Starting /dee2/code/volunteer_pipeline.sh SRR13481184 current disk space = 3052284477440 free memory = 1570093900 SRR13481184 SRAfilesize b9b31d1618b0c434e3250911e49d8db9 SRR13481184.sra SRR13481184.sra file validated SRR13481184 is paired end SRR13481184 is conventional basespace SRR13481184 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50125 33.0 33.0 33.0 33.0 33.0 2 32.478 33.0 33.0 33.0 33.0 33.0 3 32.36775 33.0 33.0 33.0 33.0 33.0 4 32.43175 33.0 33.0 33.0 33.0 33.0 5 32.30125 33.0 33.0 33.0 33.0 33.0 6 35.92925 37.0 37.0 37.0 33.0 37.0 7 36.3055 37.0 37.0 37.0 37.0 37.0 8 36.445 37.0 37.0 37.0 37.0 37.0 9 36.443 37.0 37.0 37.0 37.0 37.0 10-11 36.4285 37.0 37.0 37.0 37.0 37.0 12-13 36.420375 37.0 37.0 37.0 37.0 37.0 14-15 36.40275 37.0 37.0 37.0 37.0 37.0 16-17 36.399 37.0 37.0 37.0 37.0 37.0 18-19 36.383625 37.0 37.0 37.0 37.0 37.0 20-21 36.39625 37.0 37.0 37.0 37.0 37.0 22-23 36.3645 37.0 37.0 37.0 37.0 37.0 24-25 36.35075 37.0 37.0 37.0 37.0 37.0 26-27 36.345124999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.30825 37.0 37.0 37.0 37.0 37.0 30-31 36.286249999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.30575 37.0 37.0 37.0 37.0 37.0 34-35 36.244625 37.0 37.0 37.0 37.0 37.0 36-37 36.235 37.0 37.0 37.0 37.0 37.0 38-39 36.12375 37.0 37.0 37.0 37.0 37.0 40-41 36.224375 37.0 37.0 37.0 37.0 37.0 42-43 36.13025 37.0 37.0 37.0 37.0 37.0 44-45 36.138 37.0 37.0 37.0 37.0 37.0 46-47 36.07575 37.0 37.0 37.0 37.0 37.0 48-49 36.061 37.0 37.0 37.0 37.0 37.0 50-51 36.0905 37.0 37.0 37.0 37.0 37.0 52-53 36.0325 37.0 37.0 37.0 37.0 37.0 54-55 35.954375 37.0 37.0 37.0 35.0 37.0 56-57 35.967375000000004 37.0 37.0 37.0 33.0 37.0 58-59 35.93325 37.0 37.0 37.0 35.0 37.0 60-61 35.887375 37.0 37.0 37.0 33.0 37.0 62-63 35.832625 37.0 37.0 37.0 33.0 37.0 64-65 35.81425 37.0 37.0 37.0 33.0 37.0 66-67 35.815 37.0 37.0 37.0 33.0 37.0 68-69 35.54600000000001 37.0 37.0 37.0 33.0 37.0 70-71 35.653 37.0 37.0 37.0 33.0 37.0 72-73 35.514250000000004 37.0 37.0 37.0 33.0 37.0 74-75 35.45025 37.0 37.0 37.0 33.0 37.0 76-77 35.321875 37.0 37.0 37.0 33.0 37.0 78-79 35.398125 37.0 37.0 37.0 33.0 37.0 80-81 35.221625 37.0 37.0 37.0 33.0 37.0 82-83 35.278625 37.0 37.0 37.0 33.0 37.0 84-85 35.23425 37.0 37.0 37.0 33.0 37.0 86-87 35.11725 37.0 37.0 37.0 33.0 37.0 88-89 34.92175 37.0 37.0 37.0 30.0 37.0 90-91 34.810625 37.0 37.0 37.0 27.0 37.0 92-93 34.780625 37.0 37.0 37.0 30.0 37.0 94-95 34.746375 37.0 37.0 37.0 30.0 37.0 96-97 34.59 37.0 37.0 37.0 27.0 37.0 98-99 34.38225 37.0 37.0 37.0 27.0 37.0 100-101 34.29375 37.0 37.0 37.0 27.0 37.0 102-103 34.242374999999996 37.0 37.0 37.0 27.0 37.0 104-105 34.06825 37.0 37.0 37.0 27.0 37.0 106-107 33.8515 37.0 37.0 37.0 24.5 37.0 108-109 33.651125 37.0 33.0 37.0 24.5 37.0 110-111 33.722125 37.0 35.0 37.0 27.0 37.0 112-113 33.307125 37.0 33.0 37.0 22.0 37.0 114-115 32.94025 37.0 33.0 37.0 18.0 37.0 116-117 32.953125 37.0 33.0 37.0 18.0 37.0 118-119 32.353 37.0 33.0 37.0 14.0 37.0 120-121 31.974624999999996 37.0 33.0 37.0 14.0 37.0 122-123 31.43725 37.0 33.0 37.0 14.0 37.0 124-125 30.395875 37.0 33.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 3.0 18 4.0 19 9.0 20 6.0 21 6.0 22 10.0 23 11.0 24 18.0 25 22.0 26 23.0 27 43.0 28 38.0 29 69.0 30 57.0 31 111.0 32 130.0 33 172.0 34 315.0 35 618.0 36 2330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.775 19.125 12.775 40.325 2 16.025 27.6 38.775 17.599999999999998 3 18.55 33.875 22.275 25.3 4 20.75 39.25 18.2 21.8 5 21.17410938283994 37.25539387857501 21.575514300050173 19.994982438534873 6 18.2 34.699999999999996 25.124999999999996 21.975 7 13.325000000000001 20.225 42.425000000000004 24.025 8 20.4 17.224999999999998 30.049999999999997 32.324999999999996 9 17.575 19.1 32.275 31.05 10-11 21.95 31.662499999999998 21.0125 25.374999999999996 12-13 18.587500000000002 25.3 30.7125 25.4 14-15 19.4875 25.95 30.162499999999998 24.4 16-17 20.0125 27.8375 28.1625 23.9875 18-19 21.337500000000002 28.075 26.937499999999996 23.65 20-21 20.4375 27.950000000000003 27.975 23.6375 22-23 20.5125 28.6125 28.1125 22.7625 24-25 19.85 29.625 26.9625 23.5625 26-27 20.25 28.299999999999997 28.1625 23.2875 28-29 20.4875 28.6875 27.1125 23.7125 30-31 20.7875 28.849999999999998 26.487500000000004 23.875 32-33 20.9 27.962500000000002 27.762500000000003 23.375 34-35 20.0 29.825000000000003 27.1625 23.0125 36-37 20.5625 27.987499999999997 28.299999999999997 23.150000000000002 38-39 21.349999999999998 27.125 28.037499999999998 23.4875 40-41 20.724999999999998 27.8125 27.8125 23.65 42-43 20.8625 27.6625 27.55 23.925 44-45 21.6875 27.3 27.4125 23.599999999999998 46-47 21.4375 27.9125 27.3375 23.3125 48-49 20.25 28.299999999999997 27.3125 24.1375 50-51 20.95 28.175 27.1 23.775 52-53 20.4625 29.425 27.5875 22.525000000000002 54-55 20.8625 27.825 27.450000000000003 23.8625 56-57 20.8125 28.225 27.0875 23.875 58-59 20.7625 28.325 27.825 23.0875 60-61 21.4125 27.975 27.8375 22.775000000000002 62-63 21.2625 27.125 27.8125 23.799999999999997 64-65 20.7625 28.025 27.6125 23.599999999999998 66-67 20.599999999999998 27.875 27.962500000000002 23.5625 68-69 21.712500000000002 26.125 29.1375 23.025000000000002 70-71 20.95 27.900000000000002 27.275 23.875 72-73 21.0125 28.487499999999997 27.762500000000003 22.7375 74-75 21.212500000000002 27.6 27.5875 23.599999999999998 76-77 21.2625 27.6 27.575 23.5625 78-79 20.625 27.175 28.0875 24.1125 80-81 20.225 28.050000000000004 28.1125 23.6125 82-83 20.962500000000002 27.787499999999998 27.750000000000004 23.5 84-85 21.212500000000002 26.987499999999997 28.499999999999996 23.3 86-87 20.625 26.674999999999997 28.6875 24.0125 88-89 21.1375 27.500000000000004 27.787499999999998 23.575 90-91 20.9 28.375 27.275 23.45 92-93 21.475 26.6625 28.212500000000002 23.65 94-95 21.224999999999998 27.212500000000002 28.849999999999998 22.7125 96-97 21.05 27.675 27.8125 23.4625 98-99 21.224999999999998 27.737499999999997 27.200000000000003 23.8375 100-101 21.349999999999998 28.212500000000002 27.1 23.3375 102-103 21.4125 27.462500000000002 26.375 24.75 104-105 21.2375 27.224999999999998 27.537499999999998 24.0 106-107 19.9875 28.7375 28.225 23.05 108-109 21.525 26.9625 27.224999999999998 24.2875 110-111 21.4125 27.487499999999997 28.325 22.775000000000002 112-113 21.637500000000003 27.037499999999998 27.700000000000003 23.625 114-115 20.625 27.625 27.9125 23.8375 116-117 21.0125 27.1 29.049999999999997 22.8375 118-119 21.675 27.800000000000004 27.6375 22.8875 120-121 20.4875 27.275 28.875 23.3625 122-123 20.8875 27.5625 27.85 23.7 124-125 21.4125 27.1375 27.750000000000004 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 2.5 23 4.0 24 3.5 25 3.5 26 5.0 27 9.0 28 11.5 29 15.5 30 24.0 31 31.0 32 39.0 33 47.5 34 49.0 35 60.0 36 87.5 37 106.5 38 133.0 39 159.5 40 171.0 41 191.5 42 210.0 43 246.0 44 260.0 45 251.0 46 254.0 47 248.5 48 229.5 49 207.0 50 195.0 51 162.0 52 113.0 53 92.0 54 78.0 55 53.5 56 43.0 57 36.0 58 26.5 59 22.0 60 21.0 61 16.0 62 15.5 63 15.5 64 12.0 65 10.5 66 6.0 67 4.0 68 4.5 69 3.5 70 3.5 71 2.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13481184 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.535 33.0 33.0 33.0 33.0 33.0 2 32.53375 33.0 33.0 33.0 33.0 33.0 3 32.471 33.0 33.0 33.0 33.0 33.0 4 32.58425 33.0 33.0 33.0 33.0 33.0 5 32.50325 33.0 33.0 33.0 33.0 33.0 6 36.0955 37.0 37.0 37.0 37.0 37.0 7 35.98225 37.0 37.0 37.0 37.0 37.0 8 36.172 37.0 37.0 37.0 37.0 37.0 9 36.251 37.0 37.0 37.0 37.0 37.0 10-11 36.144125 37.0 37.0 37.0 37.0 37.0 12-13 36.091 37.0 37.0 37.0 37.0 37.0 14-15 36.061875 37.0 37.0 37.0 37.0 37.0 16-17 36.163624999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.0695 37.0 37.0 37.0 37.0 37.0 20-21 36.137875 37.0 37.0 37.0 37.0 37.0 22-23 36.1285 37.0 37.0 37.0 37.0 37.0 24-25 36.006 37.0 37.0 37.0 37.0 37.0 26-27 36.05275 37.0 37.0 37.0 37.0 37.0 28-29 35.993 37.0 37.0 37.0 37.0 37.0 30-31 36.03375 37.0 37.0 37.0 37.0 37.0 32-33 36.017 37.0 37.0 37.0 37.0 37.0 34-35 35.965 37.0 37.0 37.0 37.0 37.0 36-37 35.977375 37.0 37.0 37.0 37.0 37.0 38-39 35.973 37.0 37.0 37.0 37.0 37.0 40-41 35.96825 37.0 37.0 37.0 37.0 37.0 42-43 35.898875000000004 37.0 37.0 37.0 37.0 37.0 44-45 35.797375 37.0 37.0 37.0 33.0 37.0 46-47 35.855999999999995 37.0 37.0 37.0 33.0 37.0 48-49 35.754374999999996 37.0 37.0 37.0 33.0 37.0 50-51 35.675375 37.0 37.0 37.0 33.0 37.0 52-53 35.747749999999996 37.0 37.0 37.0 33.0 37.0 54-55 35.797625 37.0 37.0 37.0 33.0 37.0 56-57 35.8315 37.0 37.0 37.0 33.0 37.0 58-59 35.706500000000005 37.0 37.0 37.0 33.0 37.0 60-61 35.6365 37.0 37.0 37.0 33.0 37.0 62-63 35.68075 37.0 37.0 37.0 33.0 37.0 64-65 35.635 37.0 37.0 37.0 33.0 37.0 66-67 35.631874999999994 37.0 37.0 37.0 33.0 37.0 68-69 35.576 37.0 37.0 37.0 33.0 37.0 70-71 35.427375 37.0 37.0 37.0 33.0 37.0 72-73 35.359875 37.0 37.0 37.0 33.0 37.0 74-75 35.383250000000004 37.0 37.0 37.0 33.0 37.0 76-77 35.173 37.0 37.0 37.0 33.0 37.0 78-79 35.261624999999995 37.0 37.0 37.0 33.0 37.0 80-81 35.130624999999995 37.0 37.0 37.0 33.0 37.0 82-83 35.101625 37.0 37.0 37.0 33.0 37.0 84-85 35.00575 37.0 37.0 37.0 33.0 37.0 86-87 34.839 37.0 37.0 37.0 30.0 37.0 88-89 34.735875 37.0 37.0 37.0 27.0 37.0 90-91 34.67 37.0 37.0 37.0 27.0 37.0 92-93 34.644375 37.0 37.0 37.0 27.0 37.0 94-95 34.18125 37.0 37.0 37.0 27.0 37.0 96-97 34.315 37.0 37.0 37.0 27.0 37.0 98-99 34.21575 37.0 37.0 37.0 27.0 37.0 100-101 34.070750000000004 37.0 37.0 37.0 27.0 37.0 102-103 33.690124999999995 37.0 35.0 37.0 24.5 37.0 104-105 33.61425 37.0 37.0 37.0 22.0 37.0 106-107 33.481750000000005 37.0 33.0 37.0 22.0 37.0 108-109 32.939750000000004 37.0 33.0 37.0 18.0 37.0 110-111 32.711 37.0 33.0 37.0 18.0 37.0 112-113 32.364999999999995 37.0 33.0 37.0 14.0 37.0 114-115 32.3405 37.0 33.0 37.0 14.0 37.0 116-117 32.146875 37.0 33.0 37.0 14.0 37.0 118-119 31.69775 37.0 33.0 37.0 14.0 37.0 120-121 31.4755 37.0 33.0 37.0 14.0 37.0 122-123 30.806874999999998 37.0 33.0 37.0 2.0 37.0 124-125 29.70775 37.0 33.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 7.0 15 4.0 16 4.0 17 8.0 18 9.0 19 11.0 20 14.0 21 18.0 22 16.0 23 32.0 24 29.0 25 27.0 26 27.0 27 46.0 28 48.0 29 64.0 30 77.0 31 91.0 32 131.0 33 168.0 34 252.0 35 522.0 36 2395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.48774387193597 18.48424212106053 16.908454227113555 39.11955977988995 2 17.724999999999998 26.8 38.1 17.375 3 20.525 29.025000000000002 27.675 22.775000000000002 4 22.225 35.675000000000004 20.325 21.775 5 23.150000000000002 35.85 20.65 20.349999999999998 6 16.75 36.1 24.45 22.7 7 16.85 14.549999999999999 42.85 25.75 8 19.475 19.650000000000002 27.55 33.324999999999996 9 19.400000000000002 22.725 29.75 28.125 10-11 23.2875 30.125 22.725 23.8625 12-13 21.5 23.825 30.4875 24.1875 14-15 21.3875 25.924999999999997 30.0875 22.6 16-17 23.05 26.85 27.425 22.675 18-19 22.6125 27.725 27.05 22.6125 20-21 22.55 29.4 25.75 22.3 22-23 22.2 28.95 26.6125 22.237499999999997 24-25 22.55 28.0875 27.212500000000002 22.15 26-27 22.650000000000002 28.199999999999996 26.5625 22.5875 28-29 22.9625 28.012500000000003 26.474999999999998 22.55 30-31 22.650000000000002 27.525 27.437499999999996 22.3875 32-33 22.9375 28.65 27.35 21.0625 34-35 23.0875 27.750000000000004 27.1375 22.025 36-37 22.85 26.724999999999998 28.15 22.275 38-39 23.3 28.4125 26.325 21.9625 40-41 23.05 28.050000000000004 27.1 21.8 42-43 22.55 27.750000000000004 27.400000000000002 22.3 44-45 22.6375 28.375 27.287499999999998 21.7 46-47 23.1625 28.0875 26.9625 21.7875 48-49 24.3125 27.037499999999998 26.950000000000003 21.7 50-51 23.0 26.887499999999996 27.4125 22.7 52-53 23.35 27.925 26.4625 22.2625 54-55 23.474999999999998 28.349999999999998 26.737499999999997 21.4375 56-57 23.25 28.037499999999998 26.237500000000004 22.475 58-59 22.8625 27.975 27.150000000000002 22.0125 60-61 21.975 28.449999999999996 27.5125 22.0625 62-63 22.912499999999998 28.212500000000002 26.487500000000004 22.3875 64-65 23.3875 28.1 27.05 21.462500000000002 66-67 22.6375 28.525 26.224999999999998 22.6125 68-69 23.75 27.275 27.1 21.875 70-71 22.825 27.6375 27.150000000000002 22.3875 72-73 23.375 27.200000000000003 27.6625 21.762500000000003 74-75 23.0625 28.212500000000002 27.037499999999998 21.6875 76-77 23.8125 27.875 27.0125 21.3 78-79 23.150000000000002 27.075 27.6375 22.1375 80-81 23.150000000000002 27.625 27.400000000000002 21.825 82-83 22.650000000000002 28.1375 27.474999999999998 21.7375 84-85 22.9375 28.4375 27.375 21.25 86-87 24.0375 28.1 26.075 21.7875 88-89 22.9875 27.950000000000003 27.1125 21.95 90-91 22.8625 27.287499999999998 27.500000000000004 22.35 92-93 24.45 27.4125 26.400000000000002 21.7375 94-95 22.6375 27.6875 27.5625 22.112499999999997 96-97 23.1625 27.6 27.187499999999996 22.05 98-99 22.95 27.825 27.224999999999998 22.0 100-101 23.5375 27.450000000000003 27.55 21.462500000000002 102-103 23.549999999999997 28.0625 26.825 21.5625 104-105 22.725 28.225 26.937499999999996 22.112499999999997 106-107 23.525 28.225 26.625 21.625 108-109 23.08756919979869 27.56668344237544 26.49723200805234 22.84851534977353 110-111 23.175 28.537499999999998 26.387500000000003 21.9 112-113 23.549999999999997 27.712500000000002 26.687499999999996 22.05 114-115 23.875 28.349999999999998 26.450000000000003 21.325 116-117 23.1125 27.825 26.787499999999998 22.275 118-119 23.6625 27.962500000000002 26.6125 21.762500000000003 120-121 23.75 27.1375 27.8875 21.224999999999998 122-123 22.787499999999998 27.962500000000002 27.8125 21.4375 124-125 23.6625 26.775 28.349999999999998 21.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 3.0 28 4.0 29 10.5 30 14.0 31 16.5 32 20.0 33 24.5 34 32.5 35 44.5 36 64.0 37 95.0 38 114.5 39 133.0 40 182.0 41 216.0 42 236.0 43 263.5 44 261.0 45 268.5 46 280.0 47 275.0 48 253.5 49 207.0 50 170.5 51 148.0 52 124.5 53 97.5 54 78.0 55 66.5 56 59.5 57 49.0 58 45.5 59 38.5 60 20.5 61 13.5 62 16.0 63 14.0 64 9.0 65 5.0 66 4.0 67 5.0 68 3.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.65 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra Read 1015311 spots for SRR13481184.sra Written 1015311 spots for SRR13481184.sra Read 1015296 spots for SRR13481184.sra Written 1015296 spots for SRR13481184.sra SRR ids: ['SRR13481184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmy97dzn SRR13481184.sra spots: 20305935 blocks: [[1, 1015296], [1015297, 2030592], [2030593, 3045888], [3045889, 4061184], [4061185, 5076480], [5076481, 6091776], [6091777, 7107072], [7107073, 8122368], [8122369, 9137664], [9137665, 10152960], [10152961, 11168256], [11168257, 12183552], [12183553, 13198848], [13198849, 14214144], [14214145, 15229440], [15229441, 16244736], [16244737, 17260032], [17260033, 18275328], [18275329, 19290624], [19290625, 20305935]] SRR13481184 file size 5847983 SRR13481184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13481184 SRR13481184_1.fastq SRR13481184_2.fastq Input file: SRR13481184_1.fastq Paired file: SRR13481184_2.fastq trimmed: SRR13481184-trimmed-pair1.fastq, SRR13481184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:31:21 2025 >> started Tue Feb 11 22:31:40 2025 >> done (18.937s) 20305935 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 20305932 (100.00%) read pairs available; of these: 5499693 (27.08%) trimmed read pairs available after processing 14806239 (72.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 3 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 1 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 2 0.00% 58 0 0.00% 59 1 0.00% 60 2 0.00% 61 1 0.00% 62 1 0.00% 63 69 0.00% 64 160 0.00% 65 222 0.00% 66 275 0.00% 67 371 0.00% 68 443 0.00% 69 580 0.00% 70 695 0.00% 71 781 0.00% 72 815 0.00% 73 1088 0.01% 74 1052 0.01% 75 1323 0.01% 76 1432 0.01% 77 1510 0.01% 78 1810 0.01% 79 1987 0.01% 80 2162 0.01% 81 2390 0.01% 82 2680 0.01% 83 2988 0.01% 84 3360 0.02% 85 3703 0.02% 86 4110 0.02% 87 4508 0.02% 88 5276 0.03% 89 6062 0.03% 90 6813 0.03% 91 7896 0.04% 92 9207 0.05% 93 11547 0.06% 94 23010 0.11% 95 24146 0.12% 96 25137 0.12% 97 26725 0.13% 98 27935 0.14% 99 29048 0.14% 100 30744 0.15% 101 32586 0.16% 102 33492 0.16% 103 35713 0.18% 104 37696 0.19% 105 39875 0.20% 106 42468 0.21% 107 44937 0.22% 108 48817 0.24% 109 52784 0.26% 110 57430 0.28% 111 62831 0.31% 112 69707 0.34% 113 77404 0.38% 114 87202 0.43% 115 100429 0.49% 116 113605 0.56% 117 132070 0.65% 118 159047 0.78% 119 195371 0.96% 120 250638 1.23% 121 336014 1.65% 122 487547 2.40% 123 815320 4.02% 124 1912629 9.42% 125 14806239 72.92% 20305932 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=26 prefix-density=0.21 prefix-fanout=2.5 sequence=GTGAAGTGGCCAGCCTTCT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=36.07 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=8.3 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.47 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=3.5 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=39.96 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.7 sequence=ACAAGATTGAGGAGACTCTGAACATTGGAGGCAAGAAAGATGAGCGCAAGGGTGAGACACAAGGTGGGTACAACCAACA SRR13481184 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:32:16 Started mapping on | Feb 11 22:32:16 Finished on | Feb 11 22:33:16 Mapping speed, Million of reads per hour | 1218.36 Number of input reads | 20305932 Average input read length | 246 UNIQUE READS: Uniquely mapped reads number | 18461543 Uniquely mapped reads % | 90.92% Average mapped length | 246.12 Number of splices: Total | 12311277 Number of splices: Annotated (sjdb) | 12110831 Number of splices: GT/AG | 12127468 Number of splices: GC/AG | 145493 Number of splices: AT/AC | 13008 Number of splices: Non-canonical | 25308 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474880 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 152299 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.85% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1369792 1369792 1369792 N_multimapping 474880 474880 474880 N_noFeature 617771 17935451 935135 N_ambiguous 309824 3614 98023 UnstrandedReadsAssigned:17533948 PositiveStrandReadsAssigned:522478 NegativeStrandReadsAssigned:17428385 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13481184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13481184-trimmed-pair1.fastq SRR13481184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,305,932 reads, 17,682,002 reads pseudoaligned [quant] estimated average fragment length: 284.939 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR13481184.ke.tsv 34699 SRR13481184.se.tsv 87100 total ==> SRR13481184.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.06 944 35.2794 Potri.005G024800.1.v4.1 1035 751.061 116 10.0091 Potri.004G059700.1.v4.1 961 677.081 44 4.2114 Potri.007G009000.2.v4.1 1416 1132.06 0 0 Potri.003G141000.2.v4.1 2943 2659.06 335.152 8.16821 Potri.016G087400.1.v4.1 270 49.6292 451 588.915 Potri.015G069301.1.v4.1 564 284.511 0 0 Potri.010G195200.1.v4.1 1773 1489.06 51 2.21958 Potri.012G127500.1.v4.1 977 693.076 1766 165.129 ==> SRR13481184.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2517 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 143 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13481184 completed mapping pipeline successfully