Starting /dee2/code/volunteer_pipeline.sh SRR13855479 current disk space = 3053092593664 free memory = 1578730384 SRR13855479 SRAfilesize 53bd9be6fc235045572cb0fde94c02a7 SRR13855479.sra SRR13855479.sra file validated SRR13855479 is single end SRR13855479 is conventional basespace SRR13855479 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.98325 37.0 36.0 37.0 34.0 38.0 2 35.2405 37.0 36.0 37.0 32.0 38.0 3 35.00775 37.0 36.0 37.0 31.0 38.0 4 35.21475 37.0 36.0 37.0 32.0 38.0 5 34.8805 37.0 36.0 37.0 31.0 38.0 6 35.04575 37.0 36.0 37.0 32.0 38.0 7 35.75075 37.0 36.0 37.0 34.0 38.0 8 35.20425 37.0 36.0 37.0 32.0 38.0 9 35.50325 37.0 36.0 37.0 33.0 38.0 10-14 35.358349999999994 37.0 36.0 37.0 32.4 38.0 15-19 35.6691 37.0 36.0 37.0 33.4 38.0 20-24 35.2023 37.0 36.0 37.0 31.6 38.0 25-29 35.4242 37.0 36.0 37.0 32.4 38.0 30-34 35.4079 37.0 36.0 37.0 32.4 38.0 35-39 35.1901 37.0 36.0 37.0 31.6 38.0 40-44 35.02835 37.0 36.0 37.0 30.8 38.0 45-49 35.1607 37.0 35.6 37.0 31.6 38.0 50-54 35.6228 37.0 36.0 37.0 33.4 38.0 55-59 35.358000000000004 37.0 35.8 37.0 32.4 38.0 60-64 34.9469 37.0 35.4 37.0 30.4 38.0 65-69 35.418049999999994 37.0 35.8 37.0 32.4 38.0 70-74 34.8492 37.0 35.2 37.0 30.0 38.0 75-79 35.058049999999994 37.0 35.6 37.0 31.2 38.0 80-84 34.8867 37.0 35.4 37.0 30.2 38.0 85-89 35.181349999999995 37.0 35.8 37.0 31.4 38.0 90-94 34.7007 37.0 35.2 37.0 29.6 38.0 95-99 35.1308 37.0 35.8 37.0 31.2 38.0 100-104 35.03955 37.0 35.8 37.0 31.0 38.0 105-109 34.4684 37.0 35.4 37.0 28.2 38.0 110-114 34.50615 37.0 35.4 37.0 28.2 38.0 115-119 34.31785000000001 37.0 35.2 37.0 27.6 38.0 120-124 34.0642 37.0 35.0 37.0 26.2 38.0 125-129 34.095349999999996 37.0 35.0 37.0 26.8 38.0 130-134 34.564299999999996 37.0 35.2 37.0 28.8 38.0 135-139 34.52645 37.0 35.0 37.0 28.4 38.0 140-144 34.1237 37.0 34.8 37.0 26.6 38.0 145-149 33.80715 37.0 34.6 37.0 24.6 38.0 150 34.266 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 6.0 28 43.0 29 124.0 30 153.0 31 204.0 32 234.0 33 330.0 34 492.0 35 690.0 36 1223.0 37 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.775 16.175 13.325000000000001 35.725 2 19.925 24.975 41.575 13.525 3 17.875 28.599999999999998 30.15 23.375 4 20.075000000000003 37.05 25.525 17.349999999999998 5 20.825 37.15 24.425 17.599999999999998 6 16.275000000000002 37.0 26.974999999999998 19.75 7 15.75 14.649999999999999 45.824999999999996 23.775 8 20.5 21.099999999999998 29.675 28.725 9 20.674999999999997 22.75 29.049999999999997 27.525 10-14 21.55 29.425 26.72 22.305 15-19 22.14 27.785 28.395 21.68 20-24 21.81 29.17 27.089999999999996 21.93 25-29 22.264999999999997 28.595 27.83 21.310000000000002 30-34 22.285 28.439999999999998 27.634999999999998 21.64 35-39 22.259999999999998 28.799999999999997 27.415 21.525 40-44 22.275 28.389999999999997 27.735 21.6 45-49 22.939999999999998 28.59 27.02 21.45 50-54 22.12 28.794999999999998 27.565 21.52 55-59 22.495 28.555000000000003 27.334999999999997 21.615000000000002 60-64 22.63 28.365000000000002 27.860000000000003 21.145 65-69 22.63 28.110000000000003 27.405 21.855 70-74 23.285 28.365000000000002 27.465 20.885 75-79 22.906145307265362 27.701385069253465 27.84639231961598 21.546077303865193 80-84 23.1 28.305000000000003 27.32 21.275 85-89 23.064999999999998 28.28 27.38 21.275 90-94 23.145 28.025 28.235 20.595 95-99 23.09 28.299999999999997 27.38 21.23 100-104 23.18 28.4 26.950000000000003 21.47 105-109 23.115 28.42 27.1 21.365000000000002 110-114 22.895 28.07 27.139999999999997 21.895 115-119 23.18 27.305 27.465 22.05 120-124 22.919999999999998 28.54 27.11 21.43 125-129 22.73 28.165000000000003 27.52 21.584999999999997 130-134 22.625 28.18 27.48 21.715 135-139 23.02 27.46 27.88 21.64 140-144 23.285 27.915 27.485 21.315 145-149 23.494999999999997 27.775 27.275 21.455 150 23.325000000000003 27.175 28.349999999999998 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 2.5 25 3.5 26 5.5 27 10.5 28 12.5 29 15.0 30 20.5 31 28.0 32 36.5 33 42.5 34 55.0 35 78.5 36 96.0 37 115.0 38 138.0 39 162.5 40 181.0 41 215.5 42 240.0 43 260.0 44 290.5 45 271.0 46 244.5 47 235.0 48 219.5 49 185.0 50 151.5 51 143.5 52 125.5 53 100.5 54 71.5 55 51.0 56 43.0 57 28.0 58 29.0 59 24.0 60 14.5 61 12.0 62 11.0 63 8.0 64 4.5 65 5.5 66 3.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAAAT 10 0.006973645 144.0 1 GCAACAA 30 0.0018473949 72.0 8 >>END_MODULE Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362894 READS because READLEN < 1 Read 3362894 spots for SRR13855479.sra Written 3362894 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra Rejected 3362888 READS because READLEN < 1 Read 3362888 spots for SRR13855479.sra Written 3362888 spots for SRR13855479.sra SRR ids: ['SRR13855479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g7c49edu SRR13855479.sra spots: 67257766 blocks: [[1, 3362888], [3362889, 6725776], [6725777, 10088664], [10088665, 13451552], [13451553, 16814440], [16814441, 20177328], [20177329, 23540216], [23540217, 26903104], [26903105, 30265992], [30265993, 33628880], [33628881, 36991768], [36991769, 40354656], [40354657, 43717544], [43717545, 47080432], [47080433, 50443320], [50443321, 53806208], [53806209, 57169096], [57169097, 60531984], [60531985, 63894872], [63894873, 67257766]] SRR13855479 file size 11341183 SRR13855479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855479 SRR13855479_1.fastq Input file: SRR13855479_1.fastq trimmed: SRR13855479-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:29:12 2025 >> started Tue Feb 11 20:29:40 2025 >> done (27.737s) 33628883 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 33628883 (100.00%) reads available; of these: 878160 ( 2.61%) trimmed reads available after processing 32750723 (97.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 142 1 0.00% 143 5 0.00% 144 11 0.00% 145 63 0.00% 146 480 0.00% 147 4470 0.01% 148 50580 0.15% 149 822550 2.45% 150 32750723 97.39% 33628883 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.63 prefix-fanout=2.0 sequence=TTAAGTGGTAACCTACTACCTGTTCC criterion=fanout-score sequence-density=0.43 sequence-density-rank=8 fanout-score=67.65 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=30.4 sequence=AAGTCGGAGGCCAAG Started job on | Feb 11 20:30:04 Started mapping on | Feb 11 20:30:04 Finished on | Feb 11 20:31:01 Mapping speed, Million of reads per hour | 2123.93 Number of input reads | 33628883 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 32779576 Uniquely mapped reads % | 97.47% Average mapped length | 149.30 Number of splices: Total | 12956501 Number of splices: Annotated (sjdb) | 12707436 Number of splices: GT/AG | 12764039 Number of splices: GC/AG | 143657 Number of splices: AT/AC | 16669 Number of splices: Non-canonical | 32136 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 661891 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 2071 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 187416 187416 187416 N_multimapping 661891 661891 661891 N_noFeature 996859 16408983 16930654 N_ambiguous 543980 56585 51214 UnstrandedReadsAssigned:31238737 PositiveStrandReadsAssigned:16314008 NegativeStrandReadsAssigned:15797708 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13855479 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855479-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,628,883 reads, 31,950,658 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR13855479.ke.tsv 34699 SRR13855479.se.tsv 87100 total ==> SRR13855479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 961 20.5674 Potri.005G024800.1.v4.1 1035 936 92 4.03685 Potri.004G059700.1.v4.1 961 862 429 20.44 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 422.529 6.1018 Potri.016G087400.1.v4.1 270 171 1134.87 272.572 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 63 1.54567 Potri.012G127500.1.v4.1 977 878 1198 56.0394 ==> SRR13855479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7670 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1171 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 355 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13855479 completed mapping pipeline successfully