Starting /dee2/code/volunteer_pipeline.sh SRR13347978 current disk space = 3051376238592 free memory = 1469304160 SRR13347978 SRAfilesize 0a09888be5472313efabfcebb48b2a55 SRR13347978.sra SRR13347978.sra file validated SRR13347978 is paired end SRR13347978 is conventional basespace SRR13347978 read1 length is 51-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347978_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.537 37.0 37.0 37.0 37.0 37.0 2 36.515 37.0 37.0 37.0 37.0 37.0 3 36.5935 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.5605 37.0 37.0 37.0 37.0 37.0 6 36.5595 37.0 37.0 37.0 37.0 37.0 7 36.5625 37.0 37.0 37.0 37.0 37.0 8 36.422 37.0 37.0 37.0 37.0 37.0 9 36.5335 37.0 37.0 37.0 37.0 37.0 10-14 36.40239999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5261 37.0 37.0 37.0 37.0 37.0 20-24 36.375899999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.445299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4621 37.0 37.0 37.0 37.0 37.0 35-39 36.28179999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.313300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0771 37.0 37.0 37.0 37.0 37.0 50-54 35.9517558051572 37.0 37.0 37.0 34.6 37.0 55-59 35.913877889620586 37.0 37.0 37.0 37.0 37.0 60-64 35.33131375062472 37.0 37.0 37.0 34.6 37.0 65-69 36.153239837323554 37.0 37.0 37.0 37.0 37.0 70-74 36.20290321591396 37.0 37.0 37.0 37.0 37.0 75-79 35.97962343245537 37.0 37.0 37.0 34.6 37.0 80-84 36.15779063589153 37.0 37.0 37.0 37.0 37.0 85-89 36.0317854472313 37.0 37.0 37.0 37.0 37.0 90-94 36.00555494762449 37.0 37.0 37.0 37.0 37.0 95-99 36.10387204206379 37.0 37.0 37.0 37.0 37.0 100-104 35.37762922512064 37.0 37.0 37.0 31.8 37.0 105-109 35.8474144256679 37.0 37.0 37.0 34.6 37.0 110-114 36.02340669881454 37.0 37.0 37.0 37.0 37.0 115-119 35.936068149054464 37.0 37.0 37.0 37.0 37.0 120-124 35.491414211712765 37.0 37.0 37.0 34.6 37.0 125-129 35.723720473247425 37.0 37.0 37.0 34.6 37.0 130-134 35.99796160286799 37.0 37.0 37.0 37.0 37.0 135-139 34.38844226267385 37.0 34.6 37.0 29.4 37.0 140-144 35.415044733727825 37.0 37.0 37.0 34.6 37.0 145-149 35.771300297037314 37.0 37.0 37.0 37.0 37.0 150 36.4431934493347 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 5.0 29 7.0 30 17.0 31 36.0 32 66.0 33 80.0 34 196.0 35 814.0 36 2678.0 37 100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25 11.1 12.2 35.449999999999996 2 28.4 8.075000000000001 28.299999999999997 35.225 3 26.075 9.175 24.2 40.550000000000004 4 31.65 12.675 20.349999999999998 35.325 5 32.525 17.575 23.724999999999998 26.174999999999997 6 28.849999999999998 26.3 22.875 21.975 7 20.025000000000002 25.15 36.7 18.125 8 19.675 25.074999999999996 32.175 23.075000000000003 9 21.2 22.325 33.95 22.525000000000002 10-14 22.925 26.979999999999997 27.07 23.025000000000002 15-19 23.294999999999998 25.495 26.400000000000002 24.81 20-24 23.325000000000003 25.83 26.455000000000002 24.39 25-29 24.01 25.775 26.040000000000003 24.175 30-34 24.3 25.335 26.06 24.305 35-39 23.76 25.96 25.740000000000002 24.54 40-44 24.385 26.045 25.624999999999996 23.945 45-49 23.615 25.935000000000002 25.77 24.68 50-54 23.55824538588506 25.48391937178012 25.974090931826137 24.98374431050868 55-59 24.074723293434168 25.992888265638303 25.482045374868534 24.450343066058995 60-64 24.06486920720992 26.17864136165085 25.621328513330322 24.135160917808907 65-69 23.41625541343539 25.430556954376073 26.61899486353107 24.534192768657466 70-74 24.287014563106794 25.429813915857608 25.692758899676377 24.590412621359224 75-79 23.90209149661595 25.347310569436672 26.599155259274337 24.151442674673046 80-84 24.825748257482573 25.59450594505945 25.358753587535876 24.2209922099221 85-89 24.108667529107375 25.671410090556275 25.423027166882278 24.796895213454075 90-94 24.39661477379584 25.211576637759897 25.6869710584056 24.70483753003866 95-99 24.13974811614059 24.772092533066342 26.205406544764713 24.88275280602835 100-104 23.973736187476646 25.318955853306996 26.231783483691878 24.475524475524477 105-109 23.9803094233474 25.500378664935624 26.046738072054527 24.47257383966245 110-114 23.99076009239908 25.409745902540976 25.761742382576173 24.837751622483776 115-119 24.14839797639123 25.57054525014053 25.896571107363688 24.384485666104553 120-124 24.699522686755994 25.4816263154868 25.550635459198347 24.26821553855886 125-129 24.768573463090434 25.42131497745075 25.504391170187514 24.305720389271304 130-134 23.92484597084121 25.205880558775085 26.639419264320136 24.229854206063564 135-139 24.031057086488893 25.46299242665309 26.627633169986638 23.87831731687138 140-144 24.032397264821086 26.276306180707692 25.6389829383257 24.052313616145522 145-149 25.502994414911512 26.0615032635758 24.857008276697396 23.578494044815287 150 25.179119754350047 25.588536335721596 26.168543159331286 23.063800750597068 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 4.5 28 7.5 29 5.5 30 4.5 31 8.5 32 13.0 33 21.0 34 29.5 35 47.0 36 64.0 37 62.5 38 62.5 39 86.0 40 131.5 41 152.5 42 161.0 43 170.0 44 181.0 45 201.0 46 199.0 47 196.0 48 199.0 49 192.0 50 166.5 51 139.0 52 135.5 53 138.5 54 132.0 55 122.5 56 116.5 57 117.0 58 114.5 59 101.5 60 88.5 61 86.5 62 75.5 63 66.5 64 58.5 65 45.5 66 39.0 67 35.5 68 26.0 69 13.0 70 9.5 71 7.5 72 4.5 73 1.5 74 1.5 75 3.0 76 3.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 2.0 54-55 2.0 56-57 2.0 58-59 5.0 60-61 5.0 62-63 3.0 64-65 5.0 66-67 7.0 68-69 6.0 70-71 6.0 72-73 8.0 74-75 12.0 76-77 15.0 78-79 7.0 80-81 13.0 82-83 10.0 84-85 20.0 86-87 13.0 88-89 13.0 90-91 16.0 92-93 15.0 94-95 7.0 96-97 25.0 98-99 13.0 100-101 24.0 102-103 18.0 104-105 18.0 106-107 24.0 108-109 24.0 110-111 24.0 112-113 33.0 114-115 35.0 116-117 25.0 118-119 37.0 120-121 29.0 122-123 35.0 124-125 54.0 126-127 37.0 128-129 30.0 130-131 42.0 132-133 50.0 134-135 61.0 136-137 61.0 138-139 37.0 140-141 62.0 142-143 36.0 144-145 0.0 146-147 0.0 148-149 42.0 150-151 2931.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.21378187737385 84.975 2 7.080846446011938 13.05 3 0.6782419967444384 1.875 4 0.02712967986977754 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGGAA 10 0.0081650615 136.59999 6 TCCGGAG 10 0.0081650615 136.59999 2 ATCCGGA 10 0.0081650615 136.59999 1 >>END_MODULE SRR13347978 read2 length is 52-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347978_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.718 37.0 37.0 37.0 37.0 37.0 2 36.148 37.0 37.0 37.0 37.0 37.0 3 31.947 37.0 25.0 37.0 11.0 37.0 4 36.3205 37.0 37.0 37.0 37.0 37.0 5 36.3315 37.0 37.0 37.0 37.0 37.0 6 36.282 37.0 37.0 37.0 37.0 37.0 7 33.978 37.0 37.0 37.0 25.0 37.0 8 36.343 37.0 37.0 37.0 37.0 37.0 9 36.3225 37.0 37.0 37.0 37.0 37.0 10-14 34.57469999999999 37.0 37.0 37.0 27.0 37.0 15-19 36.0422 37.0 37.0 37.0 37.0 37.0 20-24 35.9958 37.0 37.0 37.0 34.6 37.0 25-29 36.0535 37.0 37.0 37.0 34.6 37.0 30-34 35.687799999999996 37.0 37.0 37.0 34.6 37.0 35-39 34.415200000000006 37.0 34.6 37.0 27.0 37.0 40-44 36.1931 37.0 37.0 37.0 37.0 37.0 45-49 35.8164 37.0 37.0 37.0 34.6 37.0 50-54 35.664420110055026 37.0 37.0 37.0 34.6 37.0 55-59 35.82324200174894 37.0 37.0 37.0 34.6 37.0 60-64 34.44131489676012 37.0 34.6 37.0 29.4 37.0 65-69 36.07740155197752 37.0 37.0 37.0 37.0 37.0 70-74 35.19868179439509 37.0 37.0 37.0 32.2 37.0 75-79 35.671863007087694 37.0 37.0 37.0 34.6 37.0 80-84 36.1357228361408 37.0 37.0 37.0 37.0 37.0 85-89 36.07210391922374 37.0 37.0 37.0 37.0 37.0 90-94 35.020190103603376 37.0 37.0 37.0 32.2 37.0 95-99 35.2739541459056 37.0 34.6 37.0 31.8 37.0 100-104 35.74601008788811 37.0 37.0 37.0 37.0 37.0 105-109 35.82698142971445 37.0 37.0 37.0 37.0 37.0 110-114 35.491588138421434 37.0 37.0 37.0 34.6 37.0 115-119 35.69311468823688 37.0 37.0 37.0 37.0 37.0 120-124 35.47848532253978 37.0 37.0 37.0 32.2 37.0 125-129 35.84891119391635 37.0 37.0 37.0 37.0 37.0 130-134 35.582176299860556 37.0 37.0 37.0 32.2 37.0 135-139 35.2651295257157 37.0 37.0 37.0 32.2 37.0 140-144 35.83849085382176 37.0 37.0 37.0 37.0 37.0 145-149 35.8255632344639 37.0 37.0 37.0 37.0 37.0 150 36.22755741127349 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 8.0 29 12.0 30 23.0 31 44.0 32 77.0 33 179.0 34 506.0 35 1350.0 36 1753.0 37 47.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.5 26.075 12.525 29.9 2 24.625 29.2 27.35 18.825 3 19.975 27.775 31.424999999999997 20.825 4 25.15 28.349999999999998 22.225 24.275 5 26.224999999999998 30.875000000000004 23.825 19.075 6 20.775 37.0 20.549999999999997 21.675 7 21.8 23.825 33.0 21.375 8 23.05 23.325000000000003 27.800000000000004 25.825 9 23.474999999999998 22.900000000000002 28.549999999999997 25.074999999999996 10-14 23.575 27.775 23.995 24.654999999999998 15-19 23.68 26.575 25.895000000000003 23.849999999999998 20-24 24.099999999999998 26.5 25.264999999999997 24.135 25-29 24.345 26.445 25.0 24.21 30-34 23.565 26.305 25.900000000000002 24.23 35-39 23.785 26.474999999999998 25.11 24.63 40-44 24.075 25.785000000000004 25.605 24.535 45-49 23.915 25.724999999999998 25.46 24.9 50-54 24.3498699739948 26.13522704540908 25.365073014602917 24.1498299659932 55-59 24.25973245152563 26.474272258129165 24.80084172553735 24.465153564807856 60-64 23.70563989142455 26.751784457625416 24.168090881672867 25.374484769277167 65-69 24.044377206253152 26.500252143217345 25.1386787695411 24.3166918809884 70-74 24.483701154079775 25.80988054261996 24.832962138084632 24.87345616521563 75-79 24.548883678254665 25.655010704455094 25.619329187480883 24.176776429809358 80-84 24.118100128369704 25.442875481386395 25.956354300385108 24.482670089858793 85-89 24.595435684647303 26.161825726141082 25.16597510373444 24.07676348547718 90-94 24.534828869437604 26.01813512238587 24.59248388280308 24.85455212537345 95-99 24.208684587243518 26.191612321722076 25.274375695880387 24.325327395154023 100-104 24.880459893622735 25.729328963627573 25.12759898995326 24.262612152796432 105-109 25.13476722025592 26.011434794445957 24.916961611761504 23.936836373536618 110-114 24.133156087293674 26.005317381189762 25.235404896421848 24.626121635094716 115-119 24.69170720669759 25.856997397895686 25.25738205679375 24.193913338612965 120-124 25.425002891176128 25.63894992482942 24.869897074129756 24.066150109864694 125-129 24.84512747200381 25.78627591136526 25.184655706456994 24.183940910173934 130-134 24.986207319315884 26.04058113161282 24.661313063201128 24.311898485870167 135-139 24.514190744055227 25.671183840450013 25.319611352595246 24.495014062899514 140-144 25.094930384384785 25.781093864499365 24.96169475717807 24.162280993937777 145-149 25.11477180664326 26.876856602754522 24.176343505266 23.832028085336212 150 26.20041753653445 26.513569937369518 24.460681976339597 22.825330549756437 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 1.5 26 2.0 27 3.5 28 3.0 29 6.5 30 10.0 31 11.5 32 17.5 33 24.0 34 31.5 35 42.5 36 59.0 37 77.0 38 94.5 39 115.0 40 140.5 41 161.5 42 173.0 43 189.0 44 200.0 45 194.5 46 197.0 47 206.0 48 188.0 49 168.0 50 163.0 51 139.0 52 113.0 53 114.5 54 123.0 55 126.0 56 120.5 57 113.0 58 106.0 59 91.5 60 75.5 61 72.5 62 81.0 63 70.5 64 54.5 65 40.5 66 30.0 67 28.0 68 21.0 69 14.5 70 9.0 71 6.5 72 6.5 73 5.0 74 4.0 75 2.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 2.0 54-55 4.0 56-57 4.0 58-59 5.0 60-61 6.0 62-63 5.0 64-65 5.0 66-67 6.0 68-69 6.0 70-71 4.0 72-73 10.0 74-75 13.0 76-77 16.0 78-79 8.0 80-81 12.0 82-83 10.0 84-85 21.0 86-87 15.0 88-89 11.0 90-91 20.0 92-93 19.0 94-95 14.0 96-97 24.0 98-99 14.0 100-101 26.0 102-103 18.0 104-105 17.0 106-107 24.0 108-109 24.0 110-111 25.0 112-113 35.0 114-115 30.0 116-117 24.0 118-119 35.0 120-121 29.0 122-123 32.0 124-125 50.0 126-127 38.0 128-129 30.0 130-131 45.0 132-133 51.0 134-135 55.0 136-137 67.0 138-139 33.0 140-141 59.0 142-143 35.0 144-145 0.0 146-147 2.0 148-149 88.0 150-151 2874.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.76744186046511 89.64999999999999 2 4.783298097251586 9.049999999999999 3 0.42283298097251587 1.2 4 0.026427061310782242 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACTT 10 0.008102838 136.95 3 >>END_MODULE Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186286 spots for SRR13347978.sra Written 1186286 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra Read 1186267 spots for SRR13347978.sra Written 1186267 spots for SRR13347978.sra SRR ids: ['SRR13347978.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xq442ojm SRR13347978.sra spots: 23725359 blocks: [[1, 1186267], [1186268, 2372534], [2372535, 3558801], [3558802, 4745068], [4745069, 5931335], [5931336, 7117602], [7117603, 8303869], [8303870, 9490136], [9490137, 10676403], [10676404, 11862670], [11862671, 13048937], [13048938, 14235204], [14235205, 15421471], [15421472, 16607738], [16607739, 17794005], [17794006, 18980272], [18980273, 20166539], [20166540, 21352806], [21352807, 22539073], [22539074, 23725359]] SRR13347978 file size 7596317 SRR13347978 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347978 SRR13347978_1.fastq SRR13347978_2.fastq Input file: SRR13347978_1.fastq Paired file: SRR13347978_2.fastq trimmed: SRR13347978-trimmed-pair1.fastq, SRR13347978-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:36:04 2025 >> started Wed Feb 12 00:36:31 2025 >> done (26.919s) 23725359 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 23725359 (100.00%) read pairs available; of these: 1169471 ( 4.93%) trimmed read pairs available after processing 22555888 (95.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 42 1 0.00% 43 1 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 1 0.00% 48 2 0.00% 49 3 0.00% 50 4733 0.02% 51 5416 0.02% 52 5792 0.02% 53 6316 0.03% 54 6448 0.03% 55 6612 0.03% 56 6990 0.03% 57 7689 0.03% 58 8440 0.04% 59 9529 0.04% 60 10582 0.04% 61 11723 0.05% 62 12873 0.05% 63 13845 0.06% 64 14459 0.06% 65 14953 0.06% 66 14646 0.06% 67 15298 0.06% 68 15830 0.07% 69 17007 0.07% 70 18577 0.08% 71 20019 0.08% 72 21674 0.09% 73 23370 0.10% 74 24357 0.10% 75 24876 0.10% 76 25116 0.11% 77 25129 0.11% 78 25351 0.11% 79 26575 0.11% 80 28308 0.12% 81 29819 0.13% 82 31917 0.13% 83 33773 0.14% 84 35356 0.15% 85 36869 0.16% 86 36897 0.16% 87 36532 0.15% 88 37358 0.16% 89 37744 0.16% 90 39398 0.17% 91 40936 0.17% 92 43478 0.18% 93 45972 0.19% 94 48363 0.20% 95 50173 0.21% 96 51081 0.22% 97 52114 0.22% 98 51143 0.22% 99 52104 0.22% 100 61263 0.26% 101 62269 0.26% 102 65584 0.28% 103 68143 0.29% 104 70333 0.30% 105 72815 0.31% 106 74825 0.32% 107 75748 0.32% 108 76176 0.32% 109 77218 0.33% 110 78346 0.33% 111 79995 0.34% 112 82087 0.35% 113 84356 0.36% 114 88864 0.37% 115 92541 0.39% 116 94368 0.40% 117 95108 0.40% 118 97177 0.41% 119 98247 0.41% 120 99442 0.42% 121 100963 0.43% 122 104549 0.44% 123 107557 0.45% 124 111626 0.47% 125 114454 0.48% 126 118223 0.50% 127 122162 0.51% 128 123407 0.52% 129 125022 0.53% 130 126868 0.53% 131 128792 0.54% 132 131138 0.55% 133 135355 0.57% 134 138421 0.58% 135 142426 0.60% 136 147207 0.62% 137 151600 0.64% 138 153314 0.65% 139 155709 0.66% 140 157376 0.66% 141 157146 0.66% 142 156440 0.66% 143 162030 0.68% 144 166737 0.70% 145 171190 0.72% 146 174598 0.74% 147 179584 0.76% 148 187590 0.79% 149 921379 3.88% 150 15894022 66.99% 23725359 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=37 prefix-density=0.38 prefix-fanout=2.3 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=67.48 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=15.7 sequence=CCTTGGCCTTCTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=36 prefix-density=0.54 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=41.34 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.2 sequence=CTTCACCATTAAACACTGCACTCAAAACTCTTGATACATCTTTATCTTCCTTTTTAAAGTATCCACCATGGGCTGGTTTGATAGCGACTCCGATCAGGCTCAGGCCTACGACCAGGTTGTGAACCGTCCCCACGAAGCCGAGTGGTCTCACGAACTTCTCGGAGGCGCTGCCGCCTTCGAGGCCGCCAAGGCGTACGAGAATCACGTCTCTCGGAACGGTCACCCCGACTCGCACGCCAAAGCAAAGGAGATTCTTGCAGGAGCCATAGGTGCCTTTGTGGACCGTGAGGTTGAGACTAGGGGCCTGGACTATGTCGATCGCGAGAAGGCAAAGCACCATGCTCAGCGACAGGCTGAGGAGC SRR13347978 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:37:49 Started mapping on | Feb 12 00:37:49 Finished on | Feb 12 00:54:10 Mapping speed, Million of reads per hour | 87.07 Number of input reads | 23725359 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 14645547 Uniquely mapped reads % | 61.73% Average mapped length | 281.07 Number of splices: Total | 13543509 Number of splices: Annotated (sjdb) | 13270446 Number of splices: GT/AG | 13326821 Number of splices: GC/AG | 173404 Number of splices: AT/AC | 12151 Number of splices: Non-canonical | 31133 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 544473 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 84657 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 35.34% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8536979 8536979 8536979 N_multimapping 544473 544473 544473 N_noFeature 506201 14485020 594524 N_ambiguous 131905 1084 58947 UnstrandedReadsAssigned:14007441 PositiveStrandReadsAssigned:159443 NegativeStrandReadsAssigned:13992076 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR13347978 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347978-trimmed-pair1.fastq SRR13347978-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,725,359 reads, 14,381,144 reads pseudoaligned [quant] estimated average fragment length: 168.232 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR13347978.ke.tsv 34699 SRR13347978.se.tsv 87100 total ==> SRR13347978.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1850.77 2209 80.8369 Potri.005G024800.1.v4.1 1035 867.768 1141 89.0529 Potri.004G059700.1.v4.1 961 793.768 151 12.884 Potri.007G009000.2.v4.1 1416 1248.77 0 0 Potri.003G141000.2.v4.1 2943 2775.77 478.884 11.6846 Potri.016G087400.1.v4.1 270 105.584 935 599.765 Potri.015G069301.1.v4.1 564 396.817 0 0 Potri.010G195200.1.v4.1 1773 1605.77 456 19.233 Potri.012G127500.1.v4.1 977 809.768 3208 268.312 ==> SRR13347978.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 898 SRR13347978 completed mapping pipeline successfully