Starting /dee2/code/volunteer_pipeline.sh SRR13347977 current disk space = 3051649191936 free memory = 1447392776 SRR13347977 SRAfilesize 0567addf23d3309e08c7fc90fea327d0 SRR13347977.sra SRR13347977.sra file validated SRR13347977 is paired end SRR13347977 is conventional basespace SRR13347977 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347977_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.451 37.0 37.0 37.0 37.0 37.0 2 36.469 37.0 37.0 37.0 37.0 37.0 3 36.65 37.0 37.0 37.0 37.0 37.0 4 36.6425 37.0 37.0 37.0 37.0 37.0 5 36.61675 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.647 37.0 37.0 37.0 37.0 37.0 8 36.3415 37.0 37.0 37.0 37.0 37.0 9 36.673 37.0 37.0 37.0 37.0 37.0 10-14 36.4565 37.0 37.0 37.0 37.0 37.0 15-19 36.5545 37.0 37.0 37.0 37.0 37.0 20-24 36.46810000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4693 37.0 37.0 37.0 37.0 37.0 30-34 36.462300000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3574 37.0 37.0 37.0 37.0 37.0 40-44 36.429199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.12 37.0 37.0 37.0 37.0 37.0 50-54 36.05804560514778 37.0 37.0 37.0 34.6 37.0 55-59 36.08280331915298 37.0 37.0 37.0 37.0 37.0 60-64 35.55183809618476 37.0 37.0 37.0 34.6 37.0 65-69 36.25433297273467 37.0 37.0 37.0 37.0 37.0 70-74 36.3281021207915 37.0 37.0 37.0 37.0 37.0 75-79 36.1018453602082 37.0 37.0 37.0 37.0 37.0 80-84 36.23572968000385 37.0 37.0 37.0 37.0 37.0 85-89 36.074994724133674 37.0 37.0 37.0 37.0 37.0 90-94 36.0282200518823 37.0 37.0 37.0 37.0 37.0 95-99 36.17444839603557 37.0 37.0 37.0 37.0 37.0 100-104 35.558260000912576 37.0 37.0 37.0 31.8 37.0 105-109 35.97638456409786 37.0 37.0 37.0 34.6 37.0 110-114 36.16394023235093 37.0 37.0 37.0 37.0 37.0 115-119 36.05773600029424 37.0 37.0 37.0 37.0 37.0 120-124 35.68433126251758 37.0 37.0 37.0 34.6 37.0 125-129 35.901137557662764 37.0 37.0 37.0 34.6 37.0 130-134 36.12847736622888 37.0 37.0 37.0 37.0 37.0 135-139 34.822952576570124 37.0 34.6 37.0 29.4 37.0 140-144 35.59139555241266 37.0 37.0 37.0 34.6 37.0 145-149 35.84710566519546 37.0 37.0 37.0 37.0 37.0 150 36.45983379501385 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 2.0 29 12.0 30 16.0 31 35.0 32 57.0 33 92.0 34 139.0 35 650.0 36 2856.0 37 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.925 11.799999999999999 11.25 38.025 2 24.349999999999998 9.2 31.075000000000003 35.375 3 21.625 11.1 24.325 42.95 4 26.375 14.899999999999999 21.925 36.8 5 26.60665166291573 21.80545136284071 25.406351587896975 26.18154538634659 6 23.849999999999998 28.9 24.349999999999998 22.900000000000002 7 16.975 26.400000000000002 39.4 17.224999999999998 8 16.775000000000002 25.95 33.35 23.925 9 17.925 24.3 35.099999999999994 22.675 10-14 19.71 29.28 28.244999999999997 22.765 15-19 19.965 27.955000000000002 28.16 23.919999999999998 20-24 20.26 28.375 27.500000000000004 23.865 25-29 20.979999999999997 28.07 26.72 24.23 30-34 20.68 27.6 27.79 23.93 35-39 20.525 28.005000000000003 27.72 23.75 40-44 20.349999999999998 28.12 27.73 23.799999999999997 45-49 20.405 27.855 27.26 24.48 50-54 21.176647155935765 27.810295662614436 27.460103056681174 23.552954124768622 55-59 20.50125313283208 28.39097744360902 27.423558897243105 23.684210526315788 60-64 20.325611778302598 28.204612833525957 28.21466257976986 23.255112808401588 65-69 20.021191785660225 27.816741510671577 28.058933346788432 24.10313335687976 70-74 20.241293658437673 27.860292999442386 27.855223804937395 24.043189537182542 75-79 20.26640808410738 27.937123609268145 27.702357864652445 24.094110441972035 80-84 20.74735653423673 27.82055230469151 27.89754645313623 23.53454470793553 85-89 20.8779277183186 27.759681505609844 27.216793340571844 24.145597435499717 90-94 20.58378152576889 28.019424573129342 27.413712077698293 23.983081823403477 95-99 20.438110319345473 27.648456057007127 27.838479809976246 24.074953813671154 100-104 20.65961086166346 28.383579217447082 27.688689330767584 23.268120590121875 105-109 20.368458235965438 28.270202706374654 27.916961034726373 23.444378022933538 110-114 21.050592272777592 28.1855419019152 27.084025240783795 23.679840584523415 115-119 20.622986036519872 27.80824241053762 27.910000565323084 23.658770987619423 120-124 21.092388146426497 27.600232423009878 27.466589192330044 23.840790238233588 125-129 21.101629169899148 27.928626842513577 27.892820910664202 23.076923076923077 130-134 20.87830753099365 27.9960525504225 27.724665391969406 23.400974526614444 135-139 20.449596515947228 27.917253746637634 27.910849237863456 23.722300499551686 140-144 20.39160464024676 27.64031382015691 27.77442499832361 24.193656541272716 145-149 20.62296416938111 29.553474484256242 26.98154180238871 22.84201954397394 150 21.641274238227144 26.662049861495845 28.947368421052634 22.749307479224377 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.0 25 3.0 26 4.5 27 5.0 28 6.5 29 9.0 30 11.0 31 16.5 32 23.0 33 25.5 34 37.0 35 62.5 36 78.0 37 85.5 38 108.0 39 137.5 40 178.0 41 213.0 42 229.5 43 260.5 44 277.5 45 281.0 46 288.0 47 274.5 48 249.5 49 224.0 50 199.5 51 163.5 52 124.0 53 97.0 54 76.5 55 68.0 56 53.0 57 33.0 58 26.0 59 21.0 60 16.5 61 13.0 62 14.5 63 10.5 64 5.0 65 6.5 66 7.5 67 6.5 68 3.5 69 2.5 70 2.0 71 1.5 72 2.0 73 2.5 74 2.0 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 5.0 55-59 10.0 60-64 13.0 65-69 16.0 70-74 28.0 75-79 22.0 80-84 23.0 85-89 42.0 90-94 35.0 95-99 43.0 100-104 61.0 105-109 61.0 110-114 76.0 115-119 82.0 120-124 91.0 125-129 109.0 130-134 109.0 135-139 140.0 140-144 82.0 145-149 64.0 150-151 2888.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5796006475985 85.775 2 6.988667026443605 12.950000000000001 3 0.37776578521316784 1.05 4 0.026983270372369132 0.1 5 0.026983270372369132 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0044324454 19.919415 70-74 >>END_MODULE SRR13347977 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347977_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5145 37.0 37.0 37.0 37.0 37.0 2 35.997 37.0 37.0 37.0 37.0 37.0 3 31.9985 37.0 25.0 37.0 11.0 37.0 4 36.2 37.0 37.0 37.0 37.0 37.0 5 36.0555 37.0 37.0 37.0 37.0 37.0 6 36.16 37.0 37.0 37.0 37.0 37.0 7 34.0345 37.0 37.0 37.0 25.0 37.0 8 36.1805 37.0 37.0 37.0 37.0 37.0 9 36.133 37.0 37.0 37.0 37.0 37.0 10-14 34.489200000000004 37.0 37.0 37.0 27.0 37.0 15-19 35.9183 37.0 37.0 37.0 37.0 37.0 20-24 35.879999999999995 37.0 37.0 37.0 34.6 37.0 25-29 36.0112 37.0 37.0 37.0 34.6 37.0 30-34 35.6439 37.0 37.0 37.0 34.6 37.0 35-39 34.366200000000006 37.0 34.6 37.0 24.2 37.0 40-44 36.0514 37.0 37.0 37.0 37.0 37.0 45-49 35.5789 37.0 37.0 37.0 34.6 37.0 50-54 35.571760131491814 37.0 37.0 37.0 34.6 37.0 55-59 35.68603997634388 37.0 37.0 37.0 34.6 37.0 60-64 34.523922028207544 37.0 34.6 37.0 29.4 37.0 65-69 35.87668838902502 37.0 37.0 37.0 37.0 37.0 70-74 35.126766272952736 37.0 37.0 37.0 32.2 37.0 75-79 35.56055655878125 37.0 37.0 37.0 34.6 37.0 80-84 35.948096804584644 37.0 37.0 37.0 37.0 37.0 85-89 35.94681486439468 37.0 37.0 37.0 37.0 37.0 90-94 34.96038041023029 37.0 37.0 37.0 32.2 37.0 95-99 35.0893153240019 37.0 34.6 37.0 31.8 37.0 100-104 35.52399160505773 37.0 37.0 37.0 32.2 37.0 105-109 35.61767416518369 37.0 37.0 37.0 34.6 37.0 110-114 35.31158636238236 37.0 37.0 37.0 29.8 37.0 115-119 35.545729994891744 37.0 37.0 37.0 34.6 37.0 120-124 35.31311027873734 37.0 37.0 37.0 32.2 37.0 125-129 35.631883788394404 37.0 37.0 37.0 37.0 37.0 130-134 35.478410041941636 37.0 37.0 37.0 32.2 37.0 135-139 35.02052455682365 37.0 37.0 37.0 29.8 37.0 140-144 35.58644983163458 37.0 37.0 37.0 37.0 37.0 145-149 35.68364374765373 37.0 37.0 37.0 37.0 37.0 150 36.20706713780919 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 4.0 27 4.0 28 12.0 29 17.0 30 28.0 31 52.0 32 93.0 33 222.0 34 591.0 35 1333.0 36 1592.0 37 51.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.25 28.825 14.099999999999998 25.825 2 22.875 30.975 30.375000000000004 15.775 3 20.875 29.125 32.7 17.299999999999997 4 25.0 30.099999999999998 24.325 20.575 5 26.224999999999998 33.650000000000006 23.375 16.75 6 20.825 37.2 23.474999999999998 18.5 7 19.650000000000002 24.099999999999998 37.45 18.8 8 22.325 24.95 30.075000000000003 22.650000000000002 9 23.625 22.375 32.300000000000004 21.7 10-14 22.99 29.995 26.095000000000002 20.919999999999998 15-19 23.095 28.189999999999998 27.775 20.94 20-24 23.044999999999998 28.17 27.689999999999998 21.095 25-29 22.900000000000002 28.405 27.189999999999998 21.505 30-34 22.975 28.51 28.275 20.24 35-39 23.39 28.599999999999998 27.18 20.830000000000002 40-44 23.405 27.794999999999998 27.544999999999998 21.255 45-49 23.275000000000002 27.505000000000003 28.435 20.785 50-54 23.326663331665834 28.46423211605803 27.188594297148573 21.020510255127565 55-59 23.90857601122751 28.569996491403938 27.05127562528194 20.47015187208661 60-64 23.516970490482425 28.3261154194783 27.102427233356835 21.054486856682445 65-69 24.17632471278911 28.0783440457513 27.16736676957336 20.57796447188623 70-74 23.36486623944665 27.784559047909674 28.099888109042826 20.750686603600855 75-79 24.111116795416176 27.69222898654525 27.63083849184018 20.565815726198394 80-84 23.75952233889232 27.73831583281861 27.4603664813671 21.04179534692197 85-89 24.20801576191217 27.375952714263498 27.562606937315294 20.853424586509046 90-94 24.25148130669603 28.346704420324052 27.14592837292224 20.25588590005768 95-99 24.06887417218543 27.396026490066227 28.407947019867553 20.127152317880796 100-104 23.88139872159854 28.334318096363535 26.79271633453295 20.99156684750497 105-109 24.027959807776323 27.61031017911752 27.866972477064223 20.49475753604194 110-114 23.7901880075648 28.2790076760485 26.554677939704085 21.37612637668261 115-119 24.198863636363637 27.732954545454547 27.47159090909091 20.59659090909091 120-124 23.99953330999883 27.5988799439972 27.5988799439972 20.802706802006767 125-129 24.381625441696116 28.052943642570522 27.28633886326885 20.279092052464513 130-134 24.88690586850096 27.5515895147797 26.969077275825743 20.5924273408936 135-139 24.432439385169463 26.94063926940639 27.345810019936973 21.28111132548717 140-144 24.38186350468234 27.541602102000944 27.164319881425588 20.91221451189113 145-149 25.15320713604794 28.891461255617596 26.01116709791638 19.944164510418087 150 25.830388692579504 28.02120141342756 26.148409893992934 20.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 1.5 23 1.0 24 2.5 25 3.5 26 5.0 27 7.5 28 8.0 29 7.5 30 13.5 31 17.0 32 19.0 33 33.5 34 51.0 35 78.0 36 103.0 37 123.0 38 144.5 39 175.0 40 219.5 41 239.5 42 259.5 43 282.5 44 284.5 45 267.5 46 256.5 47 244.5 48 211.0 49 184.0 50 154.0 51 126.5 52 107.5 53 88.5 54 67.5 55 44.5 56 43.0 57 43.5 58 28.0 59 16.0 60 11.5 61 10.5 62 11.0 63 12.0 64 9.5 65 5.5 66 4.0 67 5.5 68 5.0 69 3.0 70 4.0 71 6.0 72 3.5 73 1.5 74 1.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 3.0 55-59 14.0 60-64 23.0 65-69 18.0 70-74 25.0 75-79 21.0 80-84 24.0 85-89 44.0 90-94 36.0 95-99 46.0 100-104 63.0 105-109 58.0 110-114 78.0 115-119 79.0 120-124 89.0 125-129 109.0 130-134 110.0 135-139 140.0 140-144 82.0 145-149 108.0 150-151 2830.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30307006035162 90.8 2 4.434531618997639 8.450000000000001 3 0.26239832065074786 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra Read 1035476 spots for SRR13347977.sra Written 1035476 spots for SRR13347977.sra Read 1035465 spots for SRR13347977.sra Written 1035465 spots for SRR13347977.sra SRR ids: ['SRR13347977.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ttgn0t_e SRR13347977.sra spots: 20709311 blocks: [[1, 1035465], [1035466, 2070930], [2070931, 3106395], [3106396, 4141860], [4141861, 5177325], [5177326, 6212790], [6212791, 7248255], [7248256, 8283720], [8283721, 9319185], [9319186, 10354650], [10354651, 11390115], [11390116, 12425580], [12425581, 13461045], [13461046, 14496510], [14496511, 15531975], [15531976, 16567440], [16567441, 17602905], [17602906, 18638370], [18638371, 19673835], [19673836, 20709311]] SRR13347977 file size 6627522 SRR13347977 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347977 SRR13347977_1.fastq SRR13347977_2.fastq Input file: SRR13347977_1.fastq Paired file: SRR13347977_2.fastq trimmed: SRR13347977-trimmed-pair1.fastq, SRR13347977-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:17:42 2025 >> started Wed Feb 12 00:18:04 2025 >> done (21.764s) 20709311 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 20709311 (100.00%) read pairs available; of these: 1117953 ( 5.40%) trimmed read pairs available after processing 19591358 (94.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 4 0.00% 49 4 0.00% 50 3422 0.02% 51 3898 0.02% 52 4252 0.02% 53 4538 0.02% 54 4739 0.02% 55 4850 0.02% 56 5248 0.03% 57 5763 0.03% 58 6339 0.03% 59 7248 0.03% 60 7987 0.04% 61 8796 0.04% 62 9758 0.05% 63 10461 0.05% 64 10885 0.05% 65 10926 0.05% 66 11051 0.05% 67 11676 0.06% 68 12204 0.06% 69 13079 0.06% 70 14175 0.07% 71 15526 0.07% 72 16799 0.08% 73 17868 0.09% 74 18641 0.09% 75 19541 0.09% 76 19572 0.09% 77 20078 0.10% 78 20346 0.10% 79 21440 0.10% 80 22680 0.11% 81 24188 0.12% 82 26176 0.13% 83 27424 0.13% 84 28537 0.14% 85 30072 0.15% 86 30590 0.15% 87 30816 0.15% 88 31134 0.15% 89 32117 0.16% 90 33306 0.16% 91 35474 0.17% 92 37169 0.18% 93 39748 0.19% 94 41864 0.20% 95 43356 0.21% 96 44906 0.22% 97 44837 0.22% 98 45321 0.22% 99 46336 0.22% 100 54587 0.26% 101 55882 0.27% 102 59164 0.29% 103 61850 0.30% 104 63776 0.31% 105 65961 0.32% 106 67629 0.33% 107 68400 0.33% 108 69258 0.33% 109 69910 0.34% 110 70678 0.34% 111 73313 0.35% 112 76054 0.37% 113 77926 0.38% 114 82527 0.40% 115 85396 0.41% 116 87610 0.42% 117 88733 0.43% 118 90717 0.44% 119 91210 0.44% 120 92753 0.45% 121 94750 0.46% 122 98082 0.47% 123 101751 0.49% 124 106265 0.51% 125 109255 0.53% 126 113157 0.55% 127 115731 0.56% 128 117330 0.57% 129 119204 0.58% 130 119848 0.58% 131 121614 0.59% 132 124867 0.60% 133 129867 0.63% 134 132725 0.64% 135 136961 0.66% 136 140547 0.68% 137 144196 0.70% 138 147155 0.71% 139 147946 0.71% 140 148693 0.72% 141 149867 0.72% 142 147752 0.71% 143 155402 0.75% 144 158968 0.77% 145 163363 0.79% 146 167157 0.81% 147 170286 0.82% 148 177956 0.86% 149 808613 3.90% 150 13549502 65.43% 20709311 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=97.97 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.3 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCTTGAGCGCTTTAGTGGCAGCATTATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTTCTTGGGTGCTTCATTTGGAGAGAACATGTTAATTGTCTCATACTCTACAGTCCCCAACAGGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=57.15 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.2 sequence=ATGAGAAGATGTTGGTGCCAGGTGATGTTGCTGTGCCGAAGGCTGTTGCCTTCACAGGAGTTTGGGAATGGAAGAAATTCCGATCGGAGGAAGGTAAACTGGTATTTGGAGATTTCAATTATCCAGAGAATGGAGAGAACCTGTTGGGGACTGTAGAGTATGAGACAATTAACATGTTCTCTCCAAATGAAGCACCCAAGAAAGTTTTCTGGCTTCCCATCACCACATCCTGGTATAATGCTGCCACTAAAGCGCTCAAGGATTTGAAGTTAAGACAATGCTATTCTGATGAATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGGGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTTCCTTAACGATAATTTTAATGCAACAACTGCCGATACAGCAAGTGCTTCTGTAGCTTTGACATCTTTGTCAAATGAAAAGCTCTTCGTGGTGTTCCAAGGTGTTTCAAATGTAGCTGGTAAAACAAGTTCAGA SRR13347977 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:19:21 Started mapping on | Feb 12 00:19:21 Finished on | Feb 12 00:21:26 Mapping speed, Million of reads per hour | 596.43 Number of input reads | 20709311 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 19261497 Uniquely mapped reads % | 93.01% Average mapped length | 281.63 Number of splices: Total | 18277827 Number of splices: Annotated (sjdb) | 17907060 Number of splices: GT/AG | 17991242 Number of splices: GC/AG | 234319 Number of splices: AT/AC | 16878 Number of splices: Non-canonical | 35388 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 541674 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 511322 % of reads mapped to too many loci | 2.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 908512 908512 908512 N_multimapping 541674 541674 541674 N_noFeature 700280 19056274 821234 N_ambiguous 163319 1468 77973 UnstrandedReadsAssigned:18397898 PositiveStrandReadsAssigned:203755 NegativeStrandReadsAssigned:18362290 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR13347977 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347977-trimmed-pair1.fastq SRR13347977-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,709,311 reads, 18,921,415 reads pseudoaligned [quant] estimated average fragment length: 167.103 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR13347977.ke.tsv 34699 SRR13347977.se.tsv 87100 total ==> SRR13347977.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.9 1731 51.9919 Potri.005G024800.1.v4.1 1035 868.897 351 22.4696 Potri.004G059700.1.v4.1 961 794.897 185 12.9454 Potri.007G009000.2.v4.1 1416 1249.9 0 0 Potri.003G141000.2.v4.1 2943 2776.9 781.45 15.653 Potri.016G087400.1.v4.1 270 106.45 1080 564.33 Potri.015G069301.1.v4.1 564 397.951 0 0 Potri.010G195200.1.v4.1 1773 1606.9 502.81 17.4049 Potri.012G127500.1.v4.1 977 810.897 5345 366.638 ==> SRR13347977.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 426 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 972 SRR13347977 completed mapping pipeline successfully