Starting /dee2/code/volunteer_pipeline.sh SRR13855480 current disk space = 3053428703232 free memory = 1411554572 SRR13855480 SRAfilesize e9de87d97b2138357baa6e6cddc61b78 SRR13855480.sra SRR13855480.sra file validated SRR13855480 is single end SRR13855480 is conventional basespace SRR13855480 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13855480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0645 37.0 36.0 37.0 35.0 38.0 2 35.829 37.0 36.0 37.0 34.0 38.0 3 36.24825 37.0 36.0 37.0 35.0 38.0 4 36.149 37.0 36.0 37.0 35.0 38.0 5 36.14125 37.0 36.0 37.0 35.0 38.0 6 36.07825 37.0 36.0 37.0 35.0 38.0 7 36.165 37.0 36.0 37.0 35.0 38.0 8 36.24775 37.0 36.0 37.0 35.0 38.0 9 36.1425 37.0 36.0 37.0 35.0 38.0 10-14 36.10645 37.0 36.0 37.0 34.8 38.0 15-19 36.13075 37.0 36.0 37.0 35.0 38.0 20-24 36.08515 37.0 36.0 37.0 34.8 38.0 25-29 36.0616 37.0 36.0 37.0 34.4 38.0 30-34 36.0349 37.0 36.0 37.0 34.8 38.0 35-39 35.976350000000004 37.0 36.0 37.0 34.0 38.0 40-44 35.95975 37.0 36.0 37.0 34.0 38.0 45-49 35.91095 37.0 36.0 37.0 34.0 38.0 50-54 35.8815 37.0 36.0 37.0 34.0 38.0 55-59 35.8283 37.0 36.0 37.0 34.0 38.0 60-64 35.787749999999996 37.0 36.0 37.0 34.0 38.0 65-69 35.73235 37.0 36.0 37.0 33.8 38.0 70-74 35.615050000000004 37.0 36.0 37.0 33.2 38.0 75-79 35.565549999999995 37.0 36.0 37.0 33.2 38.0 80-84 35.4424 37.0 36.0 37.0 32.8 38.0 85-89 35.4513 37.0 36.0 37.0 32.8 38.0 90-94 35.2911 37.0 36.0 37.0 32.0 38.0 95-99 35.183800000000005 37.0 36.0 37.0 31.6 38.0 100-104 35.02524999999999 37.0 35.4 37.0 31.0 38.0 105-109 34.98955 37.0 35.6 37.0 31.0 38.0 110-114 34.81645 37.0 35.0 37.0 30.2 38.0 115-119 34.6082 37.0 35.0 37.0 29.0 38.0 120-124 34.4884 37.0 35.0 37.0 28.6 38.0 125-129 34.2832 37.0 35.0 37.0 27.6 38.0 130-134 34.121100000000006 37.0 35.0 37.0 26.6 38.0 135-139 33.8383 36.6 34.8 37.0 25.6 38.0 140-144 33.61765 36.2 34.4 37.0 24.2 38.0 145-149 33.412549999999996 36.0 34.0 37.0 23.4 38.0 150 33.25625 36.0 34.0 37.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 9.0 27 22.0 28 62.0 29 78.0 30 108.0 31 135.0 32 186.0 33 263.0 34 351.0 35 655.0 36 1372.0 37 759.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 16.05 13.850000000000001 40.875 2 18.55 22.75 44.525 14.174999999999999 3 17.1 26.950000000000003 31.5 24.45 4 21.349999999999998 35.275 24.675 18.7 5 20.724999999999998 34.475 25.8 19.0 6 15.375 34.2 28.025 22.400000000000002 7 14.825 14.95 46.825 23.400000000000002 8 18.875 20.75 28.799999999999997 31.574999999999996 9 19.275000000000002 22.400000000000002 30.15 28.175 10-14 20.59 29.5 27.04 22.869999999999997 15-19 20.97 28.38 28.21 22.439999999999998 20-24 20.955 28.265 27.975 22.805 25-29 21.095 28.384999999999998 28.355000000000004 22.165000000000003 30-34 21.105 28.4 27.994999999999997 22.5 35-39 20.974999999999998 28.720000000000002 27.68 22.625 40-44 21.64 28.67 27.46 22.23 45-49 21.584999999999997 27.98 28.075 22.36 50-54 21.725 28.244999999999997 27.495000000000005 22.535 55-59 22.2 27.88 28.015 21.905 60-64 21.38 28.32 27.875 22.425 65-69 21.895 27.825 27.58 22.7 70-74 21.515 28.349999999999998 28.03 22.105 75-79 21.23 28.43 27.639999999999997 22.7 80-84 21.515 27.689999999999998 28.34 22.455 85-89 21.46 28.744999999999997 27.365000000000002 22.43 90-94 20.76 28.34 28.360000000000003 22.54 95-99 21.64 27.700000000000003 27.800000000000004 22.86 100-104 21.84 27.615000000000002 27.785 22.759999999999998 105-109 21.8 27.68 28.115000000000002 22.405 110-114 21.975 27.694999999999997 27.515 22.814999999999998 115-119 22.045 28.194999999999997 27.38 22.38 120-124 22.040000000000003 28.015 27.395000000000003 22.55 125-129 22.3 27.715 27.634999999999998 22.35 130-134 23.075000000000003 27.305 27.255000000000003 22.365 135-139 22.78 27.310000000000002 27.455000000000002 22.455 140-144 22.98614930746537 27.496374818740936 26.871343567178357 22.64613230661533 145-149 23.31 27.389999999999997 26.845000000000002 22.455 150 22.7 27.0 27.05 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 3.0 23 3.5 24 4.0 25 4.0 26 5.0 27 9.0 28 10.5 29 16.0 30 26.5 31 36.5 32 44.0 33 56.0 34 65.0 35 73.5 36 96.5 37 118.0 38 131.5 39 159.0 40 188.0 41 202.5 42 226.5 43 261.0 44 271.0 45 258.5 46 238.5 47 232.5 48 228.0 49 196.5 50 166.0 51 147.5 52 123.0 53 95.5 54 74.0 55 56.0 56 39.5 57 25.5 58 25.5 59 22.5 60 16.0 61 12.5 62 8.0 63 5.0 64 3.0 65 4.0 66 5.0 67 3.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6568677141409 97.32499999999999 2 1.3177901672579828 2.6 3 0.025342118601115054 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTCA 10 0.006973645 144.0 4 >>END_MODULE Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872245 READS because READLEN < 1 Read 2872245 spots for SRR13855480.sra Written 2872245 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra Rejected 2872227 READS because READLEN < 1 Read 2872227 spots for SRR13855480.sra Written 2872227 spots for SRR13855480.sra SRR ids: ['SRR13855480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v8cv1ndo SRR13855480.sra spots: 57444558 blocks: [[1, 2872227], [2872228, 5744454], [5744455, 8616681], [8616682, 11488908], [11488909, 14361135], [14361136, 17233362], [17233363, 20105589], [20105590, 22977816], [22977817, 25850043], [25850044, 28722270], [28722271, 31594497], [31594498, 34466724], [34466725, 37338951], [37338952, 40211178], [40211179, 43083405], [43083406, 45955632], [45955633, 48827859], [48827860, 51700086], [51700087, 54572313], [54572314, 57444558]] SRR13855480 file size 9683288 SRR13855480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13855480 SRR13855480_2.fastq Input file: SRR13855480_2.fastq trimmed: SRR13855480-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 18:32:28 2025 >> started Tue Feb 11 18:32:55 2025 >> done (27.044s) 28722279 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 28722279 (100.00%) reads available; of these: 939329 ( 3.27%) trimmed reads available after processing 27782950 (96.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 141 1 0.00% 142 1 0.00% 143 3 0.00% 144 14 0.00% 145 76 0.00% 146 661 0.00% 147 5641 0.02% 148 57387 0.20% 149 875545 3.05% 150 27782950 96.73% 28722279 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=65.18 fanout-score-rank=1 prefix-density=1.49 prefix-fanout=32.2 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.74 sequence-density-rank=1 fanout-score=65.18 fanout-score-rank=1 prefix-density=1.49 prefix-fanout=32.2 sequence=AAGTCGGATCGTAGCCATGT Started job on | Feb 11 18:34:19 Started mapping on | Feb 11 18:34:20 Finished on | Feb 11 18:35:17 Mapping speed, Million of reads per hour | 1814.04 Number of input reads | 28722279 Average input read length | 141 UNIQUE READS: Uniquely mapped reads number | 27973211 Uniquely mapped reads % | 97.39% Average mapped length | 141.17 Number of splices: Total | 10278663 Number of splices: Annotated (sjdb) | 10083128 Number of splices: GT/AG | 10125234 Number of splices: GC/AG | 113997 Number of splices: AT/AC | 14064 Number of splices: Non-canonical | 25368 Mismatch rate per base, % | 0.69% Deletion rate per base | 0.02% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 586753 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 2028 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 162315 162315 162315 N_multimapping 586753 586753 586753 N_noFeature 843687 14360205 14090282 N_ambiguous 455759 43123 46686 UnstrandedReadsAssigned:26673765 PositiveStrandReadsAssigned:13569883 NegativeStrandReadsAssigned:13836243 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR13855480 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR13855480-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,722,279 reads, 27,297,693 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR13855480.ke.tsv 34699 SRR13855480.se.tsv 87100 total ==> SRR13855480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 798 19.7116 Potri.005G024800.1.v4.1 1035 936 91 4.60851 Potri.004G059700.1.v4.1 961 862 359 19.7416 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 406.683 6.7783 Potri.016G087400.1.v4.1 270 171 975 270.273 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44 1.24592 Potri.012G127500.1.v4.1 977 878 1023 55.2301 ==> SRR13855480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6219 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1079 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 333 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13855480 completed mapping pipeline successfully