Starting /dee2/code/volunteer_pipeline.sh SRR13695435 current disk space = 3049013096448 free memory = 1404277948 SRR13695435 SRAfilesize b7b910e9472e141759fe83e65abf2dac SRR13695435.sra SRR13695435.sra file validated SRR13695435 is paired end SRR13695435 is conventional basespace SRR13695435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13695435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.341 37.0 37.0 37.0 37.0 37.0 2 36.17 37.0 37.0 37.0 37.0 37.0 3 36.376 37.0 37.0 37.0 37.0 37.0 4 36.549 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.6285 37.0 37.0 37.0 37.0 37.0 7 36.516 37.0 37.0 37.0 37.0 37.0 8 36.5465 37.0 37.0 37.0 37.0 37.0 9 36.5215 37.0 37.0 37.0 37.0 37.0 10-14 36.567400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5396 37.0 37.0 37.0 37.0 37.0 20-24 36.459599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4476 37.0 37.0 37.0 37.0 37.0 30-34 36.4508 37.0 37.0 37.0 37.0 37.0 35-39 36.4285 37.0 37.0 37.0 37.0 37.0 40-44 36.418600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3713 37.0 37.0 37.0 37.0 37.0 50-54 36.3381 37.0 37.0 37.0 37.0 37.0 55-59 36.3745 37.0 37.0 37.0 37.0 37.0 60-64 36.31570000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3547 37.0 37.0 37.0 37.0 37.0 70-74 36.2741 37.0 37.0 37.0 37.0 37.0 75-79 36.3465 37.0 37.0 37.0 37.0 37.0 80-84 36.3644 37.0 37.0 37.0 37.0 37.0 85-89 36.215799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.193 37.0 37.0 37.0 37.0 37.0 95-99 36.1844 37.0 37.0 37.0 37.0 37.0 100-104 36.0937 37.0 37.0 37.0 37.0 37.0 105-109 36.1917 37.0 37.0 37.0 37.0 37.0 110-114 36.2242 37.0 37.0 37.0 37.0 37.0 115-119 36.2644 37.0 37.0 37.0 37.0 37.0 120-124 36.2303 37.0 37.0 37.0 37.0 37.0 125-129 36.1055 37.0 37.0 37.0 37.0 37.0 130-134 36.0732 37.0 37.0 37.0 37.0 37.0 135-139 35.9995 37.0 37.0 37.0 37.0 37.0 140-144 35.8275 37.0 37.0 37.0 37.0 37.0 145-149 35.695299999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.885999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 0.0 25 0.0 26 7.0 27 4.0 28 5.0 29 16.0 30 22.0 31 33.0 32 46.0 33 57.0 34 139.0 35 335.0 36 3105.0 37 228.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.5 14.149999999999999 5.5 28.849999999999998 2 20.490981963927858 13.827655310621243 36.122244488977955 29.559118236472948 3 17.675 22.400000000000002 28.7 31.225 4 22.725 29.675 22.975 24.625 5 23.150000000000002 32.65 24.224999999999998 19.975 6 20.05 34.300000000000004 24.375 21.275 7 14.249999999999998 25.924999999999997 42.0 17.825 8 16.975 24.85 33.900000000000006 24.275 9 18.4 24.349999999999998 32.375 24.875 10-14 20.175 29.165000000000003 27.58 23.080000000000002 15-19 19.655 28.205000000000002 28.04 24.099999999999998 20-24 20.085 28.115000000000002 27.755000000000003 24.044999999999998 25-29 20.025000000000002 27.77 28.46 23.745 30-34 19.919999999999998 28.605000000000004 27.450000000000003 24.025 35-39 19.29 29.080000000000002 27.605 24.025 40-44 20.41 29.005 27.08 23.505000000000003 45-49 19.665 27.79 28.525 24.02 50-54 20.51 28.660000000000004 27.57 23.26 55-59 19.54 28.365000000000002 28.355000000000004 23.74 60-64 20.255000000000003 28.544999999999998 27.26 23.94 65-69 20.044999999999998 28.725 27.575 23.655 70-74 20.26 28.01 27.689999999999998 24.04 75-79 20.13 28.249999999999996 27.925 23.695 80-84 20.380000000000003 28.125 27.505000000000003 23.990000000000002 85-89 20.305 28.455000000000002 27.74 23.5 90-94 20.505000000000003 29.01 27.175 23.31 95-99 20.57 28.34 27.485 23.605 100-104 20.985 28.634999999999998 27.025 23.355 105-109 20.79 28.29 27.275 23.645 110-114 20.615 28.610000000000003 27.865000000000002 22.91 115-119 21.19 27.860000000000003 27.810000000000002 23.14 120-124 21.42 27.750000000000004 27.195000000000004 23.635 125-129 20.945 27.529999999999998 27.755000000000003 23.77 130-134 20.835 28.599999999999998 26.979999999999997 23.585 135-139 21.425 27.99 27.115000000000002 23.47 140-144 21.285 27.534999999999997 27.474999999999998 23.705000000000002 145-149 20.76 28.22 27.215 23.805 150-151 20.525 28.1875 26.5125 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 2.0 24 2.5 25 2.5 26 5.5 27 9.5 28 9.5 29 9.0 30 15.0 31 20.0 32 34.5 33 53.5 34 66.0 35 81.5 36 93.0 37 106.5 38 130.5 39 154.5 40 164.5 41 199.5 42 247.5 43 252.5 44 254.0 45 262.0 46 270.5 47 262.5 48 226.5 49 188.5 50 172.5 51 151.5 52 118.0 53 106.0 54 77.5 55 50.5 56 52.5 57 42.0 58 25.0 59 21.5 60 13.5 61 7.5 62 8.5 63 6.5 64 4.0 65 2.5 66 1.5 67 3.0 68 1.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.375 #Duplication Level Percentage of deduplicated Percentage of total 1 87.75393419170243 76.67500000000001 2 10.50071530758226 18.35 3 1.4306151645207439 3.75 4 0.20028612303290413 0.7000000000000001 5 0.08583690987124463 0.375 6 0.028612303290414882 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 6 0.15 No Hit CAGCAACCAAATAAACCTAACTCCTCCAGCTACCACCTTCGGATTCACCC 5 0.125 No Hit GCCACATGTTGTGCACTGTCTTGGAAGGTCAGAATATAATGCACTTATTG 5 0.125 No Hit GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7125 0.0 0.0 0.0 0.0 132-133 3.025 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.7249999999999996 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014437955 24.166668 45-49 >>END_MODULE SRR13695435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13695435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05275 37.0 25.0 37.0 11.0 37.0 2 33.7205 37.0 37.0 37.0 25.0 37.0 3 34.456 37.0 37.0 37.0 25.0 37.0 4 34.5625 37.0 37.0 37.0 25.0 37.0 5 34.5875 37.0 37.0 37.0 25.0 37.0 6 34.596 37.0 37.0 37.0 25.0 37.0 7 34.8345 37.0 37.0 37.0 25.0 37.0 8 34.938 37.0 37.0 37.0 25.0 37.0 9 34.653 37.0 37.0 37.0 25.0 37.0 10-14 34.964299999999994 37.0 37.0 37.0 25.0 37.0 15-19 35.0101 37.0 37.0 37.0 25.0 37.0 20-24 34.8649 37.0 37.0 37.0 25.0 37.0 25-29 34.8902 37.0 37.0 37.0 25.0 37.0 30-34 34.941199999999995 37.0 37.0 37.0 25.0 37.0 35-39 34.7973 37.0 37.0 37.0 25.0 37.0 40-44 34.8152 37.0 37.0 37.0 25.0 37.0 45-49 34.9054 37.0 37.0 37.0 25.0 37.0 50-54 34.930899999999994 37.0 37.0 37.0 25.0 37.0 55-59 34.9433 37.0 37.0 37.0 27.4 37.0 60-64 35.015 37.0 37.0 37.0 25.0 37.0 65-69 35.1232 37.0 37.0 37.0 25.0 37.0 70-74 35.12230000000001 37.0 37.0 37.0 25.0 37.0 75-79 34.910999999999994 37.0 37.0 37.0 25.0 37.0 80-84 34.7779 37.0 37.0 37.0 25.0 37.0 85-89 34.362300000000005 37.0 37.0 37.0 25.0 37.0 90-94 34.3064 37.0 37.0 37.0 25.0 37.0 95-99 34.5092 37.0 37.0 37.0 25.0 37.0 100-104 34.8532 37.0 37.0 37.0 25.0 37.0 105-109 34.805600000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.9276 37.0 37.0 37.0 25.0 37.0 115-119 35.0101 37.0 37.0 37.0 25.0 37.0 120-124 34.948 37.0 37.0 37.0 25.0 37.0 125-129 34.9674 37.0 37.0 37.0 25.0 37.0 130-134 34.817099999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.739700000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.7397 37.0 37.0 37.0 25.0 37.0 145-149 34.382600000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.65925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 3.0 16 3.0 17 4.0 18 2.0 19 8.0 20 4.0 21 7.0 22 7.0 23 8.0 24 13.0 25 22.0 26 26.0 27 31.0 28 30.0 29 43.0 30 65.0 31 104.0 32 176.0 33 249.0 34 517.0 35 1080.0 36 1572.0 37 19.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.886971742935735 23.005751437859466 7.926981745436359 21.180295073768445 2 26.05 22.875 34.375 16.7 3 21.099999999999998 27.375 33.300000000000004 18.224999999999998 4 25.25 33.375 23.325000000000003 18.05 5 25.575 36.95 20.225 17.25 6 21.325 39.25 21.85 17.575 7 21.825 21.95 35.449999999999996 20.775 8 20.724999999999998 24.275 29.049999999999997 25.95 9 22.55 24.8 28.875 23.775 10-14 23.380000000000003 29.244999999999997 25.72 21.654999999999998 15-19 23.625 27.91 27.584999999999997 20.880000000000003 20-24 22.62 28.38 27.91 21.09 25-29 22.509999999999998 28.199999999999996 27.88 21.41 30-34 23.31 28.155 27.634999999999998 20.9 35-39 23.57 28.065 27.735 20.630000000000003 40-44 23.23 28.485 28.095 20.19 45-49 23.085 28.53 27.955000000000002 20.43 50-54 22.765 28.24 27.73 21.265 55-59 23.91 27.575 27.245 21.27 60-64 24.19 28.599999999999998 26.82 20.39 65-69 23.385 27.32 27.825 21.47 70-74 24.115000000000002 27.515 27.229999999999997 21.14 75-79 24.07 27.384999999999998 27.389999999999997 21.154999999999998 80-84 23.39 27.68 27.615000000000002 21.315 85-89 24.66 27.744999999999997 26.490000000000002 21.105 90-94 23.715 28.465 26.889999999999997 20.93 95-99 23.835 28.475 27.27 20.419999999999998 100-104 23.69 28.000000000000004 27.3 21.01 105-109 24.285 28.07 27.525 20.119999999999997 110-114 24.04 28.27 27.279999999999998 20.41 115-119 24.855 28.285 26.775 20.085 120-124 24.585 27.96 26.955000000000002 20.5 125-129 24.285 27.58 27.48 20.655 130-134 24.72 27.975 26.979999999999997 20.325 135-139 25.45 27.185 27.169999999999998 20.195 140-144 25.240000000000002 28.165000000000003 26.685 19.91 145-149 25.874999999999996 27.43 26.565 20.13 150-151 26.275 27.5125 27.0625 19.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 2.5 10 2.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 3.5 27 7.5 28 11.5 29 13.0 30 19.5 31 25.0 32 26.0 33 38.0 34 54.0 35 61.0 36 74.0 37 95.5 38 132.0 39 165.0 40 197.0 41 241.5 42 266.5 43 249.0 44 251.5 45 268.5 46 242.5 47 227.0 48 217.0 49 199.5 50 170.0 51 132.0 52 108.0 53 91.0 54 76.0 55 63.5 56 52.0 57 34.0 58 21.5 59 29.0 60 28.5 61 12.0 62 8.5 63 6.5 64 2.5 65 3.5 66 4.0 67 3.0 68 2.5 69 2.5 70 1.5 71 4.0 72 4.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.5 81 1.5 82 1.0 83 1.0 84 1.0 85 0.0 86 1.0 87 1.0 88 0.0 89 1.5 90 1.5 91 0.5 92 0.5 93 0.5 94 1.5 95 1.5 96 1.0 97 0.5 98 0.0 99 0.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.575 #Duplication Level Percentage of deduplicated Percentage of total 1 89.5004233700254 79.27499999999999 2 8.83432119672594 15.65 3 1.4112334180073385 3.75 4 0.14112334180073383 0.5 5 0.028224668360146768 0.125 6 0.028224668360146768 0.15 7 0.028224668360146768 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.028224668360146768 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GTTAGGTTTCTCCCAGTTTCGTTCCTCCTTCCAATCGTAGAAAATCAAAC 6 0.15 No Hit GGCGGCGGTGGTTACAGCCGTGGCGGAGGCGGCTACGGAGGCGGTGGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTAA 10 0.006830828 145.0 8 >>END_MODULE Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955746 spots for SRR13695435.sra Written 955746 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra Read 955730 spots for SRR13695435.sra Written 955730 spots for SRR13695435.sra SRR ids: ['SRR13695435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55axsyno SRR13695435.sra spots: 19114616 blocks: [[1, 955730], [955731, 1911460], [1911461, 2867190], [2867191, 3822920], [3822921, 4778650], [4778651, 5734380], [5734381, 6690110], [6690111, 7645840], [7645841, 8601570], [8601571, 9557300], [9557301, 10513030], [10513031, 11468760], [11468761, 12424490], [12424491, 13380220], [13380221, 14335950], [14335951, 15291680], [15291681, 16247410], [16247411, 17203140], [17203141, 18158870], [18158871, 19114616]] SRR13695435 file size 6474282 SRR13695435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13695435 SRR13695435_1.fastq SRR13695435_2.fastq Input file: SRR13695435_1.fastq Paired file: SRR13695435_2.fastq trimmed: SRR13695435-trimmed-pair1.fastq, SRR13695435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:10:24 2025 >> started Wed Feb 12 03:10:48 2025 >> done (24.281s) 19114616 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 2367 ( 0.01%) empty read pairs filtered out after trimming by size control 19112218 (99.99%) read pairs available; of these: 1166074 ( 6.10%) trimmed read pairs available after processing 17946144 (93.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 4 0.00% 23 5 0.00% 24 1 0.00% 25 2 0.00% 26 8 0.00% 27 6 0.00% 28 1 0.00% 29 3 0.00% 30 7 0.00% 31 5 0.00% 32 5 0.00% 33 12 0.00% 34 5 0.00% 35 6 0.00% 36 12 0.00% 37 13 0.00% 38 9 0.00% 39 16 0.00% 40 14 0.00% 41 34 0.00% 42 19 0.00% 43 18 0.00% 44 26 0.00% 45 30 0.00% 46 20 0.00% 47 38 0.00% 48 43 0.00% 49 57 0.00% 50 61 0.00% 51 59 0.00% 52 75 0.00% 53 72 0.00% 54 85 0.00% 55 94 0.00% 56 96 0.00% 57 121 0.00% 58 130 0.00% 59 158 0.00% 60 211 0.00% 61 247 0.00% 62 254 0.00% 63 292 0.00% 64 293 0.00% 65 332 0.00% 66 365 0.00% 67 390 0.00% 68 475 0.00% 69 594 0.00% 70 587 0.00% 71 675 0.00% 72 798 0.00% 73 949 0.00% 74 1082 0.01% 75 1094 0.01% 76 1280 0.01% 77 1345 0.01% 78 1446 0.01% 79 1572 0.01% 80 1724 0.01% 81 1870 0.01% 82 2191 0.01% 83 2358 0.01% 84 2741 0.01% 85 2933 0.02% 86 3081 0.02% 87 3253 0.02% 88 3630 0.02% 89 3538 0.02% 90 3943 0.02% 91 4183 0.02% 92 4486 0.02% 93 5035 0.03% 94 5259 0.03% 95 5677 0.03% 96 5983 0.03% 97 6271 0.03% 98 6385 0.03% 99 6830 0.04% 100 7232 0.04% 101 7338 0.04% 102 7896 0.04% 103 8345 0.04% 104 8874 0.05% 105 9334 0.05% 106 9713 0.05% 107 10191 0.05% 108 10266 0.05% 109 10537 0.06% 110 11125 0.06% 111 11903 0.06% 112 12281 0.06% 113 12594 0.07% 114 13224 0.07% 115 13959 0.07% 116 14678 0.08% 117 14756 0.08% 118 15380 0.08% 119 15669 0.08% 120 16734 0.09% 121 17101 0.09% 122 17410 0.09% 123 18413 0.10% 124 19158 0.10% 125 19635 0.10% 126 20794 0.11% 127 21147 0.11% 128 21957 0.11% 129 22305 0.12% 130 23100 0.12% 131 23256 0.12% 132 24343 0.13% 133 25223 0.13% 134 25965 0.14% 135 26770 0.14% 136 27433 0.14% 137 28372 0.15% 138 29127 0.15% 139 30281 0.16% 140 30327 0.16% 141 31594 0.17% 142 31863 0.17% 143 33063 0.17% 144 34253 0.18% 145 34888 0.18% 146 36445 0.19% 147 36707 0.19% 148 38210 0.20% 149 38304 0.20% 150 39571 0.21% 151 17946144 93.90% 19112218 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=4 prefix-density=0.62 prefix-fanout=3.4 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=514.26 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.55 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=50.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.4 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR13695435 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:11:31 Started mapping on | Feb 12 03:11:32 Finished on | Feb 12 03:14:03 Mapping speed, Million of reads per hour | 455.66 Number of input reads | 19112218 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17508728 Uniquely mapped reads % | 91.61% Average mapped length | 297.02 Number of splices: Total | 17464897 Number of splices: Annotated (sjdb) | 17050510 Number of splices: GT/AG | 17104987 Number of splices: GC/AG | 270930 Number of splices: AT/AC | 11489 Number of splices: Non-canonical | 77491 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433160 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 41425 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.65% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1170330 1170330 1170330 N_multimapping 433160 433160 433160 N_noFeature 706520 17177405 819607 N_ambiguous 337466 1373 118324 UnstrandedReadsAssigned:16464742 PositiveStrandReadsAssigned:329950 NegativeStrandReadsAssigned:16570797 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR13695435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13695435-trimmed-pair1.fastq SRR13695435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,112,218 reads, 16,605,782 reads pseudoaligned [quant] estimated average fragment length: 272.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR13695435.ke.tsv 34699 SRR13695435.se.tsv 87100 total ==> SRR13695435.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.82 861 23.839 Potri.005G024800.1.v4.1 1035 763.817 476 30.1405 Potri.004G059700.1.v4.1 961 689.851 0 0 Potri.007G009000.2.v4.1 1416 1144.82 0 0 Potri.003G141000.2.v4.1 2943 2671.82 1179.07 21.3434 Potri.016G087400.1.v4.1 270 73.9193 685.73 448.671 Potri.015G069301.1.v4.1 564 304.036 0 0 Potri.010G195200.1.v4.1 1773 1501.82 292 9.4037 Potri.012G127500.1.v4.1 977 705.834 168 11.5117 ==> SRR13695435.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 96 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13695435 completed mapping pipeline successfully