Starting /dee2/code/volunteer_pipeline.sh SRR13855476 current disk space = 3053442433024 free memory = 1489108872 SRR13855476 SRAfilesize 0a3ab6d958b5ee603932b26c9c115a3b SRR13855476.sra SRR13855476.sra file validated SRR13855476 is single end SRR13855476 is conventional basespace SRR13855476 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.88475 37.0 36.0 37.0 34.0 38.0 2 35.6435 37.0 36.0 37.0 34.0 38.0 3 35.16975 37.0 36.0 37.0 32.0 38.0 4 36.138 37.0 36.0 37.0 35.0 38.0 5 35.72625 37.0 36.0 37.0 34.0 38.0 6 35.734 37.0 36.0 37.0 34.0 38.0 7 34.2675 37.0 35.0 37.0 27.0 38.0 8 35.00975 37.0 36.0 37.0 31.0 38.0 9 36.09575 37.0 36.0 37.0 35.0 38.0 10-14 35.65175 37.0 36.0 37.0 33.2 38.0 15-19 34.9459 37.0 36.0 37.0 30.4 38.0 20-24 35.444900000000004 37.0 35.8 37.0 32.2 38.0 25-29 35.1317 37.0 35.4 37.0 30.8 38.0 30-34 35.2529 37.0 35.6 37.0 31.8 38.0 35-39 35.4588 37.0 36.0 37.0 32.6 38.0 40-44 34.919 37.0 35.4 37.0 29.8 38.0 45-49 35.30275 37.0 35.8 37.0 32.0 38.0 50-54 34.7238 37.0 35.4 37.0 29.2 38.0 55-59 34.9893 37.0 35.6 37.0 30.6 38.0 60-64 34.785849999999996 37.0 35.4 37.0 29.8 38.0 65-69 35.091100000000004 37.0 35.8 37.0 31.2 38.0 70-74 34.47055 37.0 35.2 37.0 28.0 38.0 75-79 34.5433 37.0 35.2 37.0 28.6 38.0 80-84 33.67255 37.0 34.2 37.0 24.2 38.0 85-89 33.5855 36.8 34.4 37.0 24.0 38.0 90-94 33.690799999999996 36.6 34.4 37.0 24.4 38.0 95-99 33.471199999999996 36.4 34.0 37.0 23.4 38.0 100-104 34.22735 36.8 34.8 37.0 27.0 38.0 105-109 33.394000000000005 36.4 33.8 37.0 23.2 38.0 110-114 33.901349999999994 36.8 34.8 37.0 25.4 38.0 115-119 33.3902 36.6 34.0 37.0 23.0 38.0 120-124 33.401199999999996 36.8 34.0 37.0 23.2 38.0 125-129 32.85275 36.2 33.0 37.0 21.0 38.0 130-134 32.5477 36.0 32.6 37.0 19.6 38.0 135-139 32.1398 36.0 31.6 37.0 17.8 37.8 140-144 32.5123 36.0 32.4 37.0 19.2 38.0 145-149 31.82325 36.0 30.6 37.0 17.2 37.6 150 31.75675 36.0 31.0 37.0 16.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 7.0 28 54.0 29 152.0 30 252.0 31 285.0 32 379.0 33 486.0 34 598.0 35 786.0 36 785.0 37 216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.425 16.45 11.275 39.85 2 18.3 23.549999999999997 42.925000000000004 15.225 3 16.85 27.250000000000004 30.825000000000003 25.074999999999996 4 21.075 35.325 25.8 17.8 5 19.5 35.85 26.700000000000003 17.95 6 15.65 34.325 28.875 21.15 7 14.7 15.475 45.375 24.45 8 18.75 21.3 30.099999999999998 29.849999999999998 9 20.674999999999997 20.599999999999998 29.975 28.749999999999996 10-14 20.075000000000003 29.56 27.485 22.88 15-19 21.36 27.800000000000004 28.16 22.68 20-24 21.529999999999998 27.97 27.855 22.645 25-29 21.095 28.71 28.144999999999996 22.05 30-34 21.195 28.27 28.244999999999997 22.29 35-39 21.475 28.845 27.779999999999998 21.9 40-44 21.23 28.439999999999998 28.044999999999998 22.285 45-49 21.245 28.435 27.529999999999998 22.79 50-54 21.14 28.22 28.24 22.400000000000002 55-59 21.58 28.17 27.66 22.59 60-64 21.224999999999998 28.12 28.15 22.505 65-69 20.919999999999998 28.28 27.955000000000002 22.845 70-74 21.625 28.09 27.415 22.869999999999997 75-79 21.759999999999998 28.225 27.705000000000002 22.31 80-84 21.935 28.315 27.295 22.455 85-89 21.716085804290213 27.241362068103403 28.466423321166058 22.57612880644032 90-94 21.66 28.015 27.105 23.22 95-99 21.75 27.435 28.134999999999998 22.68 100-104 22.439999999999998 27.66 27.705000000000002 22.195 105-109 22.33 27.800000000000004 27.205000000000002 22.665 110-114 21.48 27.794999999999998 27.775 22.95 115-119 22.775000000000002 27.375 27.639999999999997 22.21 120-124 22.33611680584029 27.1963598179909 27.50637531876594 22.96114805740287 125-129 22.2 27.62 27.57 22.61 130-134 23.006150307515373 27.51137556877844 26.871343567178357 22.611130556527826 135-139 22.99 26.634999999999998 27.224999999999998 23.150000000000002 140-144 23.04 27.13 27.43 22.400000000000002 145-149 23.466173308665432 27.631381569078457 26.916345817290864 21.986099304965247 150 24.4 26.775 26.900000000000002 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.5 24 2.0 25 2.5 26 9.0 27 10.0 28 16.0 29 21.5 30 24.0 31 33.5 32 40.0 33 49.5 34 54.5 35 62.0 36 84.5 37 113.5 38 138.0 39 154.5 40 179.0 41 210.0 42 238.0 43 258.0 44 269.5 45 281.5 46 270.0 47 246.0 48 230.5 49 193.0 50 163.0 51 151.0 52 121.0 53 81.0 54 62.0 55 56.5 56 42.0 57 29.5 58 19.0 59 17.0 60 15.0 61 8.5 62 8.5 63 8.5 64 6.5 65 4.5 66 4.5 67 3.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701028 READS because READLEN < 1 Read 3701028 spots for SRR13855476.sra Written 3701028 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra Rejected 3701016 READS because READLEN < 1 Read 3701016 spots for SRR13855476.sra Written 3701016 spots for SRR13855476.sra SRR ids: ['SRR13855476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x3puzr8a SRR13855476.sra spots: 74020332 blocks: [[1, 3701016], [3701017, 7402032], [7402033, 11103048], [11103049, 14804064], [14804065, 18505080], [18505081, 22206096], [22206097, 25907112], [25907113, 29608128], [29608129, 33309144], [33309145, 37010160], [37010161, 40711176], [40711177, 44412192], [44412193, 48113208], [48113209, 51814224], [51814225, 55515240], [55515241, 59216256], [59216257, 62917272], [62917273, 66618288], [66618289, 70319304], [70319305, 74020332]] SRR13855476 file size 12483687 SRR13855476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855476 SRR13855476_2.fastq Input file: SRR13855476_2.fastq trimmed: SRR13855476-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:26:31 2025 >> started Tue Feb 11 19:26:52 2025 >> done (21.033s) 37010166 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 37010166 (100.00%) reads available; of these: 1218599 ( 3.29%) trimmed reads available after processing 35791567 (96.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 142 1 0.00% 143 6 0.00% 144 21 0.00% 145 110 0.00% 146 818 0.00% 147 7141 0.02% 148 74565 0.20% 149 1135937 3.07% 150 35791567 96.71% 37010166 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=68.82 fanout-score-rank=1 prefix-density=1.37 prefix-fanout=31.8 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.63 sequence-density-rank=1 fanout-score=68.82 fanout-score-rank=1 prefix-density=1.37 prefix-fanout=31.8 sequence=AAGTCGGATCGTAGCCATGT Started job on | Feb 11 19:27:14 Started mapping on | Feb 11 19:27:14 Finished on | Feb 11 19:28:17 Mapping speed, Million of reads per hour | 2114.87 Number of input reads | 37010166 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 35966884 Uniquely mapped reads % | 97.18% Average mapped length | 149.13 Number of splices: Total | 13928543 Number of splices: Annotated (sjdb) | 13659202 Number of splices: GT/AG | 13719222 Number of splices: GC/AG | 154485 Number of splices: AT/AC | 18707 Number of splices: Non-canonical | 36129 Mismatch rate per base, % | 0.67% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 795710 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 3366 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 247572 247572 247572 N_multimapping 795710 795710 795710 N_noFeature 1142902 18570200 18101872 N_ambiguous 559599 58920 63765 UnstrandedReadsAssigned:34264383 PositiveStrandReadsAssigned:17337764 NegativeStrandReadsAssigned:17801247 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13855476 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855476-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,010,166 reads, 35,085,162 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR13855476.ke.tsv 34699 SRR13855476.se.tsv 87100 total ==> SRR13855476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2439 46.1632 Potri.005G024800.1.v4.1 1035 936 554 21.4978 Potri.004G059700.1.v4.1 961 862 550 23.1747 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 738.482 9.43125 Potri.016G087400.1.v4.1 270 171 1281 272.09 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 84 1.82257 Potri.012G127500.1.v4.1 977 878 3421 141.52 ==> SRR13855476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7250 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1388 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 388 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR13855476 completed mapping pipeline successfully