Starting /dee2/code/volunteer_pipeline.sh SRR13347979 current disk space = 3051409403904 free memory = 895778816 SRR13347979 SRAfilesize 4c456b6c0562781af81ef8d605476072 SRR13347979.sra SRR13347979.sra file validated SRR13347979 is paired end SRR13347979 is conventional basespace SRR13347979 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347979_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.424 37.0 37.0 37.0 37.0 37.0 2 36.4835 37.0 37.0 37.0 37.0 37.0 3 36.5845 37.0 37.0 37.0 37.0 37.0 4 36.5555 37.0 37.0 37.0 37.0 37.0 5 36.5065 37.0 37.0 37.0 37.0 37.0 6 36.48 37.0 37.0 37.0 37.0 37.0 7 36.595 37.0 37.0 37.0 37.0 37.0 8 36.247 37.0 37.0 37.0 37.0 37.0 9 36.5205 37.0 37.0 37.0 37.0 37.0 10-14 36.3928 37.0 37.0 37.0 37.0 37.0 15-19 36.50320000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4105 37.0 37.0 37.0 37.0 37.0 25-29 36.4317 37.0 37.0 37.0 37.0 37.0 30-34 36.412800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2308 37.0 37.0 37.0 37.0 37.0 40-44 36.323299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0141 37.0 37.0 37.0 37.0 37.0 50-54 35.88366077976441 37.0 37.0 37.0 34.6 37.0 55-59 35.90122095759215 37.0 37.0 37.0 34.6 37.0 60-64 35.145620281892526 37.0 37.0 37.0 31.8 37.0 65-69 36.14649399875849 37.0 37.0 37.0 37.0 37.0 70-74 36.15077290357722 37.0 37.0 37.0 37.0 37.0 75-79 35.91815136348711 37.0 37.0 37.0 34.6 37.0 80-84 36.10852465971194 37.0 37.0 37.0 37.0 37.0 85-89 35.96107336924494 37.0 37.0 37.0 37.0 37.0 90-94 35.88497832328722 37.0 37.0 37.0 34.6 37.0 95-99 36.078669243711204 37.0 37.0 37.0 37.0 37.0 100-104 35.338065919623254 37.0 37.0 37.0 31.8 37.0 105-109 35.78579910764921 37.0 37.0 37.0 34.6 37.0 110-114 35.95731462023832 37.0 37.0 37.0 37.0 37.0 115-119 35.941441890328555 37.0 37.0 37.0 37.0 37.0 120-124 35.4925920427773 37.0 37.0 37.0 34.6 37.0 125-129 35.684499753907566 37.0 37.0 37.0 34.6 37.0 130-134 35.97838833197168 37.0 37.0 37.0 37.0 37.0 135-139 34.316056528378496 37.0 34.6 37.0 29.4 37.0 140-144 35.2974310844705 37.0 37.0 37.0 31.8 37.0 145-149 35.686786626315715 37.0 37.0 37.0 34.6 37.0 150 36.44504021447721 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 1.0 28 6.0 29 16.0 30 25.0 31 37.0 32 52.0 33 104.0 34 210.0 35 824.0 36 2654.0 37 70.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.45 11.3 11.200000000000001 34.050000000000004 2 28.999999999999996 7.35 27.875 35.775 3 24.85 9.775 23.875 41.5 4 31.474999999999998 12.2 22.0 34.325 5 32.775 16.975 24.775 25.474999999999998 6 29.349999999999998 24.125 23.45 23.075000000000003 7 19.8 25.35 36.025 18.825 8 21.85 24.125 31.15 22.875 9 21.349999999999998 24.775 31.874999999999996 22.0 10-14 22.975 27.315 26.705000000000002 23.005 15-19 24.044999999999998 25.41 25.985000000000003 24.560000000000002 20-24 23.86 25.629999999999995 25.974999999999998 24.535 25-29 23.93 25.729999999999997 25.555 24.785 30-34 24.12 25.740000000000002 25.97 24.169999999999998 35-39 24.735 25.21 25.395 24.66 40-44 23.73 25.7 26.029999999999998 24.54 45-49 24.51 25.979999999999997 25.115 24.395 50-54 24.482241120560282 25.407703851925962 26.348174087043525 23.761880940470235 55-59 23.441571457205853 25.952094608137905 26.24774503908599 24.358588895570254 60-64 24.001607474757623 25.804993218465867 26.242025418194604 23.951373888581905 65-69 24.015926616601984 25.34650471246409 26.37971876417519 24.257849906758732 70-74 24.292071197411 24.812904530744337 26.218648867313917 24.676375404530745 75-79 23.794751830756713 25.59499593165175 25.86960943856794 24.740642799023597 80-84 24.40961016341376 25.644178064648326 25.613441934327135 24.33276983761078 85-89 24.405468145473304 25.0657725045138 25.994325509414494 24.534433840598403 90-94 24.543895212848902 25.448308124122875 26.030458963563596 23.97733769946463 95-99 24.6188623698875 25.954158342971294 25.27073914414888 24.156240142992324 100-104 24.5580404685836 25.4419595314164 25.89456869009585 24.105431309904155 105-109 24.760978771673958 25.852103926970237 25.090476962134716 24.296440339221085 110-114 23.97763403135621 24.975331652231112 26.356759127288676 24.690275189124 115-119 24.747051260551174 25.540835150092235 25.725306053999663 23.986807535356924 120-124 24.574042309891368 25.56889651229274 25.683247570040024 24.17381360777587 125-129 24.44783834586466 25.499295112781954 26.174812030075188 23.878054511278197 130-134 24.423600605143722 25.68835098335855 25.95461422087746 23.93343419062027 135-139 24.304209143786355 25.35493151541685 26.33060228907374 24.01025705172306 140-144 24.51873048907388 25.982049947970864 25.93652445369407 23.562695109261185 145-149 24.976915974145893 25.77496372510223 25.62326869806094 23.62485160269094 150 25.770777479892757 24.798927613941018 26.005361930294907 23.42493297587131 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 2.0 28 2.5 29 4.0 30 10.5 31 15.0 32 15.0 33 24.5 34 36.5 35 44.0 36 61.0 37 69.0 38 77.0 39 96.0 40 119.0 41 133.0 42 156.0 43 179.0 44 194.0 45 195.5 46 184.5 47 201.0 48 196.0 49 182.0 50 173.5 51 144.0 52 122.0 53 117.0 54 126.0 55 127.0 56 105.0 57 96.0 58 101.5 59 104.0 60 103.5 61 97.0 62 88.0 63 81.5 64 73.0 65 58.0 66 46.0 67 35.0 68 23.5 69 18.0 70 10.0 71 4.5 72 5.5 73 4.0 74 1.5 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 4.0 55-59 10.0 60-64 10.0 65-69 14.0 70-74 19.0 75-79 29.0 80-84 29.0 85-89 23.0 90-94 42.0 95-99 42.0 100-104 54.0 105-109 51.0 110-114 64.0 115-119 77.0 120-124 90.0 125-129 95.0 130-134 100.0 135-139 117.0 140-144 96.0 145-149 50.0 150-151 2984.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1367292225201 86.85000000000001 2 6.48793565683646 12.1 3 0.37533512064343166 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACAG 10 0.008397194 135.32501 1 >>END_MODULE SRR13347979 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347979_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.656 37.0 37.0 37.0 37.0 37.0 2 36.129 37.0 37.0 37.0 37.0 37.0 3 31.6345 37.0 25.0 37.0 11.0 37.0 4 36.219 37.0 37.0 37.0 37.0 37.0 5 36.1615 37.0 37.0 37.0 37.0 37.0 6 36.288 37.0 37.0 37.0 37.0 37.0 7 33.9755 37.0 37.0 37.0 25.0 37.0 8 36.441 37.0 37.0 37.0 37.0 37.0 9 36.258 37.0 37.0 37.0 37.0 37.0 10-14 34.4394 37.0 37.0 37.0 27.0 37.0 15-19 36.0444 37.0 37.0 37.0 37.0 37.0 20-24 36.0154 37.0 37.0 37.0 34.6 37.0 25-29 36.0517 37.0 37.0 37.0 34.6 37.0 30-34 35.6213 37.0 37.0 37.0 31.8 37.0 35-39 34.2786 37.0 34.6 37.0 24.2 37.0 40-44 36.1284 37.0 37.0 37.0 37.0 37.0 45-49 35.8143 37.0 37.0 37.0 34.6 37.0 50-54 35.55438161759139 37.0 37.0 37.0 34.6 37.0 55-59 35.81053734970921 37.0 37.0 37.0 34.6 37.0 60-64 34.30979101755993 37.0 34.6 37.0 29.4 37.0 65-69 36.07454822386849 37.0 37.0 37.0 37.0 37.0 70-74 35.228200849275815 37.0 37.0 37.0 32.2 37.0 75-79 35.570897076283266 37.0 37.0 37.0 34.6 37.0 80-84 36.13042699090139 37.0 37.0 37.0 37.0 37.0 85-89 36.049953823694786 37.0 37.0 37.0 37.0 37.0 90-94 34.99116220296101 37.0 37.0 37.0 29.4 37.0 95-99 35.18673525160704 37.0 34.6 37.0 31.8 37.0 100-104 35.765392037287434 37.0 37.0 37.0 37.0 37.0 105-109 35.81746388627555 37.0 37.0 37.0 37.0 37.0 110-114 35.50887229165981 37.0 37.0 37.0 34.6 37.0 115-119 35.66949979902416 37.0 37.0 37.0 37.0 37.0 120-124 35.50512205910715 37.0 37.0 37.0 32.2 37.0 125-129 35.8438284154846 37.0 37.0 37.0 37.0 37.0 130-134 35.55008153145986 37.0 37.0 37.0 32.2 37.0 135-139 35.222638140451735 37.0 37.0 37.0 32.2 37.0 140-144 35.90327626194532 37.0 37.0 37.0 37.0 37.0 145-149 35.836421487699624 37.0 37.0 37.0 37.0 37.0 150 36.25075936550793 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 0.0 28 2.0 29 14.0 30 24.0 31 44.0 32 72.0 33 204.0 34 538.0 35 1350.0 36 1700.0 37 51.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.8 24.6 13.575000000000001 30.025000000000002 2 23.925 28.749999999999996 27.500000000000004 19.825 3 20.599999999999998 28.425 30.575000000000003 20.4 4 23.525 29.225 22.95 24.3 5 25.3 32.375 23.025000000000002 19.3 6 21.2 36.4 20.775 21.625 7 21.775 22.475 33.0 22.75 8 21.575 23.7 28.349999999999998 26.375 9 22.85 21.375 29.625 26.150000000000002 10-14 23.599999999999998 27.49 24.03 24.88 15-19 23.56 25.86 25.665 24.915000000000003 20-24 23.595 27.005000000000003 25.405 23.995 25-29 23.89 26.31 25.345000000000002 24.455 30-34 23.375 26.69 25.765 24.169999999999998 35-39 23.53 26.505000000000003 25.255 24.709999999999997 40-44 23.39 25.779999999999998 26.229999999999997 24.6 45-49 24.3 25.61 25.679999999999996 24.41 50-54 24.15207603801901 26.048024012006003 25.522761380690344 24.27713856928464 55-59 23.817161186848438 26.348235765838012 25.195469125902164 24.63913392141139 60-64 24.022093899071052 26.442380115490838 24.42380115490836 25.111724830529752 65-69 24.308947182921305 25.92014500780424 25.336085796284173 24.43482201299028 70-74 24.320775679224322 25.89132410867589 25.113624886375113 24.674275325724672 75-79 24.291950055831897 25.95168003248401 25.428890467972792 24.327479443711297 80-84 24.474988503397885 25.6195391139952 25.532675898012364 24.372796484594552 85-89 24.8970557957587 25.679431747992588 25.44780728844966 23.975705167799052 90-94 24.280369947001976 26.431466278707266 25.241608645952407 24.04655512833836 95-99 24.39191323575866 25.908181531009795 25.365905022638728 24.33400021059282 100-104 24.806697595051457 26.10249026822375 24.838692475870527 24.252119660854262 105-109 24.82956390001082 25.79807380153663 24.748403852396926 24.62395844605562 110-114 24.585574706334395 26.078603578878035 25.293665605445163 24.042156109342407 115-119 25.162301320796953 25.92343854936199 24.445936870382805 24.46832325945825 120-124 24.759670405127032 25.898374914168006 24.937056534676127 24.404898146028838 125-129 24.036427732079908 25.71092831962397 24.91774383078731 25.334900117508813 130-134 24.91527475187606 25.587024933430165 24.546114742193172 24.951585572500605 135-139 24.438606367673735 26.0524175892913 25.10164508663289 24.407330956402078 140-144 24.31816702466966 26.322983792228083 24.519950530495347 24.838898652606915 145-149 25.15673464000528 26.78017554279681 24.08104005807431 23.982049759123605 150 25.514681066486666 26.4934188322646 23.3209584880189 24.670941613229836 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 3.5 27 4.5 28 5.5 29 8.5 30 10.0 31 9.5 32 16.0 33 23.5 34 33.5 35 47.5 36 57.5 37 80.5 38 107.0 39 116.0 40 132.5 41 156.5 42 196.0 43 217.0 44 217.5 45 220.5 46 187.5 47 176.5 48 176.5 49 161.5 50 160.5 51 139.5 52 114.0 53 100.5 54 91.5 55 93.0 56 103.5 57 110.5 58 113.5 59 105.5 60 90.0 61 91.5 62 83.5 63 68.0 64 60.5 65 49.5 66 34.5 67 22.5 68 15.5 69 14.0 70 12.0 71 8.0 72 5.5 73 3.0 74 3.5 75 2.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 5.0 55-59 10.0 60-64 6.0 65-69 13.0 70-74 16.0 75-79 28.0 80-84 27.0 85-89 26.0 90-94 52.0 95-99 46.0 100-104 52.0 105-109 51.0 110-114 62.0 115-119 77.0 120-124 90.0 125-129 92.0 130-134 100.0 135-139 121.0 140-144 95.0 145-149 68.0 150-151 2963.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.49384333246005 91.125 2 4.217972229499607 8.05 3 0.2881844380403458 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAGT 10 0.008796631 133.2375 8 GCTCAAC 10 0.008796631 133.2375 9 >>END_MODULE Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra Read 1307212 spots for SRR13347979.sra Written 1307212 spots for SRR13347979.sra SRR ids: ['SRR13347979.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tqfw6nch SRR13347979.sra spots: 26144240 blocks: [[1, 1307212], [1307213, 2614424], [2614425, 3921636], [3921637, 5228848], [5228849, 6536060], [6536061, 7843272], [7843273, 9150484], [9150485, 10457696], [10457697, 11764908], [11764909, 13072120], [13072121, 14379332], [14379333, 15686544], [15686545, 16993756], [16993757, 18300968], [18300969, 19608180], [19608181, 20915392], [20915393, 22222604], [22222605, 23529816], [23529817, 24837028], [24837029, 26144240]] SRR13347979 file size 8372801 SRR13347979 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347979 SRR13347979_1.fastq SRR13347979_2.fastq Input file: SRR13347979_1.fastq Paired file: SRR13347979_2.fastq trimmed: SRR13347979-trimmed-pair1.fastq, SRR13347979-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:29:44 2025 >> started Wed Feb 12 00:30:12 2025 >> done (27.907s) 26144240 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 26144240 (100.00%) read pairs available; of these: 1326384 ( 5.07%) trimmed read pairs available after processing 24817856 (94.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 1 0.00% 49 6 0.00% 50 5252 0.02% 51 6102 0.02% 52 6636 0.03% 53 6832 0.03% 54 7359 0.03% 55 7294 0.03% 56 7848 0.03% 57 8506 0.03% 58 9387 0.04% 59 10531 0.04% 60 11707 0.04% 61 13298 0.05% 62 14307 0.05% 63 15268 0.06% 64 16249 0.06% 65 16072 0.06% 66 16274 0.06% 67 16644 0.06% 68 17175 0.07% 69 18249 0.07% 70 20110 0.08% 71 21765 0.08% 72 23145 0.09% 73 25622 0.10% 74 26152 0.10% 75 27016 0.10% 76 27087 0.10% 77 27002 0.10% 78 27815 0.11% 79 28580 0.11% 80 30025 0.11% 81 31750 0.12% 82 34464 0.13% 83 36466 0.14% 84 37988 0.15% 85 39322 0.15% 86 39885 0.15% 87 39827 0.15% 88 40102 0.15% 89 41286 0.16% 90 42854 0.16% 91 44235 0.17% 92 47336 0.18% 93 49635 0.19% 94 52606 0.20% 95 54179 0.21% 96 55656 0.21% 97 56325 0.22% 98 56412 0.22% 99 57340 0.22% 100 67312 0.26% 101 68307 0.26% 102 70961 0.27% 103 75024 0.29% 104 77208 0.30% 105 80200 0.31% 106 82071 0.31% 107 83190 0.32% 108 83233 0.32% 109 84486 0.32% 110 85635 0.33% 111 88724 0.34% 112 91051 0.35% 113 94426 0.36% 114 97833 0.37% 115 102312 0.39% 116 104563 0.40% 117 106520 0.41% 118 109044 0.42% 119 109492 0.42% 120 110410 0.42% 121 113057 0.43% 122 116029 0.44% 123 120835 0.46% 124 125914 0.48% 125 129096 0.49% 126 134063 0.51% 127 136681 0.52% 128 138708 0.53% 129 141094 0.54% 130 142461 0.54% 131 143819 0.55% 132 146996 0.56% 133 152057 0.58% 134 156247 0.60% 135 160829 0.62% 136 165917 0.63% 137 169793 0.65% 138 173534 0.66% 139 175268 0.67% 140 177627 0.68% 141 179088 0.68% 142 176292 0.67% 143 184902 0.71% 144 187924 0.72% 145 194153 0.74% 146 196899 0.75% 147 202560 0.77% 148 211574 0.81% 149 999300 3.82% 150 17446536 66.73% 26144240 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=37 prefix-density=0.38 prefix-fanout=2.3 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=67.91 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=15.8 sequence=CCTTGGCCTTCTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=32 prefix-density=0.55 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=44.73 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.2 sequence=CTTCACCATTAAACACTGCACTCAAAACTCTTGATACATCTTTATCTTCCTTTTTAAAGTATCCACCATGGGCTGGTTTGATAGCGACTCCGATCAGGCTCAGGCCTACGACCAGGTTGTGAACCGTCCCCACGAAGCCGAGTGGTCTCACGAACTTCTCGGAGGCGCTGCCGCCTTCGAGGCCGCCAAGGCGTACGAGAATCACGTCTCTCGGAACGGTCACCCCGACTCGCACGCCAAAGCAAAGGAGATTCTTGCAGGAGCCATAGGTGCCTTTGTGGACCGTGAGGTTGAGACTAGGGGCCTGGACTATGTCGATCGCGAGAAGGCAAAGCACCATGCTCAGCGACAGGCTGAGGAGCAGCTTGCCCAGGAAGGCCGTTGG SRR13347979 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:31:28 Started mapping on | Feb 12 00:31:28 Finished on | Feb 12 00:48:26 Mapping speed, Million of reads per hour | 92.46 Number of input reads | 26144240 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 16038695 Uniquely mapped reads % | 61.35% Average mapped length | 281.02 Number of splices: Total | 14854749 Number of splices: Annotated (sjdb) | 14553626 Number of splices: GT/AG | 14617438 Number of splices: GC/AG | 190293 Number of splices: AT/AC | 13126 Number of splices: Non-canonical | 33892 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 602700 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 102147 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 35.66% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9504727 9504727 9504727 N_multimapping 602700 602700 602700 N_noFeature 547766 15862504 645518 N_ambiguous 143329 1143 64060 UnstrandedReadsAssigned:15347600 PositiveStrandReadsAssigned:175048 NegativeStrandReadsAssigned:15329117 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR13347979 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347979-trimmed-pair1.fastq SRR13347979-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,144,240 reads, 15,769,871 reads pseudoaligned [quant] estimated average fragment length: 167.082 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR13347979.ke.tsv 34699 SRR13347979.se.tsv 87100 total ==> SRR13347979.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.92 2356 78.9032 Potri.005G024800.1.v4.1 1035 868.918 1147 81.8702 Potri.004G059700.1.v4.1 961 794.924 202 15.7604 Potri.007G009000.2.v4.1 1416 1249.92 0 0 Potri.003G141000.2.v4.1 2943 2776.92 521.211 11.641 Potri.016G087400.1.v4.1 270 106.409 1018 593.347 Potri.015G069301.1.v4.1 564 397.982 0 0 Potri.010G195200.1.v4.1 1773 1606.92 517 19.9544 Potri.012G127500.1.v4.1 977 810.918 3539 270.673 ==> SRR13347979.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1046 SRR13347979 completed mapping pipeline successfully