Starting /dee2/code/volunteer_pipeline.sh SRR13855478 current disk space = 3053079461888 free memory = 1418843604 SRR13855478 SRAfilesize 8bc64839a1b7375405a69d2ea0141318 SRR13855478.sra SRR13855478.sra file validated SRR13855478 is single end SRR13855478 is conventional basespace SRR13855478 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1695 37.0 36.0 37.0 35.0 38.0 2 35.6885 37.0 36.0 37.0 34.0 38.0 3 36.25325 37.0 36.0 37.0 35.0 38.0 4 36.2745 37.0 36.0 37.0 35.0 38.0 5 36.1975 37.0 36.0 37.0 35.0 38.0 6 36.15975 37.0 36.0 37.0 35.0 38.0 7 36.218 37.0 36.0 37.0 35.0 38.0 8 36.31625 37.0 36.0 37.0 35.0 38.0 9 36.20075 37.0 36.0 37.0 35.0 38.0 10-14 36.19285 37.0 36.0 37.0 35.0 38.0 15-19 36.20865 37.0 36.0 37.0 35.0 38.0 20-24 36.227500000000006 37.0 36.0 37.0 35.0 38.0 25-29 36.14615 37.0 36.0 37.0 35.0 38.0 30-34 36.1532 37.0 36.0 37.0 35.0 38.0 35-39 36.1297 37.0 36.0 37.0 35.0 38.0 40-44 36.073449999999994 37.0 36.0 37.0 35.0 38.0 45-49 36.01065 37.0 36.0 37.0 34.8 38.0 50-54 35.968450000000004 37.0 36.0 37.0 34.6 38.0 55-59 35.9275 37.0 36.0 37.0 34.2 38.0 60-64 35.8585 37.0 36.0 37.0 34.0 38.0 65-69 35.80195 37.0 36.0 37.0 34.0 38.0 70-74 35.784 37.0 36.0 37.0 34.0 38.0 75-79 35.68955 37.0 36.0 37.0 33.8 38.0 80-84 35.68985 37.0 36.0 37.0 34.0 38.0 85-89 35.58355 37.0 36.0 37.0 33.2 38.0 90-94 35.58825 37.0 36.0 37.0 33.4 38.0 95-99 35.539300000000004 37.0 36.0 37.0 33.0 38.0 100-104 35.534 37.0 36.0 37.0 33.0 38.0 105-109 35.3461 37.0 36.0 37.0 32.4 38.0 110-114 35.21275 37.0 36.0 37.0 32.0 38.0 115-119 35.1139 37.0 36.0 37.0 31.4 38.0 120-124 35.02035 37.0 35.8 37.0 31.0 38.0 125-129 34.81505 37.0 35.2 37.0 30.2 38.0 130-134 34.7251 37.0 35.0 37.0 29.6 38.0 135-139 34.54729999999999 37.0 35.0 37.0 28.6 38.0 140-144 34.515049999999995 37.0 35.0 37.0 28.8 38.0 145-149 34.323699999999995 37.0 35.0 37.0 27.6 38.0 150 34.4515 37.0 35.0 37.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 3.0 28 28.0 29 59.0 30 57.0 31 112.0 32 157.0 33 208.0 34 378.0 35 751.0 36 1568.0 37 678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.275 16.975 11.600000000000001 36.15 2 19.35 24.325 42.675000000000004 13.65 3 17.775 26.625 31.474999999999998 24.125 4 20.75 36.199999999999996 25.1 17.95 5 21.125 36.375 25.2 17.299999999999997 6 16.675 36.9 27.650000000000002 18.775 7 13.750000000000002 15.475 46.875 23.9 8 19.275000000000002 22.475 29.049999999999997 29.2 9 20.95 22.825 29.849999999999998 26.375 10-14 21.245 28.965000000000003 27.279999999999998 22.509999999999998 15-19 21.65 28.28 28.1 21.97 20-24 21.855 28.675 27.76 21.709999999999997 25-29 21.84609230461523 29.246462323116155 27.481374068703435 21.426071303565177 30-34 22.470000000000002 28.13 27.939999999999998 21.46 35-39 22.02 28.705000000000002 27.66 21.615000000000002 40-44 21.97 28.599999999999998 27.589999999999996 21.84 45-49 22.31 28.754999999999995 27.515 21.42 50-54 22.09 28.42 27.76 21.73 55-59 22.32 28.185 27.435 22.06 60-64 22.259999999999998 28.68 27.415 21.645 65-69 22.71 28.58 27.339999999999996 21.37 70-74 22.205 28.53 27.815 21.45 75-79 22.195 28.74 27.295 21.77 80-84 22.005 28.9 27.515 21.58 85-89 22.49 28.139999999999997 27.750000000000004 21.62 90-94 22.685 28.58 27.37 21.365000000000002 95-99 22.03 28.03 28.1 21.84 100-104 22.355 27.91 27.925 21.81 105-109 22.725 27.765 28.23 21.279999999999998 110-114 22.615 27.87 27.875 21.64 115-119 23.26 27.465 27.62 21.654999999999998 120-124 22.425 27.42 27.465 22.689999999999998 125-129 23.28 28.050000000000004 27.395000000000003 21.275 130-134 22.994999999999997 28.485 27.235 21.285 135-139 23.064999999999998 27.834999999999997 27.500000000000004 21.6 140-144 23.494999999999997 27.625 27.139999999999997 21.740000000000002 145-149 23.78 27.855 26.75 21.615000000000002 150 23.775 27.200000000000003 26.05 22.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 3.5 24 5.5 25 2.5 26 4.5 27 9.5 28 12.5 29 19.5 30 27.0 31 32.5 32 44.5 33 48.0 34 55.0 35 76.0 36 98.5 37 120.5 38 141.5 39 159.0 40 177.5 41 221.5 42 248.0 43 246.0 44 249.0 45 270.0 46 258.0 47 243.0 48 243.0 49 198.5 50 167.5 51 146.0 52 106.5 53 86.0 54 69.5 55 42.5 56 35.0 57 29.0 58 18.5 59 16.0 60 15.5 61 10.5 62 7.5 63 7.0 64 7.5 65 7.5 66 4.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83485309017223 97.55 2 1.0131712259371835 2.0 3 0.1519756838905775 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCA 10 0.006973645 144.0 2 AAAAAAA 35 0.0036813593 20.571428 5 >>END_MODULE Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra Rejected 3356032 READS because READLEN < 1 Read 3356032 spots for SRR13855478.sra Written 3356032 spots for SRR13855478.sra Rejected 3356016 READS because READLEN < 1 Read 3356016 spots for SRR13855478.sra Written 3356016 spots for SRR13855478.sra SRR ids: ['SRR13855478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__27tz7zd SRR13855478.sra spots: 67120336 blocks: [[1, 3356016], [3356017, 6712032], [6712033, 10068048], [10068049, 13424064], [13424065, 16780080], [16780081, 20136096], [20136097, 23492112], [23492113, 26848128], [26848129, 30204144], [30204145, 33560160], [33560161, 36916176], [36916177, 40272192], [40272193, 43628208], [43628209, 46984224], [46984225, 50340240], [50340241, 53696256], [53696257, 57052272], [57052273, 60408288], [60408289, 63764304], [63764305, 67120336]] SRR13855478 file size 11317965 SRR13855478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855478 SRR13855478_1.fastq Input file: SRR13855478_1.fastq trimmed: SRR13855478-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:04:19 2025 >> started Tue Feb 11 18:04:50 2025 >> done (30.411s) 33560168 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 33560168 (100.00%) reads available; of these: 874739 ( 2.61%) trimmed reads available after processing 32685429 (97.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 143 3 0.00% 144 7 0.00% 145 66 0.00% 146 538 0.00% 147 4692 0.01% 148 51426 0.15% 149 818007 2.44% 150 32685429 97.39% 33560168 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.62 prefix-fanout=2.0 sequence=TTAAGTGGTAACCTACTACCTGTTCC criterion=fanout-score sequence-density=0.42 sequence-density-rank=7 fanout-score=72.60 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=31.6 sequence=AAGTCGGAGGCCAAG Started job on | Feb 11 18:05:19 Started mapping on | Feb 11 18:05:19 Finished on | Feb 11 18:06:32 Mapping speed, Million of reads per hour | 1655.02 Number of input reads | 33560168 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 32704173 Uniquely mapped reads % | 97.45% Average mapped length | 149.28 Number of splices: Total | 13006825 Number of splices: Annotated (sjdb) | 12753561 Number of splices: GT/AG | 12812362 Number of splices: GC/AG | 145102 Number of splices: AT/AC | 16857 Number of splices: Non-canonical | 32504 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.02% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 664129 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 2090 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 191866 191866 191866 N_multimapping 664129 664129 664129 N_noFeature 1029080 16398260 16901404 N_ambiguous 542218 57635 51566 UnstrandedReadsAssigned:31132875 PositiveStrandReadsAssigned:16248278 NegativeStrandReadsAssigned:15751203 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13855478 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855478-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,560,168 reads, 31,845,168 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR13855478.ke.tsv 34699 SRR13855478.se.tsv 87100 total ==> SRR13855478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 988 21.4258 Potri.005G024800.1.v4.1 1035 936 102 4.53501 Potri.004G059700.1.v4.1 961 862 377 18.2007 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 488.388 7.14643 Potri.016G087400.1.v4.1 270 171 1123 273.299 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 52 1.29271 Potri.012G127500.1.v4.1 977 878 1001 47.4454 ==> SRR13855478.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7691 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 1143 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 389 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR13855478 completed mapping pipeline successfully