Starting /dee2/code/volunteer_pipeline.sh SRR13481185 current disk space = 3052504121344 free memory = 1576712412 SRR13481185 SRAfilesize f482ae96a35ec2a97474697d845e1ed8 SRR13481185.sra SRR13481185.sra file validated SRR13481185 is paired end SRR13481185 is conventional basespace SRR13481185 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1145 33.0 33.0 33.0 33.0 33.0 2 32.37175 33.0 33.0 33.0 33.0 33.0 3 32.46625 33.0 33.0 33.0 33.0 33.0 4 32.46925 33.0 33.0 33.0 33.0 33.0 5 32.45625 33.0 33.0 33.0 33.0 33.0 6 36.142 37.0 37.0 37.0 33.0 37.0 7 36.265 37.0 37.0 37.0 37.0 37.0 8 36.30725 37.0 37.0 37.0 37.0 37.0 9 36.329 37.0 37.0 37.0 37.0 37.0 10-11 36.332499999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.401250000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.297875000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.28125 37.0 37.0 37.0 37.0 37.0 18-19 36.253125 37.0 37.0 37.0 37.0 37.0 20-21 36.18675 37.0 37.0 37.0 37.0 37.0 22-23 36.136375 37.0 37.0 37.0 37.0 37.0 24-25 36.19225 37.0 37.0 37.0 37.0 37.0 26-27 36.129625000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.18075 37.0 37.0 37.0 37.0 37.0 30-31 36.25625 37.0 37.0 37.0 37.0 37.0 32-33 36.203500000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.187 37.0 37.0 37.0 37.0 37.0 36-37 36.06825 37.0 37.0 37.0 37.0 37.0 38-39 35.912375 37.0 37.0 37.0 35.0 37.0 40-41 36.0835 37.0 37.0 37.0 37.0 37.0 42-43 35.930125000000004 37.0 37.0 37.0 35.0 37.0 44-45 35.865875 37.0 37.0 37.0 35.0 37.0 46-47 35.983875 37.0 37.0 37.0 35.0 37.0 48-49 36.008 37.0 37.0 37.0 37.0 37.0 50-51 35.969 37.0 37.0 37.0 35.0 37.0 52-53 35.855125 37.0 37.0 37.0 33.0 37.0 54-55 35.854375000000005 37.0 37.0 37.0 33.0 37.0 56-57 35.45025 37.0 37.0 37.0 33.0 37.0 58-59 35.48375 37.0 37.0 37.0 33.0 37.0 60-61 35.411625 37.0 37.0 37.0 33.0 37.0 62-63 35.48375 37.0 37.0 37.0 33.0 37.0 64-65 35.461 37.0 37.0 37.0 33.0 37.0 66-67 35.593999999999994 37.0 37.0 37.0 33.0 37.0 68-69 35.247125 37.0 37.0 37.0 33.0 37.0 70-71 35.205125 37.0 37.0 37.0 33.0 37.0 72-73 35.237875 37.0 37.0 37.0 33.0 37.0 74-75 35.17325 37.0 37.0 37.0 33.0 37.0 76-77 35.193875000000006 37.0 37.0 37.0 33.0 37.0 78-79 35.044 37.0 37.0 37.0 33.0 37.0 80-81 35.167500000000004 37.0 37.0 37.0 33.0 37.0 82-83 34.96425 37.0 37.0 37.0 30.0 37.0 84-85 34.937875 37.0 37.0 37.0 30.0 37.0 86-87 34.74875 37.0 37.0 37.0 27.0 37.0 88-89 34.564375 37.0 37.0 37.0 27.0 37.0 90-91 34.732875 37.0 37.0 37.0 27.0 37.0 92-93 34.347375 37.0 37.0 37.0 27.0 37.0 94-95 34.0305 37.0 37.0 37.0 27.0 37.0 96-97 34.182 37.0 37.0 37.0 27.0 37.0 98-99 33.728375 37.0 35.0 37.0 24.5 37.0 100-101 33.7455 37.0 35.0 37.0 27.0 37.0 102-103 33.164500000000004 37.0 33.0 37.0 18.0 37.0 104-105 32.729375000000005 37.0 33.0 37.0 14.0 37.0 106-107 32.82625 37.0 33.0 37.0 14.0 37.0 108-109 32.597624999999994 37.0 33.0 37.0 14.0 37.0 110-111 32.25675 37.0 33.0 37.0 14.0 37.0 112-113 32.04575 37.0 33.0 37.0 14.0 37.0 114-115 31.529125 37.0 33.0 37.0 14.0 37.0 116-117 31.314875 37.0 33.0 37.0 14.0 37.0 118-119 30.982374999999998 37.0 30.0 37.0 14.0 37.0 120-121 30.162374999999997 37.0 27.0 37.0 2.0 37.0 122-123 29.247124999999997 37.0 27.0 37.0 2.0 37.0 124-125 28.039375 37.0 27.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 2.0 16 2.0 17 0.0 18 7.0 19 7.0 20 15.0 21 10.0 22 19.0 23 20.0 24 17.0 25 31.0 26 41.0 27 48.0 28 62.0 29 78.0 30 89.0 31 125.0 32 164.0 33 240.0 34 346.0 35 658.0 36 2014.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.966574516210102 19.90449861774315 12.917818547373711 40.211108318673034 2 16.075 27.200000000000003 37.8 18.925 3 17.825 34.025 23.275000000000002 24.875 4 21.45 39.2 17.599999999999998 21.75 5 23.967975981986488 36.177132849637225 21.46609957468101 18.388791593695274 6 17.175 34.775 24.825 23.225 7 13.55 18.75 44.4 23.3 8 19.725 18.35 29.5 32.425 9 17.65 19.475 31.1 31.775 10-11 21.525 31.912499999999998 21.725 24.837500000000002 12-13 19.1 24.337500000000002 30.9625 25.6 14-15 20.025000000000002 27.025 29.599999999999998 23.35 16-17 21.087500000000002 27.737499999999997 27.750000000000004 23.425 18-19 21.587500000000002 28.125 27.575 22.7125 20-21 20.3375 27.4125 29.349999999999998 22.900000000000002 22-23 21.025 27.775 28.425 22.775000000000002 24-25 21.0625 28.0875 27.3125 23.5375 26-27 20.150000000000002 28.325 28.4125 23.1125 28-29 21.075 28.575 27.4125 22.9375 30-31 21.65 27.3125 27.0125 24.025 32-33 21.3125 27.762500000000003 28.075 22.85 34-35 20.8875 28.375 27.6 23.1375 36-37 20.837500000000002 28.7375 27.800000000000004 22.625 38-39 20.9875 28.499999999999996 26.737499999999997 23.775 40-41 21.15 29.175 27.0 22.675 42-43 20.775 28.487499999999997 27.762500000000003 22.975 44-45 20.5125 28.15 27.787499999999998 23.549999999999997 46-47 21.1375 28.000000000000004 28.237499999999997 22.625 48-49 20.925 27.8375 27.8125 23.425 50-51 21.675 27.287499999999998 27.950000000000003 23.0875 52-53 21.1125 29.5875 26.5 22.8 54-55 21.025 28.3375 27.025 23.6125 56-57 20.8625 27.525 28.175 23.4375 58-59 21.5625 28.462500000000002 27.3375 22.6375 60-61 20.3625 27.950000000000003 27.725 23.962500000000002 62-63 21.575 26.825 28.6375 22.9625 64-65 20.8 28.449999999999996 27.925 22.825 66-67 21.85 28.050000000000004 26.3125 23.7875 68-69 20.775 28.775000000000002 26.85 23.599999999999998 70-71 21.099999999999998 28.849999999999998 26.85 23.200000000000003 72-73 21.1375 28.349999999999998 27.55 22.9625 74-75 20.3375 27.462500000000002 28.9 23.3 76-77 21.2875 28.000000000000004 27.55 23.1625 78-79 21.075 28.000000000000004 27.5125 23.4125 80-81 21.1375 27.625 27.212500000000002 24.025 82-83 21.1625 28.6625 27.3375 22.8375 84-85 21.2625 28.4 27.6625 22.675 86-87 21.25 27.3 28.1 23.35 88-89 20.95 28.375 27.175 23.5 90-91 20.2875 28.875 27.6875 23.150000000000002 92-93 21.3 27.0625 27.150000000000002 24.4875 94-95 20.974999999999998 28.237499999999997 28.299999999999997 22.4875 96-97 21.3 28.075 26.900000000000002 23.724999999999998 98-99 20.4375 29.1875 27.1625 23.2125 100-101 21.45 27.400000000000002 27.85 23.3 102-103 21.0 27.950000000000003 27.187499999999996 23.8625 104-105 20.25 28.0625 28.1625 23.525 106-107 21.1875 27.6125 27.900000000000002 23.3 108-109 21.4875 28.3875 26.7625 23.3625 110-111 22.075 27.962500000000002 27.1125 22.85 112-113 20.7625 28.4125 27.35 23.474999999999998 114-115 21.5 27.075 27.125 24.3 116-117 21.1625 27.712500000000002 28.3625 22.7625 118-119 22.400000000000002 27.800000000000004 27.6875 22.112499999999997 120-121 20.7125 28.037499999999998 27.474999999999998 23.775 122-123 21.45 26.8625 27.875 23.8125 124-125 21.5 28.3625 26.9625 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.0 23 1.5 24 2.5 25 4.0 26 4.5 27 8.5 28 13.5 29 12.5 30 18.0 31 31.5 32 35.0 33 38.5 34 59.0 35 73.5 36 85.5 37 114.0 38 141.5 39 158.0 40 183.5 41 201.5 42 216.0 43 246.0 44 257.5 45 275.5 46 272.0 47 243.5 48 223.0 49 202.0 50 171.5 51 136.0 52 107.0 53 79.5 54 74.5 55 63.0 56 44.5 57 36.0 58 29.5 59 23.5 60 20.0 61 16.0 62 17.0 63 17.0 64 11.0 65 6.5 66 4.0 67 5.5 68 4.5 69 3.5 70 2.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGCAC 15 2.5068579E-4 119.0 5 AAATGCA 20 7.8725006E-4 89.24999 4 TCTCCTC 25 0.0019097715 71.4 7 >>END_MODULE SRR13481185 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13481185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3285 33.0 33.0 33.0 33.0 33.0 2 32.26 33.0 33.0 33.0 33.0 33.0 3 32.4385 33.0 33.0 33.0 33.0 33.0 4 32.472 33.0 33.0 33.0 33.0 33.0 5 32.431 33.0 33.0 33.0 33.0 33.0 6 36.0715 37.0 37.0 37.0 37.0 37.0 7 36.02725 37.0 37.0 37.0 37.0 37.0 8 36.165 37.0 37.0 37.0 37.0 37.0 9 36.0475 37.0 37.0 37.0 37.0 37.0 10-11 36.076750000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.088750000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.966375 37.0 37.0 37.0 37.0 37.0 16-17 35.974875 37.0 37.0 37.0 37.0 37.0 18-19 35.944625 37.0 37.0 37.0 37.0 37.0 20-21 36.013999999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.007625000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.94625 37.0 37.0 37.0 37.0 37.0 26-27 35.82875 37.0 37.0 37.0 33.0 37.0 28-29 35.929874999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.817375 37.0 37.0 37.0 35.0 37.0 32-33 35.806625 37.0 37.0 37.0 35.0 37.0 34-35 35.85875 37.0 37.0 37.0 33.0 37.0 36-37 35.780625 37.0 37.0 37.0 33.0 37.0 38-39 35.775375 37.0 37.0 37.0 33.0 37.0 40-41 35.833875 37.0 37.0 37.0 33.0 37.0 42-43 35.669624999999996 37.0 37.0 37.0 33.0 37.0 44-45 35.672875 37.0 37.0 37.0 33.0 37.0 46-47 35.564375 37.0 37.0 37.0 33.0 37.0 48-49 35.486 37.0 37.0 37.0 33.0 37.0 50-51 35.402249999999995 37.0 37.0 37.0 33.0 37.0 52-53 35.41 37.0 37.0 37.0 33.0 37.0 54-55 35.449875 37.0 37.0 37.0 33.0 37.0 56-57 35.53575 37.0 37.0 37.0 33.0 37.0 58-59 35.47675 37.0 37.0 37.0 33.0 37.0 60-61 35.311375 37.0 37.0 37.0 33.0 37.0 62-63 35.39925 37.0 37.0 37.0 33.0 37.0 64-65 35.19125 37.0 37.0 37.0 33.0 37.0 66-67 35.25075 37.0 37.0 37.0 33.0 37.0 68-69 35.192125000000004 37.0 37.0 37.0 33.0 37.0 70-71 34.967 37.0 37.0 37.0 27.0 37.0 72-73 34.837 37.0 37.0 37.0 27.0 37.0 74-75 34.707499999999996 37.0 37.0 37.0 27.0 37.0 76-77 34.637 37.0 37.0 37.0 27.0 37.0 78-79 34.577125 37.0 37.0 37.0 27.0 37.0 80-81 34.59875 37.0 37.0 37.0 27.0 37.0 82-83 34.42625 37.0 37.0 37.0 27.0 37.0 84-85 34.28 37.0 37.0 37.0 27.0 37.0 86-87 34.068 37.0 37.0 37.0 27.0 37.0 88-89 33.927625 37.0 37.0 37.0 27.0 37.0 90-91 33.645125 37.0 35.0 37.0 24.5 37.0 92-93 33.47425 37.0 33.0 37.0 22.0 37.0 94-95 33.29425 37.0 33.0 37.0 22.0 37.0 96-97 33.00512500000001 37.0 33.0 37.0 22.0 37.0 98-99 32.396249999999995 37.0 33.0 37.0 14.0 37.0 100-101 32.5385 37.0 33.0 37.0 14.0 37.0 102-103 32.067 37.0 33.0 37.0 14.0 37.0 104-105 31.722125 37.0 33.0 37.0 14.0 37.0 106-107 31.23975 37.0 30.0 37.0 14.0 37.0 108-109 30.510375 37.0 27.0 37.0 14.0 37.0 110-111 30.225375 37.0 27.0 37.0 14.0 37.0 112-113 30.2035 37.0 27.0 37.0 14.0 37.0 114-115 30.222625 37.0 27.0 37.0 8.0 37.0 116-117 29.77025 37.0 27.0 37.0 2.0 37.0 118-119 29.240499999999997 37.0 27.0 37.0 2.0 37.0 120-121 28.7925 37.0 27.0 37.0 2.0 37.0 122-123 27.622 37.0 22.0 37.0 2.0 37.0 124-125 26.718 37.0 8.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 7.0 16 11.0 17 15.0 18 13.0 19 19.0 20 33.0 21 17.0 22 36.0 23 35.0 24 38.0 25 39.0 26 56.0 27 61.0 28 73.0 29 91.0 30 95.0 31 99.0 32 176.0 33 219.0 34 356.0 35 668.0 36 1836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.556639159789945 17.60440110027507 16.204051012753187 39.634908727181795 2 18.104526131532882 26.556639159789945 38.8097024256064 16.52913228307077 3 21.280320080020005 27.806951737934483 28.532133033258315 22.380595148787197 4 22.875 36.275 19.6 21.25 5 23.5 35.375 21.325 19.8 6 17.0 35.075 25.6 22.325 7 16.675 15.5 44.15 23.674999999999997 8 19.7 19.475 29.425 31.4 9 20.275000000000002 21.125 28.95 29.65 10-11 23.525 31.2 21.3875 23.8875 12-13 20.775 24.712500000000002 30.562499999999996 23.95 14-15 22.375 26.6 28.8875 22.1375 16-17 21.762500000000003 27.0875 28.237499999999997 22.912499999999998 18-19 21.9375 27.1 28.5875 22.375 20-21 23.225 27.487499999999997 27.800000000000004 21.4875 22-23 23.65 28.3125 26.174999999999997 21.8625 24-25 23.4125 27.975 27.975 20.6375 26-27 22.4375 27.237499999999997 27.8125 22.5125 28-29 23.0625 27.125 27.925 21.8875 30-31 21.7375 28.9375 27.950000000000003 21.375 32-33 22.825 28.3625 27.5125 21.3 34-35 23.2375 27.5875 27.150000000000002 22.025 36-37 22.8875 28.799999999999997 27.0875 21.224999999999998 38-39 23.150000000000002 27.474999999999998 27.474999999999998 21.9 40-41 22.662499999999998 27.700000000000003 27.474999999999998 22.162499999999998 42-43 22.7375 27.85 27.05 22.3625 44-45 22.8875 28.15 27.450000000000003 21.512500000000003 46-47 23.25 27.6375 27.075 22.037499999999998 48-49 22.725 27.9375 26.8 22.537499999999998 50-51 22.5625 27.825 27.325 22.287499999999998 52-53 23.3125 27.237499999999997 27.675 21.775 54-55 23.474999999999998 27.8375 27.450000000000003 21.2375 56-57 22.75 27.987499999999997 27.900000000000002 21.3625 58-59 23.3625 27.975 27.237499999999997 21.425 60-61 22.75 27.85 28.050000000000004 21.349999999999998 62-63 23.3125 27.287499999999998 27.800000000000004 21.6 64-65 23.4625 28.012500000000003 26.987499999999997 21.5375 66-67 22.6375 27.950000000000003 27.700000000000003 21.712500000000002 68-69 22.525000000000002 28.575 27.3125 21.587500000000002 70-71 22.900000000000002 27.650000000000002 27.1625 22.287499999999998 72-73 22.6 27.8125 27.3125 22.275 74-75 23.2625 27.55 27.025 22.162499999999998 76-77 23.150000000000002 27.325 27.762500000000003 21.762500000000003 78-79 24.837500000000002 27.250000000000004 27.525 20.3875 80-81 23.575 27.175 27.5625 21.6875 82-83 22.825 27.975 27.500000000000004 21.7 84-85 22.900000000000002 27.700000000000003 27.237499999999997 22.162499999999998 86-87 23.0 27.5625 27.275 22.162499999999998 88-89 22.650000000000002 27.1375 28.449999999999996 21.762500000000003 90-91 22.8875 27.5625 27.9375 21.6125 92-93 23.6375 27.4125 27.1625 21.7875 94-95 23.2125 27.6125 28.000000000000004 21.175 96-97 23.0 28.1375 27.487499999999997 21.375 98-99 23.1375 27.725 27.500000000000004 21.637500000000003 100-101 24.2 27.425 27.200000000000003 21.175 102-103 23.175 27.487499999999997 27.525 21.8125 104-105 22.6375 28.262500000000003 27.8125 21.2875 106-107 23.1125 28.425 27.3375 21.125 108-109 23.065231158961367 27.308423052564912 28.258391386953768 21.36795440151995 110-111 23.6875 27.474999999999998 26.737499999999997 22.1 112-113 23.8625 27.6875 27.224999999999998 21.224999999999998 114-115 23.4625 28.075 27.737499999999997 20.724999999999998 116-117 23.4875 27.237499999999997 26.6 22.675 118-119 23.8125 27.537499999999998 28.050000000000004 20.599999999999998 120-121 23.45 27.212500000000002 27.187499999999996 22.15 122-123 22.8625 28.675 26.7125 21.75 124-125 23.8875 27.025 27.775 21.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 2.0 25 3.0 26 2.5 27 1.5 28 3.5 29 5.5 30 7.0 31 7.5 32 20.0 33 32.5 34 41.0 35 52.0 36 71.5 37 100.0 38 124.5 39 147.0 40 178.0 41 217.0 42 243.5 43 263.0 44 278.5 45 273.5 46 270.0 47 273.0 48 249.0 49 197.0 50 170.5 51 156.5 52 131.5 53 104.0 54 77.5 55 62.5 56 42.0 57 34.5 58 33.5 59 28.5 60 22.5 61 14.5 62 9.5 63 11.5 64 10.0 65 5.0 66 3.0 67 2.5 68 2.5 69 1.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 1.3125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016750 spots for SRR13481185.sra Written 1016750 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra Read 1016744 spots for SRR13481185.sra Written 1016744 spots for SRR13481185.sra SRR ids: ['SRR13481185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rpfr6qu7 SRR13481185.sra spots: 20334886 blocks: [[1, 1016744], [1016745, 2033488], [2033489, 3050232], [3050233, 4066976], [4066977, 5083720], [5083721, 6100464], [6100465, 7117208], [7117209, 8133952], [8133953, 9150696], [9150697, 10167440], [10167441, 11184184], [11184185, 12200928], [12200929, 13217672], [13217673, 14234416], [14234417, 15251160], [15251161, 16267904], [16267905, 17284648], [17284649, 18301392], [18301393, 19318136], [19318137, 20334886]] SRR13481185 file size 5856352 SRR13481185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13481185 SRR13481185_1.fastq SRR13481185_2.fastq Input file: SRR13481185_1.fastq Paired file: SRR13481185_2.fastq trimmed: SRR13481185-trimmed-pair1.fastq, SRR13481185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:56:06 2025 >> started Tue Feb 11 22:56:26 2025 >> done (19.530s) 20334886 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 20334883 (100.00%) read pairs available; of these: 6044570 (29.73%) trimmed read pairs available after processing 14290313 (70.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 2 0.00% 37 1 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 1 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 1 0.00% 58 0 0.00% 59 0 0.00% 60 2 0.00% 61 1 0.00% 62 3 0.00% 63 84 0.00% 64 172 0.00% 65 244 0.00% 66 330 0.00% 67 420 0.00% 68 481 0.00% 69 615 0.00% 70 717 0.00% 71 865 0.00% 72 994 0.00% 73 1129 0.01% 74 1285 0.01% 75 1576 0.01% 76 1673 0.01% 77 1803 0.01% 78 2092 0.01% 79 2277 0.01% 80 2586 0.01% 81 2845 0.01% 82 3314 0.02% 83 3559 0.02% 84 3839 0.02% 85 4372 0.02% 86 4979 0.02% 87 5471 0.03% 88 6212 0.03% 89 7081 0.03% 90 8053 0.04% 91 9379 0.05% 92 10885 0.05% 93 13458 0.07% 94 25571 0.13% 95 26481 0.13% 96 27898 0.14% 97 29753 0.15% 98 31149 0.15% 99 33189 0.16% 100 34906 0.17% 101 37112 0.18% 102 38458 0.19% 103 40665 0.20% 104 43572 0.21% 105 45771 0.23% 106 49070 0.24% 107 52948 0.26% 108 57025 0.28% 109 61409 0.30% 110 67511 0.33% 111 74037 0.36% 112 82559 0.41% 113 90709 0.45% 114 103262 0.51% 115 117695 0.58% 116 133289 0.66% 117 154277 0.76% 118 181952 0.89% 119 224928 1.11% 120 283338 1.39% 121 370713 1.82% 122 534997 2.63% 123 882176 4.34% 124 2005339 9.86% 125 14290313 70.27% 20334883 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=2.6 sequence=GTGAAGTGGCCAGCCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=35.24 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=7.8 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.52 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=3.6 sequence=TTCCTCCATTGTACAAAAACGTTGTGCCAGTCACCTGCCGCGGCCCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=220.68 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR13481185 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:57:04 Started mapping on | Feb 11 22:57:05 Finished on | Feb 11 22:58:07 Mapping speed, Million of reads per hour | 1180.74 Number of input reads | 20334883 Average input read length | 246 UNIQUE READS: Uniquely mapped reads number | 18488200 Uniquely mapped reads % | 90.92% Average mapped length | 245.72 Number of splices: Total | 12317270 Number of splices: Annotated (sjdb) | 12116015 Number of splices: GT/AG | 12133953 Number of splices: GC/AG | 144997 Number of splices: AT/AC | 12969 Number of splices: Non-canonical | 25351 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 475989 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 151660 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.84% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1370980 1370980 1370980 N_multimapping 475989 475989 475989 N_noFeature 619910 17961604 937129 N_ambiguous 310951 3613 98402 UnstrandedReadsAssigned:17557339 PositiveStrandReadsAssigned:522983 NegativeStrandReadsAssigned:17452669 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR13481185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13481185-trimmed-pair1.fastq SRR13481185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,334,883 reads, 17,708,314 reads pseudoaligned [quant] estimated average fragment length: 285.202 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR13481185.ke.tsv 34699 SRR13481185.se.tsv 87100 total ==> SRR13481185.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.8 949 35.3744 Potri.005G024800.1.v4.1 1035 750.798 111 9.55479 Potri.004G059700.1.v4.1 961 676.822 42 4.01048 Potri.007G009000.2.v4.1 1416 1131.8 0 0 Potri.003G141000.2.v4.1 2943 2658.8 326.283 7.93105 Potri.016G087400.1.v4.1 270 49.3808 478 625.592 Potri.015G069301.1.v4.1 564 284.157 0 0 Potri.010G195200.1.v4.1 1773 1488.8 44 1.91002 Potri.012G127500.1.v4.1 977 692.81 1678 156.531 ==> SRR13481185.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2567 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 120 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR13481185 completed mapping pipeline successfully