Starting /dee2/code/volunteer_pipeline.sh SRR13347975 current disk space = 3051717517312 free memory = 1418291340 SRR13347975 SRAfilesize 1b36796e5fd6c30684882e0667f68ef7 SRR13347975.sra SRR13347975.sra file validated SRR13347975 is paired end SRR13347975 is conventional basespace SRR13347975 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347975_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4895 37.0 37.0 37.0 37.0 37.0 2 36.4515 37.0 37.0 37.0 37.0 37.0 3 36.5385 37.0 37.0 37.0 37.0 37.0 4 36.615 37.0 37.0 37.0 37.0 37.0 5 36.572 37.0 37.0 37.0 37.0 37.0 6 36.5515 37.0 37.0 37.0 37.0 37.0 7 36.576 37.0 37.0 37.0 37.0 37.0 8 36.247 37.0 37.0 37.0 37.0 37.0 9 36.4745 37.0 37.0 37.0 37.0 37.0 10-14 36.3728 37.0 37.0 37.0 37.0 37.0 15-19 36.4894 37.0 37.0 37.0 37.0 37.0 20-24 36.3977 37.0 37.0 37.0 37.0 37.0 25-29 36.3928 37.0 37.0 37.0 37.0 37.0 30-34 36.370999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.26030000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3339 37.0 37.0 37.0 37.0 37.0 45-49 36.0212 37.0 37.0 37.0 37.0 37.0 50-54 35.90374496303506 37.0 37.0 37.0 34.6 37.0 55-59 35.925002452634374 37.0 37.0 37.0 37.0 37.0 60-64 35.29463418356019 37.0 37.0 37.0 31.8 37.0 65-69 36.19328037730892 37.0 37.0 37.0 37.0 37.0 70-74 36.165441767912526 37.0 37.0 37.0 37.0 37.0 75-79 35.96799320941692 37.0 37.0 37.0 34.6 37.0 80-84 36.11687971252134 37.0 37.0 37.0 37.0 37.0 85-89 35.95490686775334 37.0 37.0 37.0 37.0 37.0 90-94 35.93833735312467 37.0 37.0 37.0 37.0 37.0 95-99 36.034125818730175 37.0 37.0 37.0 37.0 37.0 100-104 35.34656484663043 37.0 37.0 37.0 31.8 37.0 105-109 35.743607590369045 37.0 37.0 37.0 34.6 37.0 110-114 36.01695590964497 37.0 37.0 37.0 37.0 37.0 115-119 35.94034482144675 37.0 37.0 37.0 37.0 37.0 120-124 35.565452810419906 37.0 37.0 37.0 34.6 37.0 125-129 35.70694586746309 37.0 37.0 37.0 34.6 37.0 130-134 36.081731946060465 37.0 37.0 37.0 37.0 37.0 135-139 34.38981542903092 37.0 34.6 37.0 29.4 37.0 140-144 35.34144922934182 37.0 37.0 37.0 34.6 37.0 145-149 35.76185040260998 37.0 37.0 37.0 34.6 37.0 150 36.54148020654045 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 4.0 28 7.0 29 12.0 30 20.0 31 45.0 32 60.0 33 92.0 34 174.0 35 828.0 36 2673.0 37 84.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.925000000000004 11.425 13.475000000000001 38.175 2 23.75 9.025 31.924999999999997 35.3 3 22.95 10.674999999999999 23.625 42.75 4 26.200000000000003 15.425 22.75 35.625 5 26.6 20.525 26.875 26.0 6 24.25 27.950000000000003 25.1 22.7 7 16.7 26.325 38.0 18.975 8 16.75 26.400000000000002 34.125 22.725 9 16.775000000000002 24.875 35.449999999999996 22.900000000000002 10-14 19.009999999999998 29.995 28.665000000000003 22.33 15-19 20.18 27.51 28.235 24.075 20-24 20.294999999999998 28.17 28.325 23.21 25-29 20.02 28.025 28.050000000000004 23.905 30-34 20.22 27.655 28.225 23.9 35-39 20.674999999999997 27.26 28.485 23.580000000000002 40-44 20.345 28.48 28.22 22.955000000000002 45-49 20.59 28.355000000000004 27.155 23.9 50-54 20.277235650302757 27.818645848971624 27.478356603112648 24.425761897612972 55-59 20.7741352477534 28.480345398865403 27.677092223505195 23.068427129876 60-64 20.781768789616663 28.020927658718183 27.543012375490495 23.654291176174667 65-69 20.56862943137057 27.290172709827292 28.047671952328045 24.093525906474095 70-74 20.40971553166675 28.249074590538005 27.483393337051876 23.85781654074337 75-79 20.66208301502419 27.78202189966896 27.838044308632544 23.717850776674307 80-84 20.394063459570113 27.533265097236438 28.172978505629477 23.89969293756397 85-89 20.45888115493684 27.610208816705335 28.548594998711007 23.382315029646815 90-94 20.42630621263322 28.48453340265142 27.247205614764752 23.84195476995061 95-99 20.626151012891345 28.49250197316496 27.771639042357275 23.109707971586424 100-104 20.566017661453344 27.752952441749123 27.965741036280455 23.715288860517074 105-109 20.26685317695163 28.353150051110994 27.777478883090335 23.602517888847043 110-114 20.63631376851344 27.888096544157982 27.48217224355458 23.993417443774 115-119 20.864798344241205 27.711584717793812 27.98008614420764 23.443530793757343 120-124 20.55956885678248 28.13324160073386 27.405114092420597 23.902075450063066 125-129 20.45575614087008 27.95501627700503 27.925421722403076 23.663805859721812 130-134 20.972979596838428 27.412535996568838 28.631824030390295 22.98266037620244 135-139 20.974212034383953 27.628143903215534 28.69149952244508 22.706144539955428 140-144 20.556630848294734 28.04511780017353 28.011746646199025 23.38650470533271 145-149 21.065096765462172 28.298822574096633 27.446203816483962 23.189876843957233 150 23.407917383820998 27.469879518072286 26.78141135972461 22.340791738382098 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 4.0 27 5.0 28 6.0 29 12.0 30 15.5 31 22.0 32 33.5 33 37.0 34 44.5 35 62.5 36 80.5 37 97.5 38 110.5 39 145.0 40 188.5 41 208.0 42 237.5 43 266.5 44 274.0 45 273.5 46 271.0 47 262.5 48 257.5 49 220.5 50 167.0 51 146.5 52 131.0 53 110.0 54 83.5 55 53.5 56 45.5 57 41.0 58 31.0 59 25.5 60 16.0 61 13.5 62 13.0 63 9.5 64 4.5 65 4.0 66 5.0 67 2.5 68 2.0 69 4.5 70 3.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 13.0 55-59 7.0 60-64 12.0 65-69 20.0 70-74 13.0 75-79 19.0 80-84 24.0 85-89 33.0 90-94 32.0 95-99 55.0 100-104 32.0 105-109 68.0 110-114 62.0 115-119 90.0 120-124 99.0 125-129 111.0 130-134 109.0 135-139 148.0 140-144 97.0 145-149 51.0 150-151 2905.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.78017241379311 86.1 2 6.707974137931035 12.45 3 0.4849137931034483 1.35 4 0.02693965517241379 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAG 10 0.008455429 135.0125 6 TCAAAGC 10 0.008455429 135.0125 7 TTCTATT 10 0.008455429 135.0125 7 GCTCCTT 10 0.008455429 135.0125 1 CTTCTAT 10 0.008455429 135.0125 6 CAAGAAC 15 0.009111075 130.92122 140-144 >>END_MODULE SRR13347975 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347975_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7845 37.0 37.0 37.0 37.0 37.0 2 36.233 37.0 37.0 37.0 37.0 37.0 3 32.1415 37.0 37.0 37.0 11.0 37.0 4 36.256 37.0 37.0 37.0 37.0 37.0 5 36.243 37.0 37.0 37.0 37.0 37.0 6 36.2755 37.0 37.0 37.0 37.0 37.0 7 33.9345 37.0 37.0 37.0 25.0 37.0 8 36.3885 37.0 37.0 37.0 37.0 37.0 9 36.312 37.0 37.0 37.0 37.0 37.0 10-14 34.403 37.0 37.0 37.0 27.0 37.0 15-19 36.025999999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.939099999999996 37.0 37.0 37.0 34.6 37.0 25-29 36.0116 37.0 37.0 37.0 34.6 37.0 30-34 35.6209 37.0 37.0 37.0 34.6 37.0 35-39 34.308800000000005 37.0 34.6 37.0 24.2 37.0 40-44 36.1387 37.0 37.0 37.0 37.0 37.0 45-49 35.778800000000004 37.0 37.0 37.0 34.6 37.0 50-54 35.576494899490605 37.0 37.0 37.0 34.6 37.0 55-59 35.75510754932841 37.0 37.0 37.0 34.6 37.0 60-64 34.259563290321275 37.0 34.6 37.0 29.4 37.0 65-69 35.986163489671846 37.0 37.0 37.0 37.0 37.0 70-74 35.21069006269988 37.0 37.0 37.0 32.2 37.0 75-79 35.611257268603275 37.0 37.0 37.0 34.6 37.0 80-84 36.09121977730227 37.0 37.0 37.0 37.0 37.0 85-89 35.990580140164646 37.0 37.0 37.0 37.0 37.0 90-94 35.02850216829519 37.0 37.0 37.0 32.2 37.0 95-99 35.16703905913948 37.0 34.6 37.0 31.8 37.0 100-104 35.68596327205252 37.0 37.0 37.0 34.6 37.0 105-109 35.727043797317606 37.0 37.0 37.0 37.0 37.0 110-114 35.43237783444715 37.0 37.0 37.0 32.2 37.0 115-119 35.61105079748907 37.0 37.0 37.0 34.6 37.0 120-124 35.41322979402496 37.0 37.0 37.0 32.2 37.0 125-129 35.761867344626836 37.0 37.0 37.0 37.0 37.0 130-134 35.55091159852077 37.0 37.0 37.0 32.2 37.0 135-139 35.19652732704217 37.0 37.0 37.0 32.2 37.0 140-144 35.81700495546417 37.0 37.0 37.0 37.0 37.0 145-149 35.79661618988791 37.0 37.0 37.0 37.0 37.0 150 36.18162839248434 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 8.0 28 4.0 29 14.0 30 21.0 31 59.0 32 91.0 33 186.0 34 522.0 35 1352.0 36 1691.0 37 49.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.15 28.349999999999998 14.099999999999998 25.4 2 23.849999999999998 29.5 31.474999999999998 15.174999999999999 3 20.075000000000003 28.975 33.175 17.775 4 24.099999999999998 30.599999999999998 24.6 20.7 5 25.525 33.375 24.125 16.975 6 21.025 38.125 23.175 17.675 7 19.525000000000002 23.575 38.0 18.9 8 21.6 24.5 30.0 23.9 9 22.625 25.05 31.05 21.275 10-14 22.845 29.025000000000002 26.905 21.224999999999998 15-19 23.865 27.57 27.675 20.89 20-24 23.669999999999998 28.215 27.560000000000002 20.555 25-29 23.175 27.87 28.265 20.69 30-34 22.985 28.375 28.075 20.565 35-39 23.205000000000002 28.825 27.175 20.794999999999998 40-44 23.285 27.71 28.044999999999998 20.96 45-49 23.630000000000003 27.685 28.189999999999998 20.495 50-54 23.46729392923277 27.941544467243883 27.951553976277467 20.639607627245883 55-59 22.688485091858247 28.445939162734664 27.82853127196065 21.037044473446443 60-64 22.714444108456807 28.414474347344015 27.220038302590467 21.651043241608708 65-69 23.857482666126828 28.08340503061896 27.0155372235437 21.04357507971051 70-74 24.278161854412364 28.177104514030095 27.318015453436356 20.226718178121185 75-79 23.84332550301297 27.44357062608518 27.188234092533957 21.52486977836789 80-84 23.43397001437667 28.183405216676938 27.56212774697063 20.820497021975765 85-89 23.564376905980254 28.371323719439705 27.291052876414952 20.77324649816509 90-94 23.789144050104387 27.82359081419624 27.42171189979123 20.96555323590814 95-99 23.718422999682907 27.978015008984254 27.88288764401226 20.42067434732058 100-104 23.893190921228307 28.064085447263015 27.94125500667557 20.10146862483311 105-109 23.68477908609701 27.627741168845198 28.01123474127687 20.67624500378092 110-114 24.049796188167896 28.087473834967504 27.542139473394293 20.32059050347031 115-119 23.3105074090705 28.10395150426583 27.385496183206108 21.200044903457567 120-124 24.248001380341634 27.601081267613736 27.376775751998622 20.77414160004601 125-129 24.39980984074162 27.668172094128835 28.090087948657 19.841930116472543 130-134 23.8323795458741 28.336717740446744 27.192172789366808 20.63872992431235 135-139 24.40396292745286 27.9514221796101 27.542345797379355 20.102269095557688 140-144 24.53409925856656 28.401576381003274 26.9521074076548 20.112216952775366 145-149 23.770158558070197 28.87247594525003 27.11071960970321 20.246645886976555 150 25.922059846903274 27.45302713987474 26.20041753653445 20.424495476687543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.5 26 3.5 27 6.0 28 5.0 29 5.0 30 9.0 31 15.0 32 22.5 33 42.0 34 60.0 35 71.5 36 98.5 37 122.5 38 141.0 39 179.5 40 215.5 41 233.5 42 254.0 43 269.5 44 281.5 45 284.0 46 289.0 47 275.5 48 221.5 49 175.5 50 154.5 51 128.5 52 104.5 53 84.5 54 66.0 55 56.0 56 41.0 57 29.0 58 19.5 59 15.0 60 13.5 61 9.5 62 7.0 63 9.5 64 7.5 65 5.5 66 3.5 67 3.0 68 5.0 69 3.0 70 2.0 71 1.5 72 0.5 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 13.0 55-59 11.0 60-64 14.0 65-69 23.0 70-74 14.0 75-79 21.0 80-84 23.0 85-89 34.0 90-94 38.0 95-99 52.0 100-104 33.0 105-109 68.0 110-114 59.0 115-119 88.0 120-124 101.0 125-129 113.0 130-134 111.0 135-139 135.0 140-144 95.0 145-149 80.0 150-151 2874.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4664570230608 91.07499999999999 2 4.271488469601677 8.15 3 0.2358490566037736 0.675 4 0.026205450733752623 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCAG 10 0.0088188695 133.125 1 TTTCCTC 10 0.0088188695 133.125 5 TTTCTCT 10 0.0088188695 133.125 5 TTTTCTC 10 0.0088188695 133.125 4 CTCTTCA 10 0.0088188695 133.125 6 AACTCAA 10 0.0088188695 133.125 5 >>END_MODULE Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211535 spots for SRR13347975.sra Written 1211535 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra Read 1211518 spots for SRR13347975.sra Written 1211518 spots for SRR13347975.sra SRR ids: ['SRR13347975.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dz088vbu SRR13347975.sra spots: 24230377 blocks: [[1, 1211518], [1211519, 2423036], [2423037, 3634554], [3634555, 4846072], [4846073, 6057590], [6057591, 7269108], [7269109, 8480626], [8480627, 9692144], [9692145, 10903662], [10903663, 12115180], [12115181, 13326698], [13326699, 14538216], [14538217, 15749734], [15749735, 16961252], [16961253, 18172770], [18172771, 19384288], [19384289, 20595806], [20595807, 21807324], [21807325, 23018842], [23018843, 24230377]] SRR13347975 file size 7763363 SRR13347975 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347975 SRR13347975_1.fastq SRR13347975_2.fastq Input file: SRR13347975_1.fastq Paired file: SRR13347975_2.fastq trimmed: SRR13347975-trimmed-pair1.fastq, SRR13347975-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:08:22 2025 >> started Wed Feb 12 00:09:03 2025 >> done (40.939s) 24230377 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24230377 (100.00%) read pairs available; of these: 1310479 ( 5.41%) trimmed read pairs available after processing 22919898 (94.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 3 0.00% 49 7 0.00% 50 3647 0.02% 51 4130 0.02% 52 4587 0.02% 53 4797 0.02% 54 5125 0.02% 55 5143 0.02% 56 5675 0.02% 57 6115 0.03% 58 6987 0.03% 59 7685 0.03% 60 8702 0.04% 61 9684 0.04% 62 10773 0.04% 63 11421 0.05% 64 11704 0.05% 65 11993 0.05% 66 12303 0.05% 67 12716 0.05% 68 13506 0.06% 69 14268 0.06% 70 15924 0.07% 71 17152 0.07% 72 18747 0.08% 73 20488 0.08% 74 21069 0.09% 75 21716 0.09% 76 21947 0.09% 77 22201 0.09% 78 22929 0.09% 79 24074 0.10% 80 25527 0.11% 81 27337 0.11% 82 29183 0.12% 83 31325 0.13% 84 32759 0.14% 85 34366 0.14% 86 34380 0.14% 87 34925 0.14% 88 35359 0.15% 89 36427 0.15% 90 37949 0.16% 91 40139 0.17% 92 42514 0.18% 93 45206 0.19% 94 47824 0.20% 95 49727 0.21% 96 50501 0.21% 97 51173 0.21% 98 51740 0.21% 99 53109 0.22% 100 62248 0.26% 101 64151 0.26% 102 67745 0.28% 103 71145 0.29% 104 73591 0.30% 105 76335 0.32% 106 78573 0.32% 107 79379 0.33% 108 80008 0.33% 109 81409 0.34% 110 82365 0.34% 111 85193 0.35% 112 88501 0.37% 113 91791 0.38% 114 95402 0.39% 115 99015 0.41% 116 101981 0.42% 117 103509 0.43% 118 105343 0.43% 119 105806 0.44% 120 107508 0.44% 121 110665 0.46% 122 113884 0.47% 123 118497 0.49% 124 123626 0.51% 125 127162 0.52% 126 131809 0.54% 127 134936 0.56% 128 136563 0.56% 129 138670 0.57% 130 139780 0.58% 131 141085 0.58% 132 145144 0.60% 133 149404 0.62% 134 154610 0.64% 135 158835 0.66% 136 165173 0.68% 137 167887 0.69% 138 171544 0.71% 139 173297 0.72% 140 174650 0.72% 141 176326 0.73% 142 172674 0.71% 143 181657 0.75% 144 186324 0.77% 145 192756 0.80% 146 195784 0.81% 147 200790 0.83% 148 208260 0.86% 149 960517 3.96% 150 15908378 65.65% 24230377 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=29 prefix-density=0.58 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=16.67 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.5 sequence=GTGATGGTCTTGCCAGTGAG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=26 prefix-density=0.83 prefix-fanout=2.0 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=138.23 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=22.3 sequence=GAAGAAGATCTC SRR13347975 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:09:59 Started mapping on | Feb 12 00:10:00 Finished on | Feb 12 00:14:46 Mapping speed, Million of reads per hour | 305.00 Number of input reads | 24230377 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 22607803 Uniquely mapped reads % | 93.30% Average mapped length | 281.79 Number of splices: Total | 21676347 Number of splices: Annotated (sjdb) | 21247325 Number of splices: GT/AG | 21338540 Number of splices: GC/AG | 278403 Number of splices: AT/AC | 18470 Number of splices: Non-canonical | 40934 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 675916 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 170171 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 949294 949294 949294 N_multimapping 675916 675916 675916 N_noFeature 776008 22382212 908539 N_ambiguous 182592 1540 88515 UnstrandedReadsAssigned:21649203 PositiveStrandReadsAssigned:224051 NegativeStrandReadsAssigned:21610749 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR13347975 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347975-trimmed-pair1.fastq SRR13347975-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,230,377 reads, 21,966,331 reads pseudoaligned [quant] estimated average fragment length: 167.089 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52401 SRR13347975.ke.tsv 34699 SRR13347975.se.tsv 87100 total ==> SRR13347975.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.91 2618 68.8662 Potri.005G024800.1.v4.1 1035 868.911 425 23.8271 Potri.004G059700.1.v4.1 961 794.911 153 9.37626 Potri.007G009000.2.v4.1 1416 1249.91 0 0 Potri.003G141000.2.v4.1 2943 2776.91 1078.75 18.9241 Potri.016G087400.1.v4.1 270 106.344 1302.53 596.666 Potri.015G069301.1.v4.1 564 397.961 0 0 Potri.010G195200.1.v4.1 1773 1606.91 949.692 28.7904 Potri.012G127500.1.v4.1 977 810.911 6184 371.495 ==> SRR13347975.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 87 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 439 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 710 SRR13347975 completed mapping pipeline successfully