Starting /dee2/code/volunteer_pipeline.sh SRR13481183 current disk space = 3052369448960 free memory = 1480951184 SRR13481183 SRAfilesize 2438a52a6281b7d10e5c9988c5729e43 SRR13481183.sra SRR13481183.sra file validated SRR13481183 is paired end SRR13481183 is conventional basespace SRR13481183 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4865 33.0 33.0 33.0 33.0 33.0 2 32.395 33.0 33.0 33.0 33.0 33.0 3 32.456 33.0 33.0 33.0 33.0 33.0 4 32.5465 33.0 33.0 33.0 33.0 33.0 5 32.47925 33.0 33.0 33.0 33.0 33.0 6 36.04675 37.0 37.0 37.0 33.0 37.0 7 36.20025 37.0 37.0 37.0 37.0 37.0 8 36.37 37.0 37.0 37.0 37.0 37.0 9 36.437 37.0 37.0 37.0 37.0 37.0 10-11 36.409000000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.373000000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.319874999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.3535 37.0 37.0 37.0 37.0 37.0 18-19 36.378249999999994 37.0 37.0 37.0 37.0 37.0 20-21 36.254875 37.0 37.0 37.0 37.0 37.0 22-23 36.265875 37.0 37.0 37.0 37.0 37.0 24-25 36.31175 37.0 37.0 37.0 37.0 37.0 26-27 36.276125 37.0 37.0 37.0 37.0 37.0 28-29 36.296875 37.0 37.0 37.0 37.0 37.0 30-31 36.29875 37.0 37.0 37.0 37.0 37.0 32-33 36.32825 37.0 37.0 37.0 37.0 37.0 34-35 36.23625 37.0 37.0 37.0 37.0 37.0 36-37 36.272125 37.0 37.0 37.0 37.0 37.0 38-39 36.234750000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.161375 37.0 37.0 37.0 37.0 37.0 42-43 36.16 37.0 37.0 37.0 37.0 37.0 44-45 36.0905 37.0 37.0 37.0 37.0 37.0 46-47 36.103625 37.0 37.0 37.0 37.0 37.0 48-49 36.053 37.0 37.0 37.0 37.0 37.0 50-51 36.047125 37.0 37.0 37.0 37.0 37.0 52-53 36.01075 37.0 37.0 37.0 37.0 37.0 54-55 35.895250000000004 37.0 37.0 37.0 35.0 37.0 56-57 35.943625 37.0 37.0 37.0 35.0 37.0 58-59 35.8855 37.0 37.0 37.0 33.0 37.0 60-61 35.907875 37.0 37.0 37.0 35.0 37.0 62-63 35.829750000000004 37.0 37.0 37.0 33.0 37.0 64-65 35.747749999999996 37.0 37.0 37.0 33.0 37.0 66-67 35.726749999999996 37.0 37.0 37.0 33.0 37.0 68-69 35.812 37.0 37.0 37.0 33.0 37.0 70-71 35.6545 37.0 37.0 37.0 33.0 37.0 72-73 35.476875 37.0 37.0 37.0 33.0 37.0 74-75 35.50725 37.0 37.0 37.0 33.0 37.0 76-77 35.46 37.0 37.0 37.0 33.0 37.0 78-79 35.49125 37.0 37.0 37.0 33.0 37.0 80-81 35.43625 37.0 37.0 37.0 33.0 37.0 82-83 35.39125 37.0 37.0 37.0 33.0 37.0 84-85 35.143875 37.0 37.0 37.0 33.0 37.0 86-87 35.21425 37.0 37.0 37.0 33.0 37.0 88-89 35.271375 37.0 37.0 37.0 33.0 37.0 90-91 35.15375 37.0 37.0 37.0 33.0 37.0 92-93 35.010000000000005 37.0 37.0 37.0 33.0 37.0 94-95 34.995374999999996 37.0 37.0 37.0 33.0 37.0 96-97 34.872875 37.0 37.0 37.0 33.0 37.0 98-99 34.624875 37.0 37.0 37.0 27.0 37.0 100-101 34.6605 37.0 37.0 37.0 27.0 37.0 102-103 34.71825 37.0 37.0 37.0 27.0 37.0 104-105 34.350375 37.0 37.0 37.0 27.0 37.0 106-107 34.14775 37.0 37.0 37.0 27.0 37.0 108-109 34.257125 37.0 37.0 37.0 27.0 37.0 110-111 34.122749999999996 37.0 37.0 37.0 27.0 37.0 112-113 34.030249999999995 37.0 37.0 37.0 27.0 37.0 114-115 33.7695 37.0 37.0 37.0 24.5 37.0 116-117 33.496750000000006 37.0 37.0 37.0 22.0 37.0 118-119 33.273 37.0 37.0 37.0 22.0 37.0 120-121 32.665125 37.0 33.0 37.0 14.0 37.0 122-123 32.316874999999996 37.0 33.0 37.0 14.0 37.0 124-125 31.590875 37.0 33.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 2.0 18 6.0 19 5.0 20 9.0 21 5.0 22 4.0 23 7.0 24 12.0 25 21.0 26 33.0 27 26.0 28 39.0 29 64.0 30 76.0 31 85.0 32 127.0 33 181.0 34 273.0 35 485.0 36 2536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 19.7 11.825 40.35 2 15.531062124248496 27.07915831663327 37.85070140280561 19.539078156312627 3 17.275 34.425 22.875 25.424999999999997 4 20.75 38.85 17.8 22.6 5 21.8 38.224999999999994 19.900000000000002 20.075000000000003 6 18.125 34.025 25.974999999999998 21.875 7 13.775 19.35 42.699999999999996 24.175 8 18.425 17.9 30.875000000000004 32.800000000000004 9 17.275 19.575 32.324999999999996 30.825000000000003 10-11 21.762500000000003 30.975 21.6 25.662499999999998 12-13 19.3875 25.087500000000002 30.4375 25.087500000000002 14-15 20.125 27.487499999999997 27.900000000000002 24.4875 16-17 21.1125 27.85 28.075 22.9625 18-19 20.175 27.737499999999997 28.487499999999997 23.599999999999998 20-21 20.9125 27.250000000000004 28.3625 23.474999999999998 22-23 20.575 27.5625 28.199999999999996 23.6625 24-25 21.099999999999998 28.262500000000003 27.200000000000003 23.4375 26-27 20.825 28.0875 27.474999999999998 23.6125 28-29 20.6125 27.775 27.8375 23.775 30-31 21.1875 27.8375 28.0625 22.912499999999998 32-33 21.224999999999998 27.437499999999996 28.95 22.3875 34-35 20.6375 28.212500000000002 27.6 23.549999999999997 36-37 20.3875 28.4375 27.35 23.825 38-39 21.15 27.375 27.8125 23.6625 40-41 21.025 27.975 27.3375 23.6625 42-43 20.7125 28.299999999999997 27.575 23.4125 44-45 20.9 27.287499999999998 28.1 23.7125 46-47 21.05 27.750000000000004 27.3875 23.8125 48-49 21.2875 28.537499999999998 28.0625 22.112499999999997 50-51 20.4 27.35 28.675 23.575 52-53 20.549999999999997 28.075 27.250000000000004 24.125 54-55 21.0 28.787499999999998 27.237499999999997 22.975 56-57 20.9 27.287499999999998 27.712500000000002 24.099999999999998 58-59 20.2375 28.0875 28.825 22.85 60-61 21.3125 27.025 27.8375 23.825 62-63 20.45 27.6625 27.625 24.2625 64-65 20.5625 27.900000000000002 27.8375 23.7 66-67 21.1875 27.8125 27.35 23.65 68-69 20.7 27.1125 28.199999999999996 23.9875 70-71 20.925 28.237499999999997 27.8875 22.95 72-73 21.3 28.199999999999996 27.025 23.474999999999998 74-75 21.325 27.075 27.975 23.625 76-77 20.7375 28.4 27.125 23.7375 78-79 21.3 27.462500000000002 27.500000000000004 23.7375 80-81 21.275 27.1 27.8125 23.8125 82-83 21.3 28.1375 27.6125 22.95 84-85 21.6625 26.950000000000003 27.437499999999996 23.95 86-87 20.6125 27.0625 29.225 23.1 88-89 21.1375 27.3875 27.6375 23.8375 90-91 20.9375 27.8875 27.8375 23.3375 92-93 22.125 28.075 27.450000000000003 22.35 94-95 20.625 27.625 27.500000000000004 24.25 96-97 20.4875 27.375 28.95 23.1875 98-99 20.4875 27.150000000000002 28.499999999999996 23.8625 100-101 21.712500000000002 27.5875 27.3625 23.3375 102-103 20.9125 27.55 27.325 24.212500000000002 104-105 21.087500000000002 27.35 28.287499999999998 23.275000000000002 106-107 20.7375 27.175 27.875 24.212500000000002 108-109 21.512500000000003 27.450000000000003 27.762500000000003 23.275000000000002 110-111 21.1875 27.35 28.237499999999997 23.225 112-113 21.1875 27.375 28.262500000000003 23.175 114-115 21.7 27.537499999999998 27.85 22.912499999999998 116-117 21.05 27.325 27.750000000000004 23.875 118-119 22.112499999999997 26.6625 27.712500000000002 23.5125 120-121 21.325 27.1 27.762500000000003 23.8125 122-123 21.087500000000002 27.0875 28.3875 23.4375 124-125 21.6625 26.924999999999997 27.462500000000002 23.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 3.0 24 6.5 25 5.5 26 5.0 27 8.5 28 6.5 29 13.5 30 23.0 31 29.0 32 37.5 33 44.0 34 50.5 35 66.5 36 82.5 37 94.5 38 127.0 39 163.5 40 193.0 41 202.5 42 211.0 43 237.0 44 253.5 45 259.5 46 265.5 47 256.0 48 229.0 49 190.0 50 171.5 51 148.5 52 110.0 53 94.0 54 77.0 55 56.5 56 41.0 57 39.0 58 35.0 59 24.0 60 20.5 61 23.5 62 21.5 63 15.5 64 13.0 65 13.0 66 8.5 67 4.0 68 2.5 69 3.0 70 4.5 71 2.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13481183 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4655 33.0 33.0 33.0 33.0 33.0 2 32.51625 33.0 33.0 33.0 33.0 33.0 3 32.4255 33.0 33.0 33.0 33.0 33.0 4 32.33925 33.0 33.0 33.0 33.0 33.0 5 32.5055 33.0 33.0 33.0 33.0 33.0 6 36.046 37.0 37.0 37.0 37.0 37.0 7 36.0815 37.0 37.0 37.0 37.0 37.0 8 36.28075 37.0 37.0 37.0 37.0 37.0 9 36.208 37.0 37.0 37.0 37.0 37.0 10-11 36.17 37.0 37.0 37.0 37.0 37.0 12-13 36.034000000000006 37.0 37.0 37.0 37.0 37.0 14-15 36.06675 37.0 37.0 37.0 37.0 37.0 16-17 36.086 37.0 37.0 37.0 37.0 37.0 18-19 36.042249999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.117374999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.064125000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.028999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.870000000000005 37.0 37.0 37.0 37.0 37.0 28-29 35.80500000000001 37.0 37.0 37.0 33.0 37.0 30-31 35.925625 37.0 37.0 37.0 37.0 37.0 32-33 35.694500000000005 37.0 37.0 37.0 33.0 37.0 34-35 35.838125000000005 37.0 37.0 37.0 33.0 37.0 36-37 35.928 37.0 37.0 37.0 37.0 37.0 38-39 35.80625 37.0 37.0 37.0 33.0 37.0 40-41 35.882625000000004 37.0 37.0 37.0 35.0 37.0 42-43 35.848124999999996 37.0 37.0 37.0 35.0 37.0 44-45 35.89175 37.0 37.0 37.0 33.0 37.0 46-47 35.7645 37.0 37.0 37.0 33.0 37.0 48-49 35.67775 37.0 37.0 37.0 33.0 37.0 50-51 35.657875000000004 37.0 37.0 37.0 33.0 37.0 52-53 35.58825 37.0 37.0 37.0 33.0 37.0 54-55 35.66825 37.0 37.0 37.0 33.0 37.0 56-57 35.7365 37.0 37.0 37.0 33.0 37.0 58-59 35.654250000000005 37.0 37.0 37.0 33.0 37.0 60-61 35.538875000000004 37.0 37.0 37.0 33.0 37.0 62-63 35.610749999999996 37.0 37.0 37.0 33.0 37.0 64-65 35.460125000000005 37.0 37.0 37.0 33.0 37.0 66-67 35.387125 37.0 37.0 37.0 33.0 37.0 68-69 35.489625000000004 37.0 37.0 37.0 33.0 37.0 70-71 35.47725 37.0 37.0 37.0 33.0 37.0 72-73 35.438375 37.0 37.0 37.0 33.0 37.0 74-75 35.37475 37.0 37.0 37.0 33.0 37.0 76-77 35.357875 37.0 37.0 37.0 33.0 37.0 78-79 35.217875 37.0 37.0 37.0 33.0 37.0 80-81 35.244249999999994 37.0 37.0 37.0 33.0 37.0 82-83 35.199749999999995 37.0 37.0 37.0 33.0 37.0 84-85 34.929375 37.0 37.0 37.0 30.0 37.0 86-87 34.783875 37.0 37.0 37.0 27.0 37.0 88-89 34.819625 37.0 37.0 37.0 27.0 37.0 90-91 34.760000000000005 37.0 37.0 37.0 30.0 37.0 92-93 34.45125 37.0 37.0 37.0 27.0 37.0 94-95 34.612624999999994 37.0 37.0 37.0 27.0 37.0 96-97 34.439625 37.0 37.0 37.0 27.0 37.0 98-99 34.328500000000005 37.0 37.0 37.0 27.0 37.0 100-101 33.926625 37.0 37.0 37.0 27.0 37.0 102-103 33.928875000000005 37.0 37.0 37.0 27.0 37.0 104-105 34.007625 37.0 37.0 37.0 27.0 37.0 106-107 33.634625 37.0 37.0 37.0 22.0 37.0 108-109 33.669 37.0 37.0 37.0 22.0 37.0 110-111 33.43837499999999 37.0 37.0 37.0 22.0 37.0 112-113 33.2295 37.0 37.0 37.0 22.0 37.0 114-115 33.138999999999996 37.0 35.0 37.0 22.0 37.0 116-117 32.939 37.0 35.0 37.0 18.0 37.0 118-119 32.50325 37.0 33.0 37.0 14.0 37.0 120-121 32.242875 37.0 33.0 37.0 14.0 37.0 122-123 32.009875 37.0 33.0 37.0 14.0 37.0 124-125 31.014375 37.0 33.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 4.0 16 0.0 17 12.0 18 8.0 19 18.0 20 13.0 21 12.0 22 16.0 23 23.0 24 20.0 25 27.0 26 39.0 27 52.0 28 64.0 29 51.0 30 64.0 31 102.0 32 116.0 33 171.0 34 257.0 35 432.0 36 2498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.95 18.224999999999998 17.424999999999997 39.4 2 18.45 26.275 37.25 18.025 3 20.7 29.95 27.325 22.025 4 22.775000000000002 36.55 18.35 22.325 5 23.025000000000002 37.15 20.325 19.5 6 16.375 35.925000000000004 25.174999999999997 22.525000000000002 7 16.2 14.85 44.15 24.8 8 18.6 19.8 28.849999999999998 32.75 9 20.849999999999998 22.35 30.275000000000002 26.525 10-11 23.7 30.099999999999998 22.3875 23.8125 12-13 20.9875 24.9 29.7875 24.325 14-15 21.525 25.424999999999997 30.012499999999996 23.0375 16-17 23.1875 27.825 25.887500000000003 23.1 18-19 22.912499999999998 26.900000000000002 28.3125 21.875 20-21 23.0 28.012500000000003 26.7625 22.225 22-23 22.5875 27.8625 27.025 22.525000000000002 24-25 21.725 28.675 28.1625 21.4375 26-27 22.125 29.0875 26.6625 22.125 28-29 22.7625 28.299999999999997 26.974999999999998 21.9625 30-31 22.7125 27.800000000000004 27.125 22.3625 32-33 23.1875 27.800000000000004 26.9125 22.1 34-35 21.25 28.262500000000003 28.212500000000002 22.275 36-37 22.912499999999998 28.512500000000003 26.637499999999996 21.9375 38-39 22.3625 28.825 27.037499999999998 21.775 40-41 23.0875 28.7375 26.2875 21.8875 42-43 22.3125 28.749999999999996 26.674999999999997 22.2625 44-45 22.9375 28.249999999999996 26.55 22.2625 46-47 22.375 28.3125 26.875 22.4375 48-49 22.75 28.4 27.1625 21.6875 50-51 22.95 27.975 27.2625 21.8125 52-53 23.150000000000002 27.5125 26.825 22.5125 54-55 22.6125 27.8875 27.462500000000002 22.037499999999998 56-57 23.0125 27.575 27.5625 21.85 58-59 22.525000000000002 27.35 27.6875 22.4375 60-61 22.7625 27.437499999999996 27.250000000000004 22.55 62-63 22.775000000000002 27.700000000000003 27.0875 22.4375 64-65 23.1625 28.1375 27.150000000000002 21.55 66-67 22.900000000000002 27.975 26.8125 22.3125 68-69 22.662499999999998 28.275 27.250000000000004 21.8125 70-71 23.0625 28.299999999999997 27.3625 21.275 72-73 22.775000000000002 28.299999999999997 26.7625 22.162499999999998 74-75 23.125 28.599999999999998 26.9625 21.3125 76-77 23.75 27.537499999999998 27.275 21.4375 78-79 22.225 29.4125 26.6 21.762500000000003 80-81 23.0 28.5875 27.037499999999998 21.375 82-83 22.7625 28.675 26.900000000000002 21.6625 84-85 23.724999999999998 27.212500000000002 26.825 22.237499999999997 86-87 22.3875 28.625 26.8 22.1875 88-89 23.8625 28.8625 26.0375 21.2375 90-91 23.9125 27.625 27.224999999999998 21.2375 92-93 22.4375 28.762500000000003 27.200000000000003 21.6 94-95 23.974999999999998 28.012500000000003 26.275 21.7375 96-97 23.1875 27.1625 27.650000000000002 22.0 98-99 22.7125 28.625 26.887499999999996 21.775 100-101 22.662499999999998 28.1875 27.6875 21.462500000000002 102-103 23.474999999999998 27.275 28.499999999999996 20.75 104-105 23.2625 28.499999999999996 27.212500000000002 21.025 106-107 22.5 28.525 27.1375 21.837500000000002 108-109 23.3875 28.1125 26.1625 22.3375 110-111 23.7625 28.275 27.437499999999996 20.525 112-113 23.6625 27.575 26.900000000000002 21.8625 114-115 22.8 27.450000000000003 27.6375 22.112499999999997 116-117 22.7 28.375 27.224999999999998 21.7 118-119 23.95 27.8875 26.75 21.4125 120-121 23.0875 27.3875 27.3875 22.1375 122-123 22.95 28.1 26.6625 22.287499999999998 124-125 23.7875 27.212500000000002 26.650000000000002 22.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 1.5 25 2.0 26 4.0 27 7.0 28 7.0 29 6.5 30 10.0 31 17.5 32 27.5 33 37.0 34 44.5 35 55.0 36 70.5 37 95.0 38 122.5 39 138.5 40 163.5 41 208.5 42 242.0 43 255.0 44 269.0 45 276.5 46 273.5 47 261.0 48 226.5 49 209.0 50 192.5 51 148.5 52 122.0 53 103.0 54 75.5 55 54.0 56 45.0 57 38.5 58 35.5 59 33.0 60 23.5 61 20.0 62 17.0 63 11.5 64 10.0 65 9.5 66 7.5 67 5.5 68 4.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063184 spots for SRR13481183.sra Written 1063184 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra Read 1063182 spots for SRR13481183.sra Written 1063182 spots for SRR13481183.sra SRR ids: ['SRR13481183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ojk31t4u SRR13481183.sra spots: 21263642 blocks: [[1, 1063182], [1063183, 2126364], [2126365, 3189546], [3189547, 4252728], [4252729, 5315910], [5315911, 6379092], [6379093, 7442274], [7442275, 8505456], [8505457, 9568638], [9568639, 10631820], [10631821, 11695002], [11695003, 12758184], [12758185, 13821366], [13821367, 14884548], [14884549, 15947730], [15947731, 17010912], [17010913, 18074094], [18074095, 19137276], [19137277, 20200458], [20200459, 21263642]] SRR13481183 file size 6124821 SRR13481183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13481183 SRR13481183_1.fastq SRR13481183_2.fastq Input file: SRR13481183_1.fastq Paired file: SRR13481183_2.fastq trimmed: SRR13481183-trimmed-pair1.fastq, SRR13481183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:16:28 2025 >> started Tue Feb 11 22:16:48 2025 >> done (20.040s) 21263642 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 21263639 (100.00%) read pairs available; of these: 5576229 (26.22%) trimmed read pairs available after processing 15687410 (73.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 1 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 1 0.00% 58 0 0.00% 59 1 0.00% 60 2 0.00% 61 1 0.00% 62 2 0.00% 63 83 0.00% 64 142 0.00% 65 240 0.00% 66 245 0.00% 67 370 0.00% 68 403 0.00% 69 513 0.00% 70 610 0.00% 71 677 0.00% 72 843 0.00% 73 921 0.00% 74 1110 0.01% 75 1218 0.01% 76 1303 0.01% 77 1507 0.01% 78 1676 0.01% 79 1866 0.01% 80 2082 0.01% 81 2354 0.01% 82 2562 0.01% 83 2828 0.01% 84 3159 0.01% 85 3660 0.02% 86 3899 0.02% 87 4403 0.02% 88 4929 0.02% 89 5756 0.03% 90 6499 0.03% 91 7503 0.04% 92 8768 0.04% 93 11237 0.05% 94 23176 0.11% 95 23738 0.11% 96 24879 0.12% 97 26212 0.12% 98 27629 0.13% 99 28800 0.14% 100 30937 0.15% 101 32569 0.15% 102 33480 0.16% 103 35739 0.17% 104 37644 0.18% 105 39814 0.19% 106 42430 0.20% 107 45421 0.21% 108 48610 0.23% 109 53207 0.25% 110 57572 0.27% 111 62708 0.29% 112 69972 0.33% 113 78007 0.37% 114 87376 0.41% 115 102863 0.48% 116 113600 0.53% 117 132077 0.62% 118 160693 0.76% 119 196309 0.92% 120 251856 1.18% 121 341278 1.60% 122 492844 2.32% 123 831980 3.91% 124 1959422 9.21% 125 15687410 73.78% 21263639 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.6 sequence=GTGAAGTGGCCAGCCTTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=23.24 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=5.7 sequence=ACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCAC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=3.5 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=215.34 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=30.1 sequence=AAGAAGAAGAAA SRR13481183 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:17:58 Started mapping on | Feb 11 22:17:59 Finished on | Feb 11 22:19:01 Mapping speed, Million of reads per hour | 1234.66 Number of input reads | 21263639 Average input read length | 247 UNIQUE READS: Uniquely mapped reads number | 19313840 Uniquely mapped reads % | 90.83% Average mapped length | 246.25 Number of splices: Total | 12893143 Number of splices: Annotated (sjdb) | 12683722 Number of splices: GT/AG | 12701760 Number of splices: GC/AG | 151550 Number of splices: AT/AC | 13470 Number of splices: Non-canonical | 26363 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495633 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 159023 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.95% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1454463 1454463 1454463 N_multimapping 495633 495633 495633 N_noFeature 645770 18763791 977051 N_ambiguous 324701 3737 102691 UnstrandedReadsAssigned:18343369 PositiveStrandReadsAssigned:546312 NegativeStrandReadsAssigned:18234098 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13481183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13481183-trimmed-pair1.fastq SRR13481183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,263,639 reads, 18,499,451 reads pseudoaligned [quant] estimated average fragment length: 285.931 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR13481183.ke.tsv 34699 SRR13481183.se.tsv 87100 total ==> SRR13481183.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.07 974 34.7802 Potri.005G024800.1.v4.1 1035 750.069 135 11.1384 Potri.004G059700.1.v4.1 961 676.09 41 3.75292 Potri.007G009000.2.v4.1 1416 1131.07 0 0 Potri.003G141000.2.v4.1 2943 2658.07 308.199 7.17553 Potri.016G087400.1.v4.1 270 49.5701 483 602.999 Potri.015G069301.1.v4.1 564 283.585 0 0 Potri.010G195200.1.v4.1 1773 1488.07 50 2.07939 Potri.012G127500.1.v4.1 977 692.084 1800 160.954 ==> SRR13481183.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2697 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 139 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR13481183 completed mapping pipeline successfully