Starting /dee2/code/volunteer_pipeline.sh SRR13855477 current disk space = 3053390356480 free memory = 1579138992 SRR13855477 SRAfilesize 838298af0895afe364e12a29e9b8127b SRR13855477.sra SRR13855477.sra file validated SRR13855477 is single end SRR13855477 is conventional basespace SRR13855477 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.59775 37.0 36.0 37.0 34.0 38.0 2 35.3415 37.0 36.0 37.0 32.0 38.0 3 36.03375 37.0 36.0 37.0 35.0 38.0 4 35.9725 37.0 36.0 37.0 35.0 38.0 5 35.77125 37.0 36.0 37.0 34.0 38.0 6 35.8475 37.0 36.0 37.0 34.0 38.0 7 36.0035 37.0 36.0 37.0 35.0 38.0 8 36.0245 37.0 36.0 37.0 35.0 38.0 9 35.94775 37.0 36.0 37.0 35.0 38.0 10-14 35.9199 37.0 36.0 37.0 34.6 38.0 15-19 35.95055 37.0 36.0 37.0 34.2 38.0 20-24 35.9447 37.0 36.0 37.0 34.4 38.0 25-29 35.9441 37.0 36.0 37.0 34.2 38.0 30-34 35.972500000000004 37.0 36.0 37.0 34.6 38.0 35-39 35.88875 37.0 36.0 37.0 34.0 38.0 40-44 35.842600000000004 37.0 36.0 37.0 34.0 38.0 45-49 35.881600000000006 37.0 36.0 37.0 34.0 38.0 50-54 35.79815 37.0 36.0 37.0 34.0 38.0 55-59 35.7211 37.0 36.0 37.0 34.0 38.0 60-64 35.6336 37.0 36.0 37.0 33.6 38.0 65-69 35.5685 37.0 36.0 37.0 33.4 38.0 70-74 35.5917 37.0 36.0 37.0 33.2 38.0 75-79 35.4872 37.0 36.0 37.0 33.0 38.0 80-84 35.48485 37.0 36.0 37.0 33.0 38.0 85-89 35.4105 37.0 36.0 37.0 32.6 38.0 90-94 35.4442 37.0 36.0 37.0 33.2 38.0 95-99 35.3591 37.0 36.0 37.0 32.6 38.0 100-104 35.31155 37.0 36.0 37.0 32.2 38.0 105-109 35.22945 37.0 36.0 37.0 32.2 38.0 110-114 35.08015 37.0 35.8 37.0 31.4 38.0 115-119 35.011900000000004 37.0 35.4 37.0 30.8 38.0 120-124 34.8478 37.0 35.2 37.0 30.8 38.0 125-129 34.774249999999995 37.0 35.2 37.0 30.0 38.0 130-134 34.57565000000001 37.0 35.0 37.0 29.2 38.0 135-139 34.420849999999994 37.0 35.0 37.0 28.2 38.0 140-144 34.37595 37.0 35.0 37.0 28.2 38.0 145-149 34.219049999999996 37.0 35.0 37.0 27.6 38.0 150 34.14825 37.0 35.0 37.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 11.0 28 38.0 29 52.0 30 79.0 31 125.0 32 152.0 33 283.0 34 426.0 35 818.0 36 1405.0 37 610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2 17.0 12.425 36.375 2 20.424999999999997 25.324999999999996 41.275 12.975 3 17.1 30.0 30.049999999999997 22.85 4 21.075 39.25 23.75 15.925 5 21.025 37.175000000000004 24.925 16.875 6 15.75 36.9 28.275 19.075 7 14.325 15.299999999999999 47.425 22.95 8 19.425 22.400000000000002 27.900000000000002 30.275000000000002 9 21.15 23.400000000000002 29.2 26.25 10-14 21.13 29.615000000000002 26.495 22.759999999999998 15-19 22.075 28.285 27.62 22.02 20-24 22.165000000000003 28.89 27.185 21.759999999999998 25-29 21.884999999999998 29.32 27.400000000000002 21.395 30-34 22.040000000000003 28.999999999999996 27.41 21.55 35-39 22.264999999999997 28.634999999999998 27.63 21.47 40-44 22.605 28.910000000000004 26.905 21.58 45-49 22.12 28.610000000000003 27.61 21.66 50-54 22.12 28.410000000000004 27.474999999999998 21.995 55-59 21.92 27.884999999999998 28.16 22.035 60-64 22.06 28.265 27.700000000000003 21.975 65-69 22.495 28.970000000000002 27.345000000000002 21.19 70-74 22.36 28.33 27.63 21.68 75-79 22.27 28.175 27.650000000000002 21.905 80-84 22.325 27.944999999999997 27.85 21.88 85-89 22.175 28.48 27.439999999999998 21.905 90-94 22.16 28.225 27.584999999999997 22.03 95-99 22.189999999999998 28.305000000000003 27.700000000000003 21.805 100-104 23.064999999999998 28.075 27.150000000000002 21.709999999999997 105-109 22.564999999999998 28.105000000000004 27.744999999999997 21.584999999999997 110-114 22.335 27.93 27.485 22.25 115-119 22.939999999999998 28.105000000000004 26.865 22.09 120-124 22.655 27.644999999999996 27.92 21.78 125-129 22.55 28.475 27.439999999999998 21.535 130-134 22.985 28.035 27.04 21.94 135-139 22.845 28.15 27.700000000000003 21.305 140-144 23.68618430921546 27.44637231861593 27.066353317665882 21.801090054502726 145-149 23.369999999999997 28.04 26.685 21.905 150 23.275000000000002 27.650000000000002 28.15 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 2.0 25 2.0 26 4.5 27 10.5 28 15.5 29 12.5 30 19.5 31 28.5 32 33.5 33 50.5 34 70.5 35 87.5 36 96.0 37 110.0 38 125.0 39 157.5 40 195.0 41 216.0 42 240.0 43 252.0 44 255.0 45 264.0 46 274.5 47 260.5 48 232.5 49 201.5 50 162.5 51 137.0 52 112.0 53 84.5 54 67.5 55 49.5 56 34.0 57 25.0 58 22.0 59 18.5 60 13.5 61 9.5 62 9.0 63 9.0 64 6.0 65 5.5 66 4.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0125 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAGA 10 0.006973645 144.0 9 CTGACTT 10 0.006973645 144.0 1 >>END_MODULE Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976905 READS because READLEN < 1 Read 2976905 spots for SRR13855477.sra Written 2976905 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra Rejected 2976901 READS because READLEN < 1 Read 2976901 spots for SRR13855477.sra Written 2976901 spots for SRR13855477.sra SRR ids: ['SRR13855477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_paftsyt7 SRR13855477.sra spots: 59538024 blocks: [[1, 2976901], [2976902, 5953802], [5953803, 8930703], [8930704, 11907604], [11907605, 14884505], [14884506, 17861406], [17861407, 20838307], [20838308, 23815208], [23815209, 26792109], [26792110, 29769010], [29769011, 32745911], [32745912, 35722812], [35722813, 38699713], [38699714, 41676614], [41676615, 44653515], [44653516, 47630416], [47630417, 50607317], [50607318, 53584218], [53584219, 56561119], [56561120, 59538024]] SRR13855477 file size 10036969 SRR13855477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855477 SRR13855477_1.fastq Input file: SRR13855477_1.fastq trimmed: SRR13855477-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:37:49 2025 >> started Tue Feb 11 19:38:06 2025 >> done (17.319s) 29769012 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 29769012 (100.00%) reads available; of these: 804663 ( 2.70%) trimmed reads available after processing 28964349 (97.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 143 2 0.00% 144 9 0.00% 145 65 0.00% 146 425 0.00% 147 4160 0.01% 148 46366 0.16% 149 753636 2.53% 150 28964349 97.30% 29769012 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=2.0 sequence=TTAAGTGGTAACCTACTACCTGTTCC criterion=fanout-score sequence-density=0.36 sequence-density-rank=3 fanout-score=66.57 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=29.3 sequence=AAGTCGGAGGCCAAG Started job on | Feb 11 19:38:31 Started mapping on | Feb 11 19:38:31 Finished on | Feb 11 19:39:20 Mapping speed, Million of reads per hour | 2187.11 Number of input reads | 29769012 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 28946663 Uniquely mapped reads % | 97.24% Average mapped length | 149.29 Number of splices: Total | 11554025 Number of splices: Annotated (sjdb) | 11332381 Number of splices: GT/AG | 11379982 Number of splices: GC/AG | 129725 Number of splices: AT/AC | 14624 Number of splices: Non-canonical | 29694 Mismatch rate per base, % | 0.62% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621711 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 2020 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 200638 200638 200638 N_multimapping 621711 621711 621711 N_noFeature 919197 14502375 15017908 N_ambiguous 443774 51723 47063 UnstrandedReadsAssigned:27583692 PositiveStrandReadsAssigned:14392565 NegativeStrandReadsAssigned:13881692 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13855477 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855477-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,769,012 reads, 28,227,591 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR13855477.ke.tsv 34699 SRR13855477.se.tsv 87100 total ==> SRR13855477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2052 48.9607 Potri.005G024800.1.v4.1 1035 936 491 24.0188 Potri.004G059700.1.v4.1 961 862 416 22.0969 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 618.552 9.95845 Potri.016G087400.1.v4.1 270 171 1112.45 297.872 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 53.5409 1.46445 Potri.012G127500.1.v4.1 977 878 2747 143.255 ==> SRR13855477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5969 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1067 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 253 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR13855477 completed mapping pipeline successfully