Starting /dee2/code/volunteer_pipeline.sh SRR13347974 current disk space = 3051129827328 free memory = 1579061052 SRR13347974 SRAfilesize 4de55fc88c9612885f538773908ba626 SRR13347974.sra SRR13347974.sra file validated SRR13347974 is paired end SRR13347974 is conventional basespace SRR13347974 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347974_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.415 37.0 37.0 37.0 37.0 37.0 2 36.5265 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.559 37.0 37.0 37.0 37.0 37.0 5 36.478 37.0 37.0 37.0 37.0 37.0 6 36.5265 37.0 37.0 37.0 37.0 37.0 7 36.593 37.0 37.0 37.0 37.0 37.0 8 36.2185 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.41459999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5462 37.0 37.0 37.0 37.0 37.0 20-24 36.4118 37.0 37.0 37.0 37.0 37.0 25-29 36.4161 37.0 37.0 37.0 37.0 37.0 30-34 36.4076 37.0 37.0 37.0 37.0 37.0 35-39 36.2491 37.0 37.0 37.0 37.0 37.0 40-44 36.351600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.977000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.87665352941167 37.0 37.0 37.0 34.6 37.0 55-59 35.99961193355991 37.0 37.0 37.0 34.6 37.0 60-64 35.136808010801914 37.0 37.0 37.0 29.4 37.0 65-69 36.11873978440467 37.0 37.0 37.0 37.0 37.0 70-74 36.113154569095 37.0 37.0 37.0 37.0 37.0 75-79 35.97412097044461 37.0 37.0 37.0 34.6 37.0 80-84 36.07386266824452 37.0 37.0 37.0 37.0 37.0 85-89 35.93703721445775 37.0 37.0 37.0 34.6 37.0 90-94 35.90726005520545 37.0 37.0 37.0 34.6 37.0 95-99 36.072327489210764 37.0 37.0 37.0 37.0 37.0 100-104 35.35594512995667 37.0 37.0 37.0 31.8 37.0 105-109 35.76705491965583 37.0 37.0 37.0 34.6 37.0 110-114 36.00356656614052 37.0 37.0 37.0 37.0 37.0 115-119 35.96217368565581 37.0 37.0 37.0 37.0 37.0 120-124 35.49040786641259 37.0 37.0 37.0 34.6 37.0 125-129 35.68994808020342 37.0 37.0 37.0 34.6 37.0 130-134 36.019816196401514 37.0 37.0 37.0 37.0 37.0 135-139 34.252387135606 37.0 34.6 37.0 29.4 37.0 140-144 35.24355404229307 37.0 37.0 37.0 31.8 37.0 145-149 35.665964471662946 37.0 37.0 37.0 34.6 37.0 150 36.46729922060319 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 3.0 28 3.0 29 13.0 30 14.0 31 37.0 32 69.0 33 77.0 34 200.0 35 889.0 36 2629.0 37 66.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 12.0 10.975 38.275 2 24.8 8.325000000000001 31.75 35.125 3 21.875 10.525 26.05 41.55 4 26.05 14.249999999999998 21.349999999999998 38.35 5 26.974999999999998 21.525 24.825 26.674999999999997 6 23.3 29.4 24.975 22.325 7 16.025 25.6 40.525 17.849999999999998 8 17.45 26.400000000000002 33.800000000000004 22.35 9 17.724999999999998 26.075 34.55 21.65 10-14 19.37 29.21 28.535 22.884999999999998 15-19 20.135 27.825 28.415000000000003 23.625 20-24 20.28 28.444999999999997 27.785 23.49 25-29 20.26 28.125 27.54 24.075 30-34 20.06 28.060000000000002 27.68 24.2 35-39 20.119999999999997 27.79 28.71 23.380000000000003 40-44 20.86 28.26 27.395000000000003 23.485 45-49 20.200000000000003 27.92 28.03 23.849999999999998 50-54 20.275275275275277 28.553553553553552 27.347347347347345 23.823823823823822 55-59 20.545746388443018 27.969502407704656 27.844101123595504 23.640650080256822 60-64 19.986926790024135 28.40909090909091 27.629726468222042 23.974255832662912 65-69 20.354963948973932 28.296273886956087 27.308021983562746 24.040740180507235 70-74 20.398967140904258 28.059338767657334 28.003645385043797 23.538048706394612 75-79 20.687197760244334 28.266734538050393 27.803512344107915 23.242555357597354 80-84 20.716295727807623 28.08390892811461 27.577385520593502 23.622409823484265 85-89 20.556756200473398 27.616548317381906 28.069362972110735 23.75733251003396 90-94 20.68265778656538 28.01394453405484 27.774598054009054 23.528799625370727 95-99 20.98063973063973 28.14604377104377 27.072811447811446 23.80050505050505 100-104 20.07658352390576 28.591182258150294 27.8253470190927 23.50688719885125 105-109 20.84858927417618 28.677579151410725 27.186086581951326 23.28774499246177 110-114 20.786824250383017 28.458087108776535 26.969796454366385 23.785292186474063 115-119 20.20855406234317 28.34439301845759 27.2179780293314 24.229074889867842 120-124 20.54865127999542 27.87354676135387 27.936544298722872 23.641257659927838 125-129 20.9346235544017 27.690582959641258 27.808590984186925 23.56620250177012 130-134 20.42519493177388 27.686403508771928 27.765594541910332 24.12280701754386 135-139 20.72855612277053 28.556122770530028 28.266212894687087 22.44910821201235 140-144 21.17934173207572 28.355649363498447 27.45201503858585 23.012993865839984 145-149 21.092291277674047 28.901040277407308 27.64070418778341 22.365964257135236 150 21.314808539478143 27.414435784479835 26.49949169772958 24.771263978312437 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 3.0 27 4.0 28 5.5 29 9.0 30 15.0 31 20.5 32 24.0 33 27.5 34 38.5 35 55.0 36 79.0 37 95.0 38 108.0 39 158.0 40 194.0 41 210.5 42 255.5 43 283.0 44 280.0 45 267.0 46 272.0 47 284.5 48 250.5 49 205.5 50 173.5 51 148.0 52 114.5 53 94.0 54 86.5 55 60.0 56 49.5 57 43.0 58 34.5 59 28.0 60 20.5 61 14.0 62 6.5 63 9.0 64 7.0 65 3.0 66 4.0 67 2.5 68 1.0 69 1.0 70 0.5 71 1.0 72 3.0 73 2.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 11.0 55-59 8.0 60-64 9.0 65-69 14.0 70-74 21.0 75-79 20.0 80-84 20.0 85-89 33.0 90-94 46.0 95-99 41.0 100-104 49.0 105-109 45.0 110-114 62.0 115-119 91.0 120-124 89.0 125-129 121.0 130-134 95.0 135-139 142.0 140-144 83.0 145-149 49.0 150-151 2951.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20779220779221 85.2 2 7.386363636363637 13.65 3 0.3787878787878788 1.05 4 0.027056277056277056 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATTT 10 0.008378672 135.425 3 >>END_MODULE SRR13347974 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347974_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6525 37.0 37.0 37.0 37.0 37.0 2 36.072 37.0 37.0 37.0 37.0 37.0 3 31.1195 37.0 25.0 37.0 11.0 37.0 4 36.2385 37.0 37.0 37.0 37.0 37.0 5 36.2725 37.0 37.0 37.0 37.0 37.0 6 36.165 37.0 37.0 37.0 37.0 37.0 7 33.526 37.0 37.0 37.0 25.0 37.0 8 36.355 37.0 37.0 37.0 37.0 37.0 9 36.3255 37.0 37.0 37.0 37.0 37.0 10-14 34.302899999999994 37.0 34.6 37.0 27.0 37.0 15-19 35.9779 37.0 37.0 37.0 37.0 37.0 20-24 35.902100000000004 37.0 37.0 37.0 34.6 37.0 25-29 35.9527 37.0 37.0 37.0 34.6 37.0 30-34 35.4311 37.0 37.0 37.0 31.8 37.0 35-39 33.8897 37.0 34.6 37.0 24.2 37.0 40-44 36.1298 37.0 37.0 37.0 37.0 37.0 45-49 35.7014 37.0 37.0 37.0 34.6 37.0 50-54 35.38459026462009 37.0 37.0 37.0 34.6 37.0 55-59 35.5980739965273 37.0 37.0 37.0 34.6 37.0 60-64 33.99277576352692 37.0 31.8 37.0 29.4 37.0 65-69 35.90462033926338 37.0 37.0 37.0 37.0 37.0 70-74 34.89700930534924 37.0 37.0 37.0 32.2 37.0 75-79 35.38056094970574 37.0 37.0 37.0 34.6 37.0 80-84 36.08933390444757 37.0 37.0 37.0 37.0 37.0 85-89 36.069285790702644 37.0 37.0 37.0 37.0 37.0 90-94 34.78812542591501 37.0 37.0 37.0 27.0 37.0 95-99 35.073619919167925 37.0 34.6 37.0 31.8 37.0 100-104 35.71829074961426 37.0 37.0 37.0 37.0 37.0 105-109 35.63436716704153 37.0 37.0 37.0 34.6 37.0 110-114 35.51606665868675 37.0 37.0 37.0 34.6 37.0 115-119 35.59554139741104 37.0 37.0 37.0 34.6 37.0 120-124 35.32816404719086 37.0 37.0 37.0 32.2 37.0 125-129 35.7230342346174 37.0 37.0 37.0 37.0 37.0 130-134 35.43230737572423 37.0 37.0 37.0 32.2 37.0 135-139 35.056257718491665 37.0 37.0 37.0 29.4 37.0 140-144 35.80910413949537 37.0 37.0 37.0 37.0 37.0 145-149 35.72512474425596 37.0 37.0 37.0 37.0 37.0 150 36.247933884297524 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 1.0 27 4.0 28 7.0 29 13.0 30 19.0 31 47.0 32 94.0 33 230.0 34 633.0 35 1484.0 36 1430.0 37 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.5 27.400000000000002 13.075000000000001 26.025 2 23.175 30.575000000000003 30.375000000000004 15.875 3 20.9 29.45 32.175 17.474999999999998 4 24.15 31.674999999999997 24.95 19.225 5 25.074999999999996 33.125 24.275 17.525 6 20.775 39.2 21.7 18.325 7 20.674999999999997 23.875 35.85 19.6 8 20.7 25.1 30.525000000000002 23.674999999999997 9 23.95 23.05 31.2 21.8 10-14 23.285 29.080000000000002 26.495 21.14 15-19 23.035 28.244999999999997 28.105000000000004 20.615 20-24 22.97 27.955000000000002 28.4 20.674999999999997 25-29 23.29 27.615000000000002 28.249999999999996 20.845 30-34 22.74 28.53 28.275 20.455000000000002 35-39 22.985 27.97 27.73 21.315 40-44 23.165 27.805000000000003 27.97 21.060000000000002 45-49 23.73 27.544999999999998 28.005000000000003 20.72 50-54 23.18281938325991 27.09251101321586 28.639367240688827 21.085302362835403 55-59 23.577521324636226 27.94279979929754 27.737079779227297 20.742599096838937 60-64 23.493884946398914 28.280235542805375 27.40449947153858 20.821380039257136 65-69 23.18533111077436 27.74662827701167 28.494216295398296 20.573824316815678 70-74 23.529710255239255 27.847972801542596 27.94438524382199 20.677931699396154 75-79 23.62987509559011 28.202905939332148 28.02447106806016 20.14274789701759 80-84 23.84201077199282 28.01744036932547 28.09438317517312 20.046165683508594 85-89 23.849566652909616 27.770326042096578 27.992158481221622 20.387948823772184 90-94 23.753788274636847 28.325843870832895 27.17107325739367 20.749294597136586 95-99 24.264045240737804 28.30188679245283 26.864330637915547 20.569737328893822 100-104 24.34410900347315 27.806572268234035 28.116484103660166 19.73283462463265 105-109 23.151750972762645 27.621054907047128 28.404669260700388 20.822524859489842 110-114 23.89239637661268 27.680483118309084 28.00988196541312 20.41723853966511 115-119 24.03604006939392 28.05417202977223 27.153170294924173 20.756617605909675 120-124 24.0773689950066 28.020432761292547 27.343167078000345 20.55903116570051 125-129 24.243677617584495 27.98392814937367 27.45804774285039 20.314346490191443 130-134 24.16971916971917 28.235653235653235 27.136752136752136 20.457875457875456 135-139 23.831805248182107 27.347454947834333 27.41068605754031 21.41005374644325 140-144 24.125157107891777 28.041278031355425 27.115168353509294 20.7183965072435 145-149 24.533725516411526 28.410990039441142 27.01383782338392 20.04144662076342 150 25.034435261707987 27.926997245179063 28.030303030303028 19.00826446280992 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 6.5 29 9.0 30 10.5 31 24.5 32 32.5 33 40.5 34 60.5 35 70.0 36 82.0 37 114.0 38 140.5 39 163.5 40 196.0 41 231.5 42 288.5 43 300.5 44 279.5 45 294.5 46 285.5 47 250.5 48 231.5 49 209.5 50 165.0 51 122.0 52 104.0 53 85.0 54 59.0 55 36.5 56 27.0 57 25.0 58 18.5 59 15.0 60 13.5 61 12.0 62 9.0 63 8.5 64 6.0 65 4.0 66 4.0 67 3.5 68 2.5 69 1.5 70 1.5 71 1.0 72 0.0 73 1.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 12.0 55-59 10.0 60-64 12.0 65-69 18.0 70-74 16.0 75-79 22.0 80-84 24.0 85-89 36.0 90-94 48.0 95-99 44.0 100-104 45.0 105-109 43.0 110-114 61.0 115-119 88.0 120-124 84.0 125-129 121.0 130-134 101.0 135-139 144.0 140-144 78.0 145-149 89.0 150-151 2904.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52356020942409 91.225 2 4.267015706806283 8.15 3 0.18324607329842932 0.525 4 0.026178010471204192 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437343 spots for SRR13347974.sra Written 1437343 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra Read 1437336 spots for SRR13347974.sra Written 1437336 spots for SRR13347974.sra SRR ids: ['SRR13347974.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8phzkgb SRR13347974.sra spots: 28746727 blocks: [[1, 1437336], [1437337, 2874672], [2874673, 4312008], [4312009, 5749344], [5749345, 7186680], [7186681, 8624016], [8624017, 10061352], [10061353, 11498688], [11498689, 12936024], [12936025, 14373360], [14373361, 15810696], [15810697, 17248032], [17248033, 18685368], [18685369, 20122704], [20122705, 21560040], [21560041, 22997376], [22997377, 24434712], [24434713, 25872048], [25872049, 27309384], [27309385, 28746727]] SRR13347974 file size 9226301 SRR13347974 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347974 SRR13347974_1.fastq SRR13347974_2.fastq Input file: SRR13347974_1.fastq Paired file: SRR13347974_2.fastq trimmed: SRR13347974-trimmed-pair1.fastq, SRR13347974-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:22:07 2025 >> started Wed Feb 12 01:22:37 2025 >> done (29.811s) 28746727 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 28746727 (100.00%) read pairs available; of these: 1439256 ( 5.01%) trimmed read pairs available after processing 27307471 (94.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 3 0.00% 47 2 0.00% 48 2 0.00% 49 9 0.00% 50 4620 0.02% 51 5221 0.02% 52 5876 0.02% 53 6154 0.02% 54 6344 0.02% 55 6491 0.02% 56 6970 0.02% 57 7615 0.03% 58 8706 0.03% 59 9605 0.03% 60 10876 0.04% 61 11895 0.04% 62 13075 0.05% 63 13959 0.05% 64 14716 0.05% 65 14918 0.05% 66 15159 0.05% 67 15757 0.05% 68 16615 0.06% 69 17686 0.06% 70 19640 0.07% 71 21145 0.07% 72 23199 0.08% 73 25081 0.09% 74 25995 0.09% 75 26766 0.09% 76 26945 0.09% 77 27065 0.09% 78 28035 0.10% 79 29253 0.10% 80 31543 0.11% 81 32981 0.11% 82 35448 0.12% 83 37620 0.13% 84 39529 0.14% 85 41601 0.14% 86 41194 0.14% 87 41972 0.15% 88 42506 0.15% 89 43070 0.15% 90 45544 0.16% 91 47478 0.17% 92 50586 0.18% 93 54030 0.19% 94 56441 0.20% 95 58709 0.20% 96 59499 0.21% 97 60183 0.21% 98 61021 0.21% 99 62922 0.22% 100 73654 0.26% 101 74515 0.26% 102 78802 0.27% 103 82286 0.29% 104 85709 0.30% 105 87924 0.31% 106 90646 0.32% 107 90934 0.32% 108 92252 0.32% 109 92394 0.32% 110 94642 0.33% 111 97443 0.34% 112 100637 0.35% 113 103672 0.36% 114 108220 0.38% 115 112037 0.39% 116 114753 0.40% 117 116803 0.41% 118 118003 0.41% 119 119832 0.42% 120 120924 0.42% 121 124108 0.43% 122 127318 0.44% 123 132313 0.46% 124 137889 0.48% 125 141207 0.49% 126 145935 0.51% 127 149772 0.52% 128 151387 0.53% 129 152666 0.53% 130 154993 0.54% 131 156461 0.54% 132 160182 0.56% 133 166252 0.58% 134 171112 0.60% 135 175914 0.61% 136 180247 0.63% 137 185310 0.64% 138 189377 0.66% 139 190512 0.66% 140 191904 0.67% 141 193241 0.67% 142 191198 0.67% 143 200456 0.70% 144 205628 0.72% 145 211868 0.74% 146 216423 0.75% 147 219755 0.76% 148 231308 0.80% 149 1142635 3.97% 150 19283997 67.08% 28746727 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=29 prefix-density=0.57 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=169.78 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.5 sequence=AAGAAAAAAGATACACACGGCCATACATAATACACGGACCTCAATTCACCAGATTTTCAAGGCAGCACATAATATTTATTATAAATCAAGTCGTCAGCTATGTTCTTAGCTTCTTACTTACTCCGCACGCTGTTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGACTAAATTCCATAGGGATATTAAATCCATCAACAAGGGATATATCATAAAAA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=26 prefix-density=0.82 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=134.17 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=22.0 sequence=GAAGAAGATCTC SRR13347974 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:23:22 Started mapping on | Feb 12 01:23:22 Finished on | Feb 12 01:26:51 Mapping speed, Million of reads per hour | 495.16 Number of input reads | 28746727 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 26953289 Uniquely mapped reads % | 93.76% Average mapped length | 282.24 Number of splices: Total | 25889882 Number of splices: Annotated (sjdb) | 25380655 Number of splices: GT/AG | 25485966 Number of splices: GC/AG | 333475 Number of splices: AT/AC | 21978 Number of splices: Non-canonical | 48463 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 804933 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 154226 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991619 991619 991619 N_multimapping 804933 804933 804933 N_noFeature 917484 26676366 1083011 N_ambiguous 218814 1942 106105 UnstrandedReadsAssigned:25816991 PositiveStrandReadsAssigned:274981 NegativeStrandReadsAssigned:25764173 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR13347974 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347974-trimmed-pair1.fastq SRR13347974-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,746,727 reads, 26,149,349 reads pseudoaligned [quant] estimated average fragment length: 169.509 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR13347974.ke.tsv 34699 SRR13347974.se.tsv 87100 total ==> SRR13347974.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1849.49 3268 72.2566 Potri.005G024800.1.v4.1 1035 866.491 535 25.2486 Potri.004G059700.1.v4.1 961 792.491 172 8.87528 Potri.007G009000.2.v4.1 1416 1247.49 0 0 Potri.003G141000.2.v4.1 2943 2774.49 1145.15 16.8783 Potri.016G087400.1.v4.1 270 104.362 1508 590.89 Potri.015G069301.1.v4.1 564 395.541 0 0 Potri.010G195200.1.v4.1 1773 1604.49 1097 27.9587 Potri.012G127500.1.v4.1 977 808.491 7020 355.067 ==> SRR13347974.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 486 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 814 SRR13347974 completed mapping pipeline successfully