Starting /dee2/code/volunteer_pipeline.sh SRR13855475 current disk space = 3053408104448 free memory = 1516316668 SRR13855475 SRAfilesize b0147e316f80862f4cac48536aa5ba80 SRR13855475.sra SRR13855475.sra file validated SRR13855475 is single end SRR13855475 is conventional basespace SRR13855475 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0035 37.0 36.0 37.0 34.0 38.0 2 35.76 37.0 36.0 37.0 34.0 38.0 3 35.22225 37.0 36.0 37.0 31.0 38.0 4 36.2735 37.0 36.0 37.0 35.0 38.0 5 35.857 37.0 36.0 37.0 34.0 38.0 6 35.78875 37.0 36.0 37.0 34.0 38.0 7 34.467 37.0 36.0 37.0 28.0 38.0 8 35.1525 37.0 36.0 37.0 31.0 38.0 9 36.036 37.0 36.0 37.0 35.0 38.0 10-14 35.76819999999999 37.0 36.0 37.0 33.4 38.0 15-19 35.128949999999996 37.0 36.0 37.0 31.6 38.0 20-24 35.6202 37.0 36.0 37.0 33.2 38.0 25-29 35.3774 37.0 36.0 37.0 32.2 38.0 30-34 35.41295 37.0 35.8 37.0 32.2 38.0 35-39 35.6007 37.0 36.0 37.0 32.8 38.0 40-44 35.161300000000004 37.0 35.6 37.0 31.0 38.0 45-49 35.47205 37.0 35.8 37.0 32.4 38.0 50-54 34.857150000000004 37.0 35.4 37.0 29.6 38.0 55-59 35.140550000000005 37.0 35.6 37.0 31.2 38.0 60-64 34.922799999999995 37.0 35.4 37.0 30.2 38.0 65-69 35.2767 37.0 35.8 37.0 31.8 38.0 70-74 34.73535 37.0 35.2 37.0 29.6 38.0 75-79 34.70034999999999 37.0 35.4 37.0 29.2 38.0 80-84 34.077 37.0 35.2 37.0 25.8 38.0 85-89 34.0082 37.0 34.6 37.0 26.2 38.0 90-94 33.9431 37.0 34.4 37.0 25.6 38.0 95-99 33.8881 37.0 34.6 37.0 25.2 38.0 100-104 34.539500000000004 37.0 35.0 37.0 28.8 38.0 105-109 33.8466 37.0 34.4 37.0 25.2 38.0 110-114 34.238099999999996 36.8 34.8 37.0 27.2 38.0 115-119 33.77355 36.8 34.4 37.0 24.6 38.0 120-124 33.763850000000005 36.8 34.8 37.0 24.6 38.0 125-129 33.36280000000001 36.6 34.2 37.0 23.0 38.0 130-134 32.97305 36.4 32.8 37.0 21.4 38.0 135-139 32.7442 36.0 32.8 37.0 20.4 38.0 140-144 32.8583 36.0 33.0 37.0 21.0 38.0 145-149 32.36965000000001 36.0 32.2 37.0 18.6 38.0 150 32.40075 36.0 32.0 37.0 20.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 3.0 28 63.0 29 147.0 30 200.0 31 276.0 32 305.0 33 395.0 34 570.0 35 761.0 36 952.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 16.55 13.075000000000001 38.275 2 18.175 23.45 43.65 14.725 3 16.125 26.724999999999998 30.175 26.974999999999998 4 20.4 36.55 25.374999999999996 17.675 5 19.85 35.575 25.55 19.025 6 14.899999999999999 36.1 28.299999999999997 20.7 7 14.325 15.575 46.775 23.325000000000003 8 19.175 19.975 30.0 30.85 9 19.825 21.475 30.175 28.525 10-14 20.3 28.73 28.065 22.905 15-19 21.19 27.855 28.58 22.375 20-24 20.815 28.360000000000003 28.24 22.585 25-29 20.61 27.834999999999997 28.37 23.185 30-34 20.905 28.15 28.255000000000003 22.689999999999998 35-39 21.005 28.73 28.16 22.105 40-44 21.535 27.744999999999997 27.639999999999997 23.080000000000002 45-49 21.584999999999997 28.110000000000003 27.560000000000002 22.745 50-54 21.529999999999998 27.905 27.52 23.044999999999998 55-59 21.335 27.615000000000002 28.065 22.985 60-64 21.195 28.165000000000003 27.884999999999998 22.755 65-69 21.6 28.015 27.705000000000002 22.68 70-74 21.255 28.49 28.165000000000003 22.09 75-79 21.69 28.675 26.895000000000003 22.74 80-84 21.715 27.975 27.71 22.6 85-89 22.095000000000002 28.17 27.765 21.97 90-94 21.68 27.250000000000004 27.845 23.225 95-99 21.355 27.950000000000003 27.96 22.735 100-104 21.825 28.265 27.505000000000003 22.405 105-109 22.585 27.725 27.27 22.42 110-114 21.4 27.905 27.845 22.85 115-119 22.24 27.595 27.529999999999998 22.634999999999998 120-124 21.63 27.794999999999998 27.605 22.97 125-129 22.155 27.415 27.91 22.52 130-134 22.215 27.715 27.375 22.695 135-139 21.965 27.82 27.83 22.384999999999998 140-144 22.470000000000002 27.665 27.26 22.605 145-149 22.561128056402822 27.76138806940347 27.051352567628385 22.626131306565327 150 23.225 27.450000000000003 27.474999999999998 21.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 2.5 23 2.0 24 2.5 25 3.5 26 3.5 27 6.5 28 13.0 29 17.5 30 20.5 31 28.5 32 46.0 33 55.0 34 61.0 35 70.0 36 78.5 37 103.0 38 122.5 39 154.5 40 200.0 41 222.0 42 239.5 43 261.5 44 266.0 45 267.5 46 265.0 47 252.5 48 223.0 49 190.5 50 168.0 51 138.5 52 111.0 53 94.5 54 78.5 55 51.0 56 40.0 57 35.5 58 23.5 59 18.5 60 16.5 61 11.5 62 8.0 63 5.5 64 4.5 65 4.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACCT 10 0.006973645 144.0 3 GGATTCT 10 0.006973645 144.0 6 TAGTCTG 10 0.006973645 144.0 3 AGTCTGG 10 0.006973645 144.0 4 GGAAACC 10 0.006973645 144.0 2 >>END_MODULE Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572534 READS because READLEN < 1 Read 3572534 spots for SRR13855475.sra Written 3572534 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra Rejected 3572516 READS because READLEN < 1 Read 3572516 spots for SRR13855475.sra Written 3572516 spots for SRR13855475.sra SRR ids: ['SRR13855475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3xv5t5dl SRR13855475.sra spots: 71450338 blocks: [[1, 3572516], [3572517, 7145032], [7145033, 10717548], [10717549, 14290064], [14290065, 17862580], [17862581, 21435096], [21435097, 25007612], [25007613, 28580128], [28580129, 32152644], [32152645, 35725160], [35725161, 39297676], [39297677, 42870192], [42870193, 46442708], [46442709, 50015224], [50015225, 53587740], [53587741, 57160256], [57160257, 60732772], [60732773, 64305288], [64305289, 67877804], [67877805, 71450338]] SRR13855475 file size 12049499 SRR13855475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855475 SRR13855475_2.fastq Input file: SRR13855475_2.fastq trimmed: SRR13855475-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:20:38 2025 >> started Tue Feb 11 19:21:01 2025 >> done (23.253s) 35725169 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 35725169 (100.00%) reads available; of these: 1134095 ( 3.17%) trimmed reads available after processing 34591074 (96.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 143 1 0.00% 144 19 0.00% 145 102 0.00% 146 793 0.00% 147 6592 0.02% 148 68924 0.19% 149 1057664 2.96% 150 34591074 96.83% 35725169 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=68.58 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=31.5 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.50 sequence-density-rank=1 fanout-score=68.58 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=31.5 sequence=AAGTCGGATCGTAGCCATGT Started job on | Feb 11 19:21:23 Started mapping on | Feb 11 19:21:24 Finished on | Feb 11 19:22:25 Mapping speed, Million of reads per hour | 2108.37 Number of input reads | 35725169 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 34722698 Uniquely mapped reads % | 97.19% Average mapped length | 149.20 Number of splices: Total | 13482277 Number of splices: Annotated (sjdb) | 13222959 Number of splices: GT/AG | 13279938 Number of splices: GC/AG | 149986 Number of splices: AT/AC | 17041 Number of splices: Non-canonical | 35312 Mismatch rate per base, % | 0.65% Deletion rate per base | 0.02% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 760546 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 3087 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 241925 241925 241925 N_multimapping 760546 760546 760546 N_noFeature 1111659 17926795 17484191 N_ambiguous 540406 57151 60673 UnstrandedReadsAssigned:33070633 PositiveStrandReadsAssigned:16738752 NegativeStrandReadsAssigned:17177834 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13855475 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855475-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,725,169 reads, 33,854,645 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR13855475.ke.tsv 34699 SRR13855475.se.tsv 87100 total ==> SRR13855475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2382.69 46.8257 Potri.005G024800.1.v4.1 1035 936 564 22.7246 Potri.004G059700.1.v4.1 961 862 547 23.9316 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 742.572 9.84694 Potri.016G087400.1.v4.1 270 171 1211 267.079 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 1.23908 Potri.012G127500.1.v4.1 977 878 3308 142.09 ==> SRR13855475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7002 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1322 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 341 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR13855475 completed mapping pipeline successfully