Starting /dee2/code/volunteer_pipeline.sh SRR13347980 current disk space = 3051400794112 free memory = 1421463860 SRR13347980 SRAfilesize 08ddaf2d58098541349ac016d7513f60 SRR13347980.sra SRR13347980.sra file validated SRR13347980 is paired end SRR13347980 is conventional basespace SRR13347980 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.496 37.0 37.0 37.0 37.0 37.0 2 36.492 37.0 37.0 37.0 37.0 37.0 3 36.6015 37.0 37.0 37.0 37.0 37.0 4 36.643 37.0 37.0 37.0 37.0 37.0 5 36.6835 37.0 37.0 37.0 37.0 37.0 6 36.568 37.0 37.0 37.0 37.0 37.0 7 36.622 37.0 37.0 37.0 37.0 37.0 8 36.431 37.0 37.0 37.0 37.0 37.0 9 36.635 37.0 37.0 37.0 37.0 37.0 10-14 36.5135 37.0 37.0 37.0 37.0 37.0 15-19 36.5576 37.0 37.0 37.0 37.0 37.0 20-24 36.533500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.495799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.483900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.363 37.0 37.0 37.0 37.0 37.0 40-44 36.4503 37.0 37.0 37.0 37.0 37.0 45-49 36.195100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.04051550681642 37.0 37.0 37.0 34.6 37.0 55-59 36.05812019222267 37.0 37.0 37.0 37.0 37.0 60-64 35.46327449044914 37.0 37.0 37.0 34.6 37.0 65-69 36.29083191961103 37.0 37.0 37.0 37.0 37.0 70-74 36.30729525649305 37.0 37.0 37.0 37.0 37.0 75-79 36.08227709415193 37.0 37.0 37.0 34.6 37.0 80-84 36.19734082554722 37.0 37.0 37.0 37.0 37.0 85-89 36.12985405008022 37.0 37.0 37.0 37.0 37.0 90-94 36.052987023222435 37.0 37.0 37.0 37.0 37.0 95-99 36.13302668464159 37.0 37.0 37.0 37.0 37.0 100-104 35.57501958230822 37.0 37.0 37.0 31.8 37.0 105-109 35.95192089325086 37.0 37.0 37.0 34.6 37.0 110-114 36.114111745575784 37.0 37.0 37.0 37.0 37.0 115-119 36.076169976096885 37.0 37.0 37.0 37.0 37.0 120-124 35.73048889865792 37.0 37.0 37.0 34.6 37.0 125-129 35.86707723219098 37.0 37.0 37.0 34.6 37.0 130-134 36.10415377916915 37.0 37.0 37.0 37.0 37.0 135-139 34.62329907221029 37.0 34.6 37.0 29.4 37.0 140-144 35.56622584785834 37.0 37.0 37.0 34.6 37.0 145-149 35.86976179054973 37.0 37.0 37.0 37.0 37.0 150 36.53112582781457 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 1.0 28 4.0 29 6.0 30 12.0 31 38.0 32 47.0 33 78.0 34 158.0 35 669.0 36 2862.0 37 125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 11.625 12.325 35.925000000000004 2 24.55 9.049999999999999 30.5 35.9 3 21.85 11.825 24.7 41.625 4 25.75 15.024999999999999 22.0 37.225 5 27.450000000000003 21.5 24.9 26.150000000000002 6 24.0 29.475 25.1 21.425 7 17.2 26.375 39.175 17.25 8 16.175 26.950000000000003 32.800000000000004 24.075 9 18.625 26.55 32.425 22.400000000000002 10-14 20.21 29.695 28.189999999999998 21.905 15-19 20.73 27.935 27.800000000000004 23.535 20-24 20.645 27.72 28.065 23.57 25-29 20.825 28.000000000000004 27.605 23.57 30-34 20.715 27.425 28.54 23.32 35-39 20.435 28.175 27.860000000000003 23.53 40-44 20.87 27.605 28.384999999999998 23.14 45-49 20.505000000000003 28.325 27.939999999999998 23.23 50-54 20.451135340602182 28.163449034710414 27.78333500050015 23.602080624187256 55-59 19.878763588998545 28.3603025900506 28.144882520915786 23.616051300035068 60-64 20.747701120546704 27.787548364403797 27.95336917742827 23.511381337621227 65-69 19.937506299768167 28.6311863723415 27.250277189799416 24.181030138090918 70-74 20.026283865750102 28.43206631621512 28.23999191265669 23.301657905378086 75-79 20.4917200040638 28.18754444783095 28.091029157777104 23.229706390328154 80-84 20.19343943503403 28.565580062432833 27.14804769459086 24.092932807942276 85-89 19.860752965446107 28.035069623517277 28.246518824136153 23.857658586900467 90-94 20.781786048445785 28.246179436531865 27.638008108951034 23.334026406071317 95-99 20.528028553432712 27.949821541045562 28.322485828259502 23.19966407726223 100-104 20.56124343536152 27.828762399872687 28.523685746114264 23.08630841865153 105-109 20.948127421437796 28.503013344812743 27.42143779595351 23.127421437795952 110-114 20.08425429478061 28.050114892220158 28.63551810920232 23.230112703796916 115-119 20.031290160362072 28.105269039503828 28.194669497681176 23.668771302452924 120-124 19.526017516743945 28.46184669986834 28.295838342206192 23.71629744118152 125-129 20.008262999468805 28.058785339078085 27.958448916956858 23.974502744496252 130-134 20.614355231143552 27.65206812652068 28.965936739659366 22.767639902676397 135-139 20.97331240188383 28.383045525902666 27.90580847723705 22.737833594976454 140-144 20.790088220031137 28.405552672548 28.0098598858329 22.794499221587962 145-149 20.951131518530666 29.4260413250246 26.454575270580516 23.16825188586422 150 20.99337748344371 27.71523178807947 27.68211920529801 23.60927152317881 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 2.0 27 4.5 28 7.0 29 7.0 30 11.5 31 17.0 32 27.5 33 35.5 34 31.5 35 51.0 36 83.5 37 112.0 38 121.5 39 142.5 40 181.5 41 196.5 42 239.5 43 274.0 44 283.0 45 307.0 46 302.0 47 281.5 48 255.0 49 214.5 50 167.5 51 141.5 52 132.0 53 99.5 54 76.0 55 65.5 56 51.0 57 38.0 58 30.0 59 18.5 60 11.5 61 10.0 62 4.0 63 2.5 64 2.0 65 3.0 66 2.5 67 1.5 68 1.0 69 2.0 70 3.0 71 1.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 3.0 55-59 13.0 60-64 11.0 65-69 12.0 70-74 14.0 75-79 29.0 80-84 26.0 85-89 31.0 90-94 28.0 95-99 45.0 100-104 51.0 105-109 56.0 110-114 72.0 115-119 76.0 120-124 107.0 125-129 93.0 130-134 111.0 135-139 94.0 140-144 77.0 145-149 31.0 150-151 3020.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9761452968284 84.82499999999999 2 7.617240444564922 14.05 3 0.4066142586066685 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCTGT 10 0.008514205 134.7 3 CGGCCTG 10 0.008514205 134.7 2 GTAGTTC 10 0.008514205 134.7 7 >>END_MODULE SRR13347980 read2 length is 52-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347980_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.651 37.0 37.0 37.0 37.0 37.0 2 36.01 37.0 37.0 37.0 37.0 37.0 3 31.9805 37.0 25.0 37.0 11.0 37.0 4 36.1795 37.0 37.0 37.0 37.0 37.0 5 36.059 37.0 37.0 37.0 37.0 37.0 6 36.2115 37.0 37.0 37.0 37.0 37.0 7 33.9995 37.0 37.0 37.0 25.0 37.0 8 36.3045 37.0 37.0 37.0 37.0 37.0 9 36.136 37.0 37.0 37.0 37.0 37.0 10-14 34.342000000000006 37.0 37.0 37.0 27.0 37.0 15-19 35.9497 37.0 37.0 37.0 37.0 37.0 20-24 35.8601 37.0 37.0 37.0 34.6 37.0 25-29 35.90429999999999 37.0 37.0 37.0 34.6 37.0 30-34 35.48949999999999 37.0 37.0 37.0 34.6 37.0 35-39 34.3113 37.0 34.6 37.0 24.2 37.0 40-44 36.0136 37.0 37.0 37.0 37.0 37.0 45-49 35.635000000000005 37.0 37.0 37.0 34.6 37.0 50-54 35.4287564278457 37.0 37.0 37.0 34.6 37.0 55-59 35.61620434640805 37.0 37.0 37.0 34.6 37.0 60-64 34.32083121287473 37.0 34.6 37.0 29.4 37.0 65-69 35.93538087662695 37.0 37.0 37.0 37.0 37.0 70-74 35.03919800653888 37.0 37.0 37.0 32.2 37.0 75-79 35.46222370303293 37.0 37.0 37.0 34.6 37.0 80-84 35.98983474955244 37.0 37.0 37.0 37.0 37.0 85-89 35.890544186281964 37.0 37.0 37.0 37.0 37.0 90-94 34.90164440429116 37.0 37.0 37.0 27.4 37.0 95-99 35.03623156939723 37.0 34.6 37.0 31.8 37.0 100-104 35.48314483751919 37.0 37.0 37.0 32.2 37.0 105-109 35.631234097041435 37.0 37.0 37.0 34.6 37.0 110-114 35.34413868760198 37.0 37.0 37.0 29.8 37.0 115-119 35.597742266351695 37.0 37.0 37.0 34.6 37.0 120-124 35.269631748946814 37.0 37.0 37.0 32.2 37.0 125-129 35.62080336330291 37.0 37.0 37.0 37.0 37.0 130-134 35.34407980957027 37.0 37.0 37.0 29.8 37.0 135-139 34.94050236785953 37.0 37.0 37.0 32.2 37.0 140-144 35.57314878703131 37.0 37.0 37.0 37.0 37.0 145-149 35.53958798310827 37.0 37.0 37.0 37.0 37.0 150 36.094028826355526 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 0.0 28 4.0 29 11.0 30 37.0 31 46.0 32 109.0 33 227.0 34 635.0 35 1414.0 36 1481.0 37 34.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.825000000000003 30.349999999999998 13.450000000000001 25.374999999999996 2 22.575 31.175000000000004 30.725 15.525 3 20.275000000000002 29.599999999999998 32.525 17.599999999999998 4 23.849999999999998 31.075000000000003 25.124999999999996 19.950000000000003 5 25.825 31.45 24.9 17.825 6 21.2 38.6 23.65 16.55 7 20.75 24.575 36.449999999999996 18.224999999999998 8 22.375 25.074999999999996 28.9 23.65 9 22.125 24.7 30.625000000000004 22.55 10-14 22.955000000000002 30.17 26.345000000000002 20.53 15-19 23.185 28.185 28.055000000000003 20.575 20-24 22.869999999999997 28.634999999999998 27.74 20.755000000000003 25-29 23.235 28.095 28.265 20.405 30-34 23.555 27.634999999999998 28.515 20.294999999999998 35-39 22.775000000000002 28.99 27.735 20.5 40-44 23.35 28.235 27.74 20.674999999999997 45-49 22.655 28.96 27.800000000000004 20.585 50-54 23.650912728182043 28.1470367591898 28.127031757939484 20.075018754688674 55-59 23.387622149837135 27.511901779002756 28.3688298672012 20.73164620395891 60-64 23.013478173405755 28.414805874069604 27.097163548581776 21.474552403942866 65-69 23.4172425969833 28.08858396811784 27.745548100691114 20.748625334207738 70-74 23.025116467490378 28.367429613125378 27.719262710147863 20.88819120923638 75-79 23.33791838606144 28.371287380915994 27.87712058688675 20.41367364613582 80-84 23.206036341238065 27.676829894261367 28.226054819833692 20.891078944666873 85-89 23.312279975150137 27.904328018223236 27.95609857113274 20.82729343549389 90-94 22.939517392666875 28.61694348689021 27.572338869737806 20.871200250705108 95-99 23.238135459008603 27.4982843266642 28.58575727181545 20.677822942511746 100-104 23.93194303696197 27.148114566110195 27.916155528294844 21.003786868632993 105-109 24.019475250202866 27.93075466594536 27.81714903976197 20.2326210440898 110-114 23.889133304003522 28.013638363396392 27.91465024197096 20.182578090629125 115-119 24.39092848321545 27.95554058605591 27.382957224654763 20.270573706073876 120-124 23.24846255531927 29.053393873211103 27.352146675096268 20.345996896373357 125-129 24.229492650545282 27.47747747747748 28.236130867709814 20.056899004267425 130-134 24.295925224509745 27.814771824790764 27.234406500091634 20.654896450607858 135-139 23.184568835098336 28.964952092788703 27.300806858295513 20.54967221381745 140-144 23.034330011074196 28.356458862614815 27.49658002735978 21.11263109895121 145-149 24.344791255103384 28.974055050704596 26.62320558409061 20.05794811010141 150 24.639670555936856 27.934111187371315 27.419354838709676 20.006863417982153 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 0.5 22 0.5 23 1.5 24 1.5 25 1.0 26 1.0 27 7.0 28 9.5 29 10.0 30 16.0 31 22.5 32 26.5 33 36.5 34 62.0 35 75.5 36 92.5 37 126.0 38 154.0 39 199.5 40 222.5 41 221.0 42 254.0 43 274.0 44 278.0 45 296.5 46 296.5 47 250.5 48 205.0 49 195.0 50 170.0 51 136.0 52 109.5 53 81.5 54 57.5 55 36.5 56 33.0 57 33.0 58 22.0 59 12.0 60 6.5 61 8.5 62 9.0 63 3.5 64 1.5 65 1.0 66 1.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 4.0 54-55 3.0 56-57 3.0 58-59 8.0 60-61 4.0 62-63 8.0 64-65 3.0 66-67 3.0 68-69 8.0 70-71 7.0 72-73 8.0 74-75 9.0 76-77 13.0 78-79 12.0 80-81 9.0 82-83 14.0 84-85 15.0 86-87 13.0 88-89 11.0 90-91 16.0 92-93 15.0 94-95 19.0 96-97 15.0 98-99 14.0 100-101 14.0 102-103 20.0 104-105 25.0 106-107 20.0 108-109 23.0 110-111 22.0 112-113 38.0 114-115 26.0 116-117 31.0 118-119 29.0 120-121 39.0 122-123 42.0 124-125 41.0 126-127 40.0 128-129 38.0 130-131 48.0 132-133 32.0 134-135 41.0 136-137 50.0 138-139 33.0 140-141 47.0 142-143 29.0 144-145 0.0 146-147 0.0 148-149 124.0 150-151 2914.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.56033799841563 89.525 2 5.2548191180353845 9.950000000000001 3 0.18484288354898337 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAGC 10 0.008516566 134.6875 7 GCCATCA 10 0.008516566 134.6875 7 >>END_MODULE Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125753 spots for SRR13347980.sra Written 1125753 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra Read 1125736 spots for SRR13347980.sra Written 1125736 spots for SRR13347980.sra SRR ids: ['SRR13347980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zb43wpmq SRR13347980.sra spots: 22514737 blocks: [[1, 1125736], [1125737, 2251472], [2251473, 3377208], [3377209, 4502944], [4502945, 5628680], [5628681, 6754416], [6754417, 7880152], [7880153, 9005888], [9005889, 10131624], [10131625, 11257360], [11257361, 12383096], [12383097, 13508832], [13508833, 14634568], [14634569, 15760304], [15760305, 16886040], [16886041, 18011776], [18011777, 19137512], [19137513, 20263248], [20263249, 21388984], [21388985, 22514737]] SRR13347980 file size 7220995 SRR13347980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347980 SRR13347980_1.fastq SRR13347980_2.fastq Input file: SRR13347980_1.fastq Paired file: SRR13347980_2.fastq trimmed: SRR13347980-trimmed-pair1.fastq, SRR13347980-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:29:35 2025 >> started Wed Feb 12 00:30:17 2025 >> done (41.791s) 22514737 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 22514737 (100.00%) read pairs available; of these: 1097833 ( 4.88%) trimmed read pairs available after processing 21416904 (95.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 1 0.00% 47 4 0.00% 48 1 0.00% 49 10 0.00% 50 3976 0.02% 51 4608 0.02% 52 4866 0.02% 53 5155 0.02% 54 5480 0.02% 55 5817 0.03% 56 6044 0.03% 57 6671 0.03% 58 7324 0.03% 59 8165 0.04% 60 9299 0.04% 61 10565 0.05% 62 11416 0.05% 63 12035 0.05% 64 12527 0.06% 65 12865 0.06% 66 13070 0.06% 67 13553 0.06% 68 14143 0.06% 69 14941 0.07% 70 16367 0.07% 71 17630 0.08% 72 19348 0.09% 73 20796 0.09% 74 21766 0.10% 75 22138 0.10% 76 22714 0.10% 77 22712 0.10% 78 23035 0.10% 79 23902 0.11% 80 25133 0.11% 81 26744 0.12% 82 28965 0.13% 83 30850 0.14% 84 32207 0.14% 85 33390 0.15% 86 33811 0.15% 87 33769 0.15% 88 33827 0.15% 89 34555 0.15% 90 36288 0.16% 91 38113 0.17% 92 40617 0.18% 93 42330 0.19% 94 44970 0.20% 95 46494 0.21% 96 46787 0.21% 97 47216 0.21% 98 47547 0.21% 99 48582 0.22% 100 57195 0.25% 101 58730 0.26% 102 61670 0.27% 103 64040 0.28% 104 66445 0.30% 105 68551 0.30% 106 70117 0.31% 107 70976 0.32% 108 71603 0.32% 109 71933 0.32% 110 72922 0.32% 111 75581 0.34% 112 76931 0.34% 113 80037 0.36% 114 83653 0.37% 115 86509 0.38% 116 88465 0.39% 117 89283 0.40% 118 90916 0.40% 119 91283 0.41% 120 92781 0.41% 121 94869 0.42% 122 97974 0.44% 123 101152 0.45% 124 105245 0.47% 125 108276 0.48% 126 111700 0.50% 127 115180 0.51% 128 115733 0.51% 129 117388 0.52% 130 119616 0.53% 131 120117 0.53% 132 123221 0.55% 133 125924 0.56% 134 129853 0.58% 135 134584 0.60% 136 138669 0.62% 137 142016 0.63% 138 144666 0.64% 139 145119 0.64% 140 146826 0.65% 141 148168 0.66% 142 146151 0.65% 143 152683 0.68% 144 157474 0.70% 145 161488 0.72% 146 165089 0.73% 147 168957 0.75% 148 177323 0.79% 149 892316 3.96% 150 15172197 67.39% 22514737 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=30 prefix-density=0.48 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=117.27 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=15.3 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCTTGAGCGCTTTAGTGGCAGCATTATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTTCTTGGGTGCTTCATTTGGAGAGAACATGTTAATTGTCTCATACTCTACAGTCCCCAACAGGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=35.53 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.2 sequence=CAAGGAAGGAAACCCTGGAAATGTTGCA SRR13347980 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:31:11 Started mapping on | Feb 12 00:31:12 Finished on | Feb 12 00:33:55 Mapping speed, Million of reads per hour | 497.26 Number of input reads | 22514737 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 21591421 Uniquely mapped reads % | 95.90% Average mapped length | 282.13 Number of splices: Total | 20622586 Number of splices: Annotated (sjdb) | 20205611 Number of splices: GT/AG | 20297706 Number of splices: GC/AG | 267207 Number of splices: AT/AC | 18574 Number of splices: Non-canonical | 39099 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 585774 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 55425 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 340203 340203 340203 N_multimapping 585774 585774 585774 N_noFeature 754072 21370613 881468 N_ambiguous 181218 1469 86848 UnstrandedReadsAssigned:20656131 PositiveStrandReadsAssigned:219339 NegativeStrandReadsAssigned:20623105 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR13347980 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347980-trimmed-pair1.fastq SRR13347980-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,514,737 reads, 20,825,592 reads pseudoaligned [quant] estimated average fragment length: 170.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR13347980.ke.tsv 34699 SRR13347980.se.tsv 87100 total ==> SRR13347980.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1848.66 2053 56.6013 Potri.005G024800.1.v4.1 1035 865.657 385 22.6678 Potri.004G059700.1.v4.1 961 791.657 202 13.0049 Potri.007G009000.2.v4.1 1416 1246.66 0 0 Potri.003G141000.2.v4.1 2943 2773.66 887.23 16.3034 Potri.016G087400.1.v4.1 270 103.894 1217 597.027 Potri.015G069301.1.v4.1 564 394.72 0 0 Potri.010G195200.1.v4.1 1773 1603.66 518 16.4631 Potri.012G127500.1.v4.1 977 807.657 5469 345.124 ==> SRR13347980.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 434 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1055 SRR13347980 completed mapping pipeline successfully