0 37.0 37.0 145-149 35.7308720889942 37.0 37.0 37.0 34.6 37.0 150 36.10158311345646 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 1.0 28 3.0 29 13.0 30 27.0 31 50.0 32 88.0 33 242.0 34 660.0 35 1595.0 36 1304.0 37 16.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.95 27.1 13.075000000000001 28.875 2 22.400000000000002 29.15 29.125 19.325 3 19.7 29.349999999999998 32.1 18.85 4 24.575 29.7 22.900000000000002 22.825 5 25.45 32.35 23.075000000000003 19.125 6 19.1 37.775 22.8 20.325 7 20.549999999999997 23.275000000000002 36.075 20.1 8 21.675 22.925 28.249999999999996 27.150000000000002 9 21.725 23.7 30.349999999999998 24.224999999999998 10-14 22.32 28.005000000000003 25.665 24.01 15-19 23.46 26.974999999999998 26.484999999999996 23.080000000000002 20-24 22.685 26.419999999999998 26.825 24.07 25-29 23.655 26.674999999999997 26.165 23.505000000000003 30-34 23.400000000000002 27.265 26.0 23.335 35-39 22.405 27.779999999999998 25.66 24.154999999999998 40-44 23.65 26.88 26.450000000000003 23.02 45-49 23.44 26.650000000000002 26.355 23.555 50-54 23.108486789431545 26.886509207365894 26.07586068855084 23.92914331465172 55-59 23.591054953870838 26.30365022061773 26.519253910950663 23.586040914560773 60-64 22.762469831053902 27.14702333065165 25.88495575221239 24.205551086082057 65-69 23.74728768229298 27.234192864712114 25.97264974516829 23.045869707826615 70-74 23.53269133299544 27.30359858084136 25.57019766852509 23.593512417638117 75-79 23.850267379679142 27.216704863763685 25.627705627705627 23.30532212885154 80-84 24.035213430238507 26.49196437711127 26.02620534343331 23.446616849216912 85-89 23.871831856583555 26.61240469812487 26.334226251803006 23.181537193488563 90-94 23.4718826405868 26.9520886438121 25.53191489361702 24.04411382198408 95-99 24.239238976191725 26.835549482314608 25.49009302570032 23.435118515793345 100-104 23.922047578589634 27.129354290569246 26.162914188615122 22.785683942225997 105-109 23.95206362854686 25.96195184866724 26.27364574376612 23.812338779019775 110-114 24.15917143635868 27.658762605614605 25.32570182611066 22.856364131916056 115-119 24.016861722779968 26.612679571800985 26.091297354262576 23.279161351156468 120-124 23.58683314415437 26.71396140749149 26.367763904653803 23.33144154370034 125-129 23.795128190221497 26.597290855182838 25.91128422766118 23.69629672693448 130-134 24.65002680645738 26.413296002859354 26.12140346696849 22.81527372371478 135-139 24.57933060025699 26.500642476901426 25.49715474515083 23.422872177690753 140-144 24.752851711026615 27.19898605830165 25.076045627376427 22.972116603295312 145-149 24.86517719568567 27.324088341037495 25.12840267077555 22.682331792501284 150 24.604221635883906 26.550131926121374 25.725593667546175 23.12005277044855 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 2.0 26 3.5 27 4.5 28 7.5 29 9.5 30 10.5 31 16.0 32 23.5 33 30.0 34 36.0 35 45.0 36 68.0 37 93.0 38 109.0 39 132.5 40 159.5 41 194.5 42 199.5 43 193.0 44 205.5 45 215.0 46 212.5 47 202.5 48 203.0 49 196.5 50 186.0 51 165.0 52 136.0 53 121.0 54 107.5 55 110.0 56 108.0 57 99.5 58 87.5 59 69.0 60 62.5 61 53.5 62 43.0 63 28.0 64 21.5 65 22.0 66 18.0 67 11.5 68 7.0 69 3.5 70 3.5 71 4.0 72 2.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 3.0 52-53 5.0 54-55 2.0 56-57 2.0 58-59 3.0 60-61 8.0 62-63 5.0 64-65 4.0 66-67 9.0 68-69 5.0 70-71 9.0 72-73 6.0 74-75 8.0 76-77 9.0 78-79 6.0 80-81 10.0 82-83 5.0 84-85 14.0 86-87 8.0 88-89 14.0 90-91 20.0 92-93 22.0 94-95 12.0 96-97 11.0 98-99 13.0 100-101 22.0 102-103 16.0 104-105 14.0 106-107 28.0 108-109 20.0 110-111 17.0 112-113 22.0 114-115 28.0 116-117 29.0 118-119 28.0 120-121 39.0 122-123 38.0 124-125 27.0 126-127 35.0 128-129 37.0 130-131 30.0 132-133 28.0 134-135 36.0 136-137 48.0 138-139 36.0 140-141 58.0 142-143 33.0 144-145 2.0 146-147 0.0 148-149 84.0 150-151 3032.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.98225932689799 91.975 2 3.678580746151839 7.049999999999999 3 0.33915992695016955 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra Read 1348946 spots for SRR13347973.sra Written 1348946 spots for SRR13347973.sra SRR ids: ['SRR13347973.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_db724pbc SRR13347973.sra spots: 26978920 blocks: [[1, 1348946], [1348947, 2697892], [2697893, 4046838], [4046839, 5395784], [5395785, 6744730], [6744731, 8093676], [8093677, 9442622], [9442623, 10791568], [10791569, 12140514], [12140515, 13489460], [13489461, 14838406], [14838407, 16187352], [16187353, 17536298], [17536299, 18885244], [18885245, 20234190], [20234191, 21583136], [21583137, 22932082], [22932083, 24281028], [24281029, 25629974], [25629975, 26978920]] SRR13347973 file size 8673391 SRR13347973 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347973 SRR13347973_1.fastq SRR13347973_2.fastq Input file: SRR13347973_1.fastq Paired file: SRR13347973_2.fastq trimmed: SRR13347973-trimmed-pair1.fastq, SRR13347973-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:13:36 2025 >> started Wed Feb 12 00:14:06 2025 >> done (30.506s) 26978920 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 26978920 (100.00%) read pairs available; of these: 1235882 ( 4.58%) trimmed read pairs available after processing 25743038 (95.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 4 0.00% 49 5 0.00% 50 4865 0.02% 51 5603 0.02% 52 5977 0.02% 53 6424 0.02% 54 6469 0.02% 55 6888 0.03% 56 7070 0.03% 57 7881 0.03% 58 8882 0.03% 59 9917 0.04% 60 10971 0.04% 61 12506 0.05% 62 13068 0.05% 63 14300 0.05% 64 14805 0.05% 65 15025 0.06% 66 15372 0.06% 67 15723 0.06% 68 16218 0.06% 69 17570 0.07% 70 19108 0.07% 71 20576 0.08% 72 22781 0.08% 73 24007 0.09% 74 25291 0.09% 75 25775 0.10% 76 26014 0.10% 77 26069 0.10% 78 26692 0.10% 79 27975 0.10% 80 29531 0.11% 81 31305 0.12% 82 33355 0.12% 83 35512 0.13% 84 37218 0.14% 85 38751 0.14% 86 38907 0.14% 87 39200 0.15% 88 39412 0.15% 89 40083 0.15% 90 41817 0.15% 91 43913 0.16% 92 45854 0.17% 93 48927 0.18% 94 51125 0.19% 95 53200 0.20% 96 53635 0.20% 97 54189 0.20% 98 54473 0.20% 99 55340 0.21% 100 65702 0.24% 101 66851 0.25% 102 69815 0.26% 103 73721 0.27% 104 74914 0.28% 105 78024 0.29% 106 79968 0.30% 107 80394 0.30% 108 80577 0.30% 109 82341 0.31% 110 82750 0.31% 111 84993 0.32% 112 88245 0.33% 113 90717 0.34% 114 93547 0.35% 115 97368 0.36% 116 100024 0.37% 117 101493 0.38% 118 102582 0.38% 119 103353 0.38% 120 105622 0.39% 121 108469 0.40% 122 110602 0.41% 123 113971 0.42% 124 117965 0.44% 125 121640 0.45% 126 125215 0.46% 127 129538 0.48% 128 130578 0.48% 129 132550 0.49% 130 133641 0.50% 131 136112 0.50% 132 139186 0.52% 133 142594 0.53% 134 146157 0.54% 135 150462 0.56% 136 155300 0.58% 137 159278 0.59% 138 161675 0.60% 139 164373 0.61% 140 164692 0.61% 141 166551 0.62% 142 164558 0.61% 143 172636 0.64% 144 176321 0.65% 145 181603 0.67% 146 185750 0.69% 147 190557 0.71% 148 199699 0.74% 149 1069100 3.96% 150 18599566 68.94% 26978920 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=32 prefix-density=0.28 prefix-fanout=2.9 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=177.84 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.6 sequence=TCAAGTTCTGATTGCATCGTCTTTTGCGAGCATGACTGATGGTCTTTGATCCTAACACCGCCTGGTTCCTGACCTTCCAGTTGTCATAATTCCCTTCCCCGTAATGTTCATTGTGTGCCCAACAGCCGCTCAAGTGCGGGGTTCCACCACCGTGACGTAGTTCCCAAAGTCAAATCCCAGCTCATAACGTTGCGGGACATCCCAGAGGCGCCAAGGTAGCGTTCGCAGCTTCGGCCAGAGTATCGTTGTGCGTGTGAAGTCGTAACATCATGAGAGATGAGTCAAGTCAGGTTGAGGTGCGAGGTGTTTATTTGGATCGAGCCCTCATCTTTCTTCTCTTGCGCTTGAGGCGGCGAACCCGCTTCTTCCTCCATTTGGCTCTCATCTTGATTGACGATGTCTTTCGTGGATGAG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=31 prefix-density=0.38 prefix-fanout=2.2 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=41.97 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=5.4 sequence=AGACCATCACCTTGGAGGTGGAGAGCTC SRR13347973 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:15:26 Started mapping on | Feb 12 00:15:26 Finished on | Feb 12 00:31:57 Mapping speed, Million of reads per hour | 98.01 Number of input reads | 26978920 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 17862628 Uniquely mapped reads % | 66.21% Average mapped length | 282.50 Number of splices: Total | 16694266 Number of splices: Annotated (sjdb) | 16366093 Number of splices: GT/AG | 16433306 Number of splices: GC/AG | 210791 Number of splices: AT/AC | 14227 Number of splices: Non-canonical | 35942 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621513 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 83621 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 30.94% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8496786 8496786 8496786 N_multimapping 621513 621513 621513 N_noFeature 585851 17672361 696053 N_ambiguous 153261 1453 72124 UnstrandedReadsAssigned:17123516 PositiveStrandReadsAssigned:188814 NegativeStrandReadsAssigned:17094451 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR13347973 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347973-trimmed-pair1.fastq SRR13347973-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,978,920 reads, 17,551,869 reads pseudoaligned [quant] estimated average fragment length: 172.083 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR13347973.ke.tsv 34699 SRR13347973.se.tsv 87100 total ==> SRR13347973.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1846.92 2684.63 86.5372 Potri.005G024800.1.v4.1 1035 863.917 628 43.2767 Potri.004G059700.1.v4.1 961 789.917 202 15.2243 Potri.007G009000.2.v4.1 1416 1244.92 0 0 Potri.003G141000.2.v4.1 2943 2771.92 754.961 16.2148 Potri.016G087400.1.v4.1 270 102.435 969 563.175 Potri.015G069301.1.v4.1 564 392.977 0 0 Potri.010G195200.1.v4.1 1773 1601.92 435.925 16.2009 Potri.012G127500.1.v4.1 977 805.917 3210 237.127 ==> SRR13347973.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1087 SRR13347973 completed mapping pipeline successfully