Starting /dee2/code/volunteer_pipeline.sh SRR13347981 current disk space = 3051334647808 free memory = 1003050176 SRR13347981 SRAfilesize ff0aa397839d19eb42e97d008ab85016 SRR13347981.sra SRR13347981.sra file validated SRR13347981 is paired end SRR13347981 is conventional basespace SRR13347981 read1 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347981_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.53 37.0 37.0 37.0 37.0 37.0 3 36.575 37.0 37.0 37.0 37.0 37.0 4 36.5945 37.0 37.0 37.0 37.0 37.0 5 36.515 37.0 37.0 37.0 37.0 37.0 6 36.5465 37.0 37.0 37.0 37.0 37.0 7 36.5855 37.0 37.0 37.0 37.0 37.0 8 36.3995 37.0 37.0 37.0 37.0 37.0 9 36.6175 37.0 37.0 37.0 37.0 37.0 10-14 36.469800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5727 37.0 37.0 37.0 37.0 37.0 20-24 36.4811 37.0 37.0 37.0 37.0 37.0 25-29 36.5005 37.0 37.0 37.0 37.0 37.0 30-34 36.4274 37.0 37.0 37.0 37.0 37.0 35-39 36.3237 37.0 37.0 37.0 37.0 37.0 40-44 36.4033 37.0 37.0 37.0 37.0 37.0 45-49 36.1913 37.0 37.0 37.0 37.0 37.0 50-54 36.05951196636551 37.0 37.0 37.0 34.6 37.0 55-59 36.06091037609967 37.0 37.0 37.0 37.0 37.0 60-64 35.507633228186904 37.0 37.0 37.0 34.6 37.0 65-69 36.248966580919486 37.0 37.0 37.0 37.0 37.0 70-74 36.247660602864656 37.0 37.0 37.0 37.0 37.0 75-79 36.10556267782974 37.0 37.0 37.0 37.0 37.0 80-84 36.24118110477417 37.0 37.0 37.0 37.0 37.0 85-89 36.14648673437796 37.0 37.0 37.0 37.0 37.0 90-94 36.00142448133781 37.0 37.0 37.0 37.0 37.0 95-99 36.115894285408636 37.0 37.0 37.0 37.0 37.0 100-104 35.551943480872396 37.0 37.0 37.0 31.8 37.0 105-109 35.92925906413999 37.0 37.0 37.0 34.6 37.0 110-114 36.05516540549469 37.0 37.0 37.0 37.0 37.0 115-119 36.030099395375636 37.0 37.0 37.0 37.0 37.0 120-124 35.73938419673322 37.0 37.0 37.0 34.6 37.0 125-129 35.84709541820916 37.0 37.0 37.0 34.6 37.0 130-134 36.086656255578994 37.0 37.0 37.0 37.0 37.0 135-139 34.743061389433294 37.0 34.6 37.0 29.4 37.0 140-144 35.53010618459193 37.0 37.0 37.0 34.6 37.0 145-149 35.87485240698771 37.0 37.0 37.0 37.0 37.0 150 36.49650349650349 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 28 6.0 29 10.0 30 29.0 31 36.0 32 49.0 33 82.0 34 151.0 35 618.0 36 2907.0 37 112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.125 12.0 12.125 36.75 2 24.6 8.7 30.95 35.75 3 22.900000000000002 10.925 25.275 40.9 4 28.249999999999996 14.975 21.125 35.65 5 27.825 20.25 26.75 25.174999999999997 6 23.400000000000002 27.700000000000003 26.200000000000003 22.7 7 15.25 26.650000000000002 40.1 18.0 8 17.575 26.150000000000002 33.95 22.325 9 18.175 25.25 34.75 21.825 10-14 19.81 28.82 28.27 23.1 15-19 20.16 27.834999999999997 28.599999999999998 23.405 20-24 20.169999999999998 27.515 28.485 23.830000000000002 25-29 20.14 27.839999999999996 27.889999999999997 24.13 30-34 19.765 28.37 27.860000000000003 24.005000000000003 35-39 20.925 28.38 27.725 22.97 40-44 20.535 28.32 27.965 23.18 45-49 20.635 27.71 27.67 23.985 50-54 19.753766077773886 28.171763175016267 27.756368550122616 24.31810219708723 55-59 20.473230399037497 27.892520553438942 27.812312011229196 23.821937036294365 60-64 20.604050454796724 28.277802904668576 27.106889793456958 24.011256847077743 65-69 21.14337568058076 27.59628957451099 27.61141359144989 23.648921153458357 70-74 20.793682931767567 28.497671593439968 27.611864749949383 23.096780724843086 75-79 20.42135260292097 28.029107933438503 28.3497023052262 23.19983715841433 80-84 20.586429229352166 28.835329034899193 27.23365059871047 23.344591137038172 85-89 20.35069623517277 27.63280041258381 27.76689014956163 24.249613202681793 90-94 20.834417104510223 27.571138740050984 27.950892160432815 23.643551995005982 95-99 20.139727898303303 27.82476230498503 28.88060093502127 23.154908861690394 100-104 20.701026541141427 28.17403329610127 27.95064092335514 23.17429923940216 105-109 20.65793745265664 27.675576236338056 28.43307001406774 23.233416296937563 110-114 21.300804113560527 27.27421913462064 28.05098189376949 23.37399485804934 115-119 20.60376938900317 27.936843275699115 28.34825151498304 23.111135820314672 120-124 20.433647406061983 27.914632761948006 27.908956748779655 23.742763083210352 125-129 20.850026127852292 26.992974510828542 28.879986065145445 23.27701329617372 130-134 20.784103114930183 28.100011934598403 27.861319966583125 23.254564983888294 135-139 20.811396717249924 28.42985444410034 27.7299473521214 23.028801486528337 140-144 20.47172859450727 27.915993537964457 28.226171243941845 23.386106623586432 145-149 21.50045745654163 28.296954646451443 27.58462946020128 22.617958436805647 150 21.878121878121878 29.37062937062937 26.906426906426905 21.844821844821848 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 2.0 27 3.0 28 4.5 29 7.5 30 11.0 31 15.5 32 25.0 33 33.5 34 33.0 35 47.5 36 71.0 37 89.0 38 125.0 39 153.5 40 184.0 41 217.0 42 245.5 43 257.0 44 286.5 45 316.0 46 286.5 47 258.0 48 250.0 49 233.5 50 188.5 51 144.0 52 127.5 53 105.0 54 77.0 55 59.5 56 47.5 57 39.5 58 26.0 59 20.0 60 14.0 61 10.5 62 10.5 63 9.5 64 6.5 65 2.0 66 0.5 67 1.5 68 2.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 8.0 55-59 7.0 60-64 14.0 65-69 12.0 70-74 18.0 75-79 20.0 80-84 31.0 85-89 32.0 90-94 33.0 95-99 44.0 100-104 58.0 105-109 49.0 110-114 46.0 115-119 73.0 120-124 78.0 125-129 86.0 130-134 107.0 135-139 138.0 140-144 85.0 145-149 58.0 150-151 3003.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.39101001895477 85.3 2 6.9049553208773355 12.75 3 0.7040346601678852 1.95 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATTA 10 0.008255061 136.1 1 >>END_MODULE SRR13347981 read2 length is 50-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13347981_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4635 37.0 37.0 37.0 37.0 37.0 2 35.863 37.0 37.0 37.0 37.0 37.0 3 31.9515 37.0 25.0 37.0 11.0 37.0 4 36.1625 37.0 37.0 37.0 37.0 37.0 5 36.0915 37.0 37.0 37.0 37.0 37.0 6 36.273 37.0 37.0 37.0 37.0 37.0 7 33.9315 37.0 37.0 37.0 25.0 37.0 8 36.2855 37.0 37.0 37.0 37.0 37.0 9 36.196 37.0 37.0 37.0 37.0 37.0 10-14 34.5596 37.0 37.0 37.0 27.0 37.0 15-19 35.9139 37.0 37.0 37.0 37.0 37.0 20-24 35.908500000000004 37.0 37.0 37.0 34.6 37.0 25-29 36.0022 37.0 37.0 37.0 34.6 37.0 30-34 35.6299 37.0 37.0 37.0 34.6 37.0 35-39 34.2583 37.0 34.6 37.0 24.2 37.0 40-44 36.0115 37.0 37.0 37.0 37.0 37.0 45-49 35.6223 37.0 37.0 37.0 34.6 37.0 50-54 35.49015554852028 37.0 37.0 37.0 34.6 37.0 55-59 35.70071442478197 37.0 37.0 37.0 34.6 37.0 60-64 34.26254994854928 37.0 34.6 37.0 29.4 37.0 65-69 35.89071859286754 37.0 37.0 37.0 37.0 37.0 70-74 35.139392280160465 37.0 37.0 37.0 32.2 37.0 75-79 35.41822929389516 37.0 37.0 37.0 32.2 37.0 80-84 35.90431888376006 37.0 37.0 37.0 37.0 37.0 85-89 35.909984071338215 37.0 37.0 37.0 37.0 37.0 90-94 34.97733896299097 37.0 37.0 37.0 32.2 37.0 95-99 35.10270947540665 37.0 34.6 37.0 31.8 37.0 100-104 35.523108468648914 37.0 37.0 37.0 34.6 37.0 105-109 35.60284104063343 37.0 37.0 37.0 34.6 37.0 110-114 35.35090169939711 37.0 37.0 37.0 29.8 37.0 115-119 35.52142794608788 37.0 37.0 37.0 34.6 37.0 120-124 35.28929742449581 37.0 37.0 37.0 32.2 37.0 125-129 35.70128973318079 37.0 37.0 37.0 37.0 37.0 130-134 35.547069845216434 37.0 37.0 37.0 32.2 37.0 135-139 35.10853711664068 37.0 37.0 37.0 32.2 37.0 140-144 35.66547233556133 37.0 37.0 37.0 37.0 37.0 145-149 35.64152484387728 37.0 37.0 37.0 34.6 37.0 150 36.08567558415171 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 3.0 28 13.0 29 18.0 30 36.0 31 59.0 32 97.0 33 207.0 34 564.0 35 1375.0 36 1577.0 37 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.574999999999996 29.65 13.975000000000001 24.8 2 22.1 32.4 30.4 15.1 3 22.05 28.575 33.35 16.025 4 25.174999999999997 31.55 22.725 20.549999999999997 5 23.775 35.375 24.175 16.675 6 21.05 39.525 22.925 16.5 7 20.549999999999997 24.3 37.375 17.775 8 21.275 25.474999999999998 30.825000000000003 22.425 9 22.925 24.525 30.775000000000002 21.775 10-14 22.485 29.84 26.419999999999998 21.255 15-19 23.035 27.639999999999997 28.315 21.01 20-24 23.13 28.57 27.48 20.82 25-29 22.67 28.37 27.915 21.044999999999998 30-34 22.645 28.455000000000002 28.000000000000004 20.9 35-39 22.48 28.825 27.48 21.215 40-44 23.34 27.955000000000002 27.750000000000004 20.955 45-49 22.975 27.74 28.449999999999996 20.835 50-54 23.28677979676628 27.686839865845727 28.062271612354206 20.96410872503379 55-59 23.682230803952052 28.015447113696773 27.18290786900045 21.11941421335072 60-64 22.82351757783031 29.43720766483931 26.439672081677816 21.29960267565257 65-69 23.03654350898445 27.594387240056534 28.548354532606503 20.820714718352516 70-74 23.499898641800122 28.28907358605311 27.58970200689236 20.621325765254408 75-79 23.25605095541401 28.16305732484076 27.6687898089172 20.912101910828028 80-84 23.17660315509117 27.801679983609915 27.909239909854538 21.112476951444375 85-89 24.202210058866054 27.796137560673344 27.589590003098213 20.41206237736239 90-94 24.027567482900853 28.261891087558084 27.61447292852295 20.096068501018117 95-99 23.717813423385394 28.13423385394681 27.537990713381173 20.60996200928662 100-104 24.219752030782384 28.056861906797774 27.201795639162036 20.521590423257802 105-109 24.102480417754567 27.687119234116626 27.9210182767624 20.289382071366404 110-114 23.425554149936747 27.92475661404763 27.572740773334797 21.076948462680818 115-119 24.4500279173646 27.59352317141262 27.660524846454493 20.295924064768286 120-124 23.5642999714856 28.23495865412033 27.305389221556887 20.895352152837184 125-129 24.352543163789083 27.91647223518432 27.09986000933271 20.631124591693887 130-134 23.989929265076128 27.868361107780842 27.71849898093754 20.42321064620549 135-139 24.522550544323487 28.466562986003108 26.23950233281493 20.771384136858476 140-144 24.041518001946155 28.744729159909177 27.103470645475188 20.11028219266948 145-149 24.20783310371974 28.14406612871482 26.91071311421636 20.737387653349078 150 26.37995259058584 29.224517439891635 25.871994581781237 18.52353538774128 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 1.5 26 4.0 27 7.5 28 7.0 29 8.5 30 14.5 31 18.5 32 25.5 33 39.5 34 55.5 35 67.0 36 81.5 37 117.5 38 146.5 39 176.5 40 209.0 41 246.0 42 279.0 43 293.0 44 297.5 45 276.0 46 271.0 47 265.0 48 232.0 49 194.0 50 156.0 51 125.0 52 97.5 53 78.0 54 60.5 55 39.0 56 27.5 57 30.0 58 22.5 59 14.5 60 16.0 61 11.0 62 6.5 63 4.5 64 6.5 65 5.5 66 3.5 67 3.5 68 3.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 10.0 55-59 8.0 60-64 15.0 65-69 15.0 70-74 16.0 75-79 21.0 80-84 26.0 85-89 39.0 90-94 42.0 95-99 44.0 100-104 60.0 105-109 49.0 110-114 44.0 115-119 73.0 120-124 76.0 125-129 85.0 130-134 110.0 135-139 134.0 140-144 83.0 145-149 97.0 150-151 2953.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0815360336665 90.375 2 4.629142556549184 8.799999999999999 3 0.289321409784324 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGAAT 10 0.008158363 136.6375 1 AGCGTTG 10 0.008158363 136.6375 4 >>END_MODULE Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059865 spots for SRR13347981.sra Written 1059865 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra Read 1059846 spots for SRR13347981.sra Written 1059846 spots for SRR13347981.sra SRR ids: ['SRR13347981.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7otqq36t SRR13347981.sra spots: 21196939 blocks: [[1, 1059846], [1059847, 2119692], [2119693, 3179538], [3179539, 4239384], [4239385, 5299230], [5299231, 6359076], [6359077, 7418922], [7418923, 8478768], [8478769, 9538614], [9538615, 10598460], [10598461, 11658306], [11658307, 12718152], [12718153, 13777998], [13777999, 14837844], [14837845, 15897690], [15897691, 16957536], [16957537, 18017382], [18017383, 19077228], [19077229, 20137074], [20137075, 21196939]] SRR13347981 file size 6786758 SRR13347981 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13347981 SRR13347981_1.fastq SRR13347981_2.fastq Input file: SRR13347981_1.fastq Paired file: SRR13347981_2.fastq trimmed: SRR13347981-trimmed-pair1.fastq, SRR13347981-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:42:22 2025 >> started Wed Feb 12 00:42:57 2025 >> done (34.290s) 21196939 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21196939 (100.00%) read pairs available; of these: 1071087 ( 5.05%) trimmed read pairs available after processing 20125852 (94.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 46 1 0.00% 47 2 0.00% 48 2 0.00% 49 4 0.00% 50 3679 0.02% 51 4245 0.02% 52 4738 0.02% 53 5045 0.02% 54 5109 0.02% 55 5288 0.02% 56 5612 0.03% 57 6227 0.03% 58 6965 0.03% 59 7776 0.04% 60 8857 0.04% 61 9557 0.05% 62 10692 0.05% 63 11363 0.05% 64 11609 0.05% 65 11769 0.06% 66 12214 0.06% 67 12676 0.06% 68 13551 0.06% 69 14495 0.07% 70 15604 0.07% 71 16861 0.08% 72 18270 0.09% 73 20122 0.09% 74 20605 0.10% 75 20872 0.10% 76 21324 0.10% 77 21742 0.10% 78 22420 0.11% 79 23033 0.11% 80 24604 0.12% 81 26330 0.12% 82 27843 0.13% 83 29857 0.14% 84 31575 0.15% 85 32335 0.15% 86 32873 0.16% 87 32787 0.15% 88 32806 0.15% 89 33531 0.16% 90 35024 0.17% 91 37155 0.18% 92 39212 0.18% 93 41686 0.20% 94 43574 0.21% 95 45465 0.21% 96 46066 0.22% 97 46723 0.22% 98 46215 0.22% 99 47324 0.22% 100 55008 0.26% 101 57267 0.27% 102 59597 0.28% 103 62096 0.29% 104 64454 0.30% 105 66344 0.31% 106 68353 0.32% 107 69097 0.33% 108 69716 0.33% 109 70200 0.33% 110 70714 0.33% 111 72430 0.34% 112 75623 0.36% 113 77822 0.37% 114 81485 0.38% 115 84913 0.40% 116 87426 0.41% 117 87984 0.42% 118 88933 0.42% 119 90005 0.42% 120 91017 0.43% 121 92621 0.44% 122 95747 0.45% 123 99223 0.47% 124 103183 0.49% 125 106420 0.50% 126 110044 0.52% 127 112034 0.53% 128 113485 0.54% 129 114929 0.54% 130 115444 0.54% 131 117314 0.55% 132 120148 0.57% 133 123279 0.58% 134 128019 0.60% 135 132177 0.62% 136 134956 0.64% 137 138939 0.66% 138 140553 0.66% 139 142934 0.67% 140 144025 0.68% 141 144086 0.68% 142 141979 0.67% 143 148959 0.70% 144 152577 0.72% 145 157278 0.74% 146 160650 0.76% 147 164486 0.78% 148 171457 0.81% 149 825805 3.90% 150 14088390 66.46% 21196939 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=32 prefix-density=0.50 prefix-fanout=2.4 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=76.83 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=17.7 sequence=TTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=23 prefix-density=0.71 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=35.41 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.0 sequence=CAAGGAAGGAAACCCTGGAAATGTTGCA SRR13347981 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:43:39 Started mapping on | Feb 12 00:43:39 Finished on | Feb 12 00:45:45 Mapping speed, Million of reads per hour | 605.63 Number of input reads | 21196939 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 20302968 Uniquely mapped reads % | 95.78% Average mapped length | 281.60 Number of splices: Total | 19337779 Number of splices: Annotated (sjdb) | 18943259 Number of splices: GT/AG | 19032291 Number of splices: GC/AG | 249873 Number of splices: AT/AC | 18108 Number of splices: Non-canonical | 37507 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 551387 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 71492 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345006 345006 345006 N_multimapping 551387 551387 551387 N_noFeature 712606 20094174 833470 N_ambiguous 171259 1423 82367 UnstrandedReadsAssigned:19419103 PositiveStrandReadsAssigned:207371 NegativeStrandReadsAssigned:19387131 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR13347981 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13347981-trimmed-pair1.fastq SRR13347981-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,196,939 reads, 19,595,852 reads pseudoaligned [quant] estimated average fragment length: 169 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR13347981.ke.tsv 34699 SRR13347981.se.tsv 87100 total ==> SRR13347981.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1850 1853 53.7758 Potri.005G024800.1.v4.1 1035 867 319 19.754 Potri.004G059700.1.v4.1 961 793.006 243 16.4518 Potri.007G009000.2.v4.1 1416 1248 0 0 Potri.003G141000.2.v4.1 2943 2775 859.723 16.6333 Potri.016G087400.1.v4.1 270 105.081 1301 664.713 Potri.015G069301.1.v4.1 564 396.076 0 0 Potri.010G195200.1.v4.1 1773 1605 470 15.7219 Potri.012G127500.1.v4.1 977 809 5571 369.715 ==> SRR13347981.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 421 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1101 SRR13347981 completed mapping pipeline successfully