Starting /dee2/code/volunteer_pipeline.sh SRR13857034 current disk space = 3053206962176 free memory = 1520531540 SRR13857034 SRAfilesize cc3a8764224505fc028af7293ae75ab5 SRR13857034.sra SRR13857034.sra file validated SRR13857034 is paired end SRR13857034 is conventional basespace SRR13857034 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857034_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.08625 32.0 32.0 32.0 2.0 32.0 2 31.54875 32.0 32.0 32.0 32.0 32.0 3 35.17375 37.0 32.0 37.0 32.0 37.0 4 36.1025 37.0 37.0 37.0 32.0 37.0 5 36.4225 37.0 37.0 37.0 37.0 37.0 6 39.92725 41.0 41.0 41.0 37.0 41.0 7 40.2235 41.0 41.0 41.0 37.0 41.0 8 40.0125 41.0 41.0 41.0 37.0 41.0 9 40.20175 41.0 41.0 41.0 37.0 41.0 10-14 40.265249999999995 41.0 41.0 41.0 39.4 41.0 15-19 40.13565 41.0 41.0 41.0 39.4 41.0 20-24 40.1679 41.0 41.0 41.0 38.6 41.0 25-29 40.0078 41.0 41.0 41.0 37.8 41.0 30-34 39.97675 41.0 41.0 41.0 37.0 41.0 35-39 39.9289 41.0 41.0 41.0 37.0 41.0 40-44 39.712 41.0 41.0 41.0 37.0 41.0 45-49 39.55865 41.0 41.0 41.0 37.0 41.0 50-54 39.45655 41.0 41.0 41.0 37.0 41.0 55-59 39.11075000000001 41.0 41.0 41.0 35.0 41.0 60-64 39.0329 41.0 41.0 41.0 34.0 41.0 65-69 38.897549999999995 41.0 41.0 41.0 34.0 41.0 70-74 38.87 41.0 41.0 41.0 33.0 41.0 75-79 37.975350000000006 40.2 37.6 41.0 31.0 41.0 80-84 38.17095 41.0 39.4 41.0 31.0 41.0 85-89 38.110749999999996 41.0 37.8 41.0 31.0 41.0 90-94 38.4982 41.0 41.0 41.0 32.0 41.0 95-99 38.29860000000001 41.0 41.0 41.0 32.0 41.0 100-104 38.29175 41.0 40.2 41.0 32.0 41.0 105-109 38.50585 41.0 40.2 41.0 32.0 41.0 110-114 38.4572 41.0 39.4 41.0 32.0 41.0 115-119 38.440999999999995 41.0 39.4 41.0 32.0 41.0 120-124 38.16205 41.0 37.0 41.0 32.0 41.0 125-129 38.161950000000004 41.0 37.0 41.0 32.0 41.0 130-134 38.0848 41.0 37.0 41.0 32.0 41.0 135-139 37.66545 41.0 37.0 41.0 30.0 41.0 140-144 37.747550000000004 41.0 37.0 41.0 29.0 41.0 145-149 37.3516 41.0 37.0 41.0 27.0 41.0 150 37.3795 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 8.0 24 16.0 25 19.0 26 28.0 27 31.0 28 44.0 29 39.0 30 50.0 31 58.0 32 57.0 33 70.0 34 70.0 35 114.0 36 142.0 37 172.0 38 251.0 39 514.0 40 2317.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.944491645426226 25.658453695836876 19.20135938827528 39.19569527046163 2 20.8 21.825 42.325 15.049999999999999 3 17.025000000000002 26.025 33.6 23.35 4 19.7 22.400000000000002 34.375 23.525 5 30.425 22.775000000000002 26.450000000000003 20.349999999999998 6 22.175 24.224999999999998 32.225 21.375 7 28.275 25.224999999999998 25.775 20.724999999999998 8 19.1 22.400000000000002 36.625 21.875 9 20.5 21.725 35.949999999999996 21.825 10-14 24.154999999999998 25.369999999999997 27.22 23.255 15-19 25.069999999999997 24.72 25.645 24.565 20-24 24.245 25.245 26.395000000000003 24.115000000000002 25-29 23.695 25.41 26.224999999999998 24.67 30-34 24.5 25.285000000000004 25.779999999999998 24.435000000000002 35-39 24.57 25.72 25.055 24.654999999999998 40-44 24.58 25.840000000000003 25.46 24.12 45-49 25.695 24.81 24.6 24.895 50-54 24.395 25.009999999999998 25.635 24.959999999999997 55-59 24.285 24.16 25.555 26.0 60-64 24.455 24.515 26.08 24.95 65-69 24.95 24.64 25.97 24.44 70-74 24.490000000000002 26.005 25.355 24.15 75-79 23.56 26.36 25.25 24.83 80-84 24.36 25.7 25.0 24.94 85-89 24.490000000000002 27.02 24.18 24.310000000000002 90-94 24.635 26.035000000000004 24.575 24.755 95-99 24.48 26.314999999999998 24.485 24.72 100-104 24.97374080928325 25.734006902415846 25.08878107337568 24.203471214925223 105-109 24.05 25.480000000000004 25.545 24.925 110-114 24.067220166049815 25.682704811443436 25.387616284885468 24.86245873762129 115-119 24.709999999999997 25.77 25.14 24.38 120-124 24.47213049134394 26.01320924647253 24.64224957470229 24.872410687481235 125-129 24.67 26.115 24.715 24.5 130-134 24.73 25.585 25.55 24.135 135-139 24.34934934934935 26.326326326326328 25.555555555555554 23.76876876876877 140-144 26.085 26.334999999999997 23.9 23.68 145-149 25.34 27.279999999999998 23.64 23.74 150 24.875 26.35 24.349999999999998 24.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.5 3 1.5 4 3.0 5 3.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 0.5 18 2.5 19 4.0 20 3.0 21 3.5 22 4.5 23 4.0 24 7.0 25 11.5 26 9.0 27 7.5 28 9.0 29 12.0 30 15.5 31 14.0 32 12.5 33 16.5 34 28.5 35 44.5 36 47.5 37 49.5 38 66.0 39 79.0 40 101.0 41 126.5 42 134.0 43 158.0 44 200.5 45 217.0 46 189.5 47 170.5 48 180.0 49 194.5 50 188.5 51 168.5 52 163.5 53 162.5 54 146.5 55 122.0 56 115.5 57 110.5 58 99.5 59 93.0 60 84.5 61 64.0 62 48.0 63 46.5 64 43.0 65 38.0 66 27.0 67 22.5 68 21.5 69 18.0 70 19.0 71 14.0 72 8.5 73 6.0 74 5.0 75 5.5 76 7.0 77 7.5 78 5.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.06999999999999999 125-129 0.0 130-134 0.0 135-139 0.1 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.04806333050608 79.625 2 8.00113090189426 14.149999999999999 3 1.300537178399774 3.45 4 0.33927056827820185 1.2 5 0.14136273678258413 0.625 6 0.11309018942606729 0.6 7 0.05654509471303364 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 7 0.17500000000000002 No Hit CTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATC 7 0.17500000000000002 No Hit CTTTGTGTTTGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTT 6 0.15 No Hit GTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCC 6 0.15 No Hit ATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACCTTCGCCGAAGCTC 6 0.15 No Hit CAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTG 6 0.15 No Hit AGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGT 5 0.125 No Hit CAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTT 5 0.125 No Hit CTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGCTTCGGCGAAG 5 0.125 No Hit TTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCC 5 0.125 No Hit CTTTGTGTTTGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0125 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.1625 0.025 0.0 0.0 0.0 136-137 0.975 0.025 0.0 0.0 0.0 138 1.5 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTGT 10 0.0069863307 143.91249 2 GTTTGAC 20 3.6967988E-4 107.93437 7 TTTGTGT 40 3.8944563E-9 107.93437 2 CTTTGTG 45 4.5529305E-9 105.141556 1 GTGTTTG 55 3.5590347E-8 78.49773 5 TGTGTTT 55 3.5590347E-8 78.49773 4 TGTTTGA 65 1.13333954E-7 66.42116 6 TTGTGTT 65 1.13333954E-7 66.42116 3 >>END_MODULE SRR13857034 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857034_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.96375 27.0 2.0 32.0 2.0 32.0 2 30.47125 32.0 32.0 32.0 27.0 32.0 3 32.0275 32.0 32.0 37.0 32.0 37.0 4 33.09 37.0 27.0 37.0 27.0 37.0 5 34.425 37.0 37.0 37.0 27.0 37.0 6 37.49075 41.0 37.0 41.0 27.0 41.0 7 38.05475 41.0 37.0 41.0 32.0 41.0 8 38.09525 41.0 37.0 41.0 32.0 41.0 9 37.981 41.0 37.0 41.0 27.0 41.0 10-14 38.3357 41.0 38.6 41.0 32.0 41.0 15-19 38.347350000000006 41.0 41.0 41.0 32.0 41.0 20-24 38.4195 41.0 41.0 41.0 32.0 41.0 25-29 38.25485 41.0 39.4 41.0 31.0 41.0 30-34 38.1281 41.0 38.6 41.0 30.0 41.0 35-39 38.4067 41.0 40.2 41.0 32.0 41.0 40-44 38.2335 41.0 38.6 41.0 32.0 41.0 45-49 38.4848 41.0 40.2 41.0 32.0 41.0 50-54 38.35375 41.0 40.2 41.0 32.0 41.0 55-59 38.3831 41.0 40.2 41.0 32.0 41.0 60-64 38.33205 41.0 40.2 41.0 32.0 41.0 65-69 38.571949999999994 41.0 40.2 41.0 32.0 41.0 70-74 38.47195 41.0 40.2 41.0 32.0 41.0 75-79 37.78435 40.2 37.0 41.0 30.0 41.0 80-84 38.5576 41.0 41.0 41.0 32.0 41.0 85-89 38.42015 41.0 39.4 41.0 32.0 41.0 90-94 38.2716 41.0 37.0 41.0 32.0 41.0 95-99 38.0594 41.0 37.0 41.0 30.0 41.0 100-104 37.735800000000005 41.0 37.0 41.0 30.0 41.0 105-109 37.6181 41.0 37.0 41.0 29.0 41.0 110-114 37.110400000000006 41.0 37.0 41.0 27.0 41.0 115-119 36.913799999999995 41.0 37.0 41.0 27.0 41.0 120-124 36.52295 41.0 36.0 41.0 25.0 41.0 125-129 36.308749999999996 41.0 36.0 41.0 24.0 41.0 130-134 35.72115 41.0 33.0 41.0 22.0 41.0 135-139 35.3546 41.0 32.0 41.0 22.0 41.0 140-144 35.03529999999999 41.0 32.0 41.0 22.0 41.0 145-149 34.3738 40.2 31.0 41.0 20.0 41.0 150 33.47575 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 8.0 23 29.0 24 40.0 25 52.0 26 54.0 27 62.0 28 58.0 29 83.0 30 87.0 31 94.0 32 92.0 33 96.0 34 120.0 35 153.0 36 194.0 37 239.0 38 342.0 39 726.0 40 1471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 16.757894736842104 27.031578947368423 21.347368421052632 34.863157894736844 2 19.375 23.25 42.275 15.1 3 18.35 26.650000000000002 32.9 22.1 4 21.025 21.05 34.75 23.175 5 29.95 22.125 27.325 20.599999999999998 6 22.5 24.025 32.800000000000004 20.674999999999997 7 27.575 24.224999999999998 28.599999999999998 19.6 8 20.1 21.675 38.074999999999996 20.150000000000002 9 23.150000000000002 21.349999999999998 34.375 21.125 10-14 25.005 25.27 26.895000000000003 22.830000000000002 15-19 25.36 24.45 25.85 24.34 20-24 24.22 24.75 26.575 24.455 25-29 23.48 24.87 26.505000000000003 25.145 30-34 25.06 25.480000000000004 25.085 24.375 35-39 25.074999999999996 25.230000000000004 25.080000000000002 24.615000000000002 40-44 24.425 25.385 25.365 24.825 45-49 25.06 25.240000000000002 25.09 24.610000000000003 50-54 24.415 24.805 25.5 25.28 55-59 24.605 24.385 25.745 25.264999999999997 60-64 24.474999999999998 24.529999999999998 26.424999999999997 24.57 65-69 24.705 25.035 25.724999999999998 24.535 70-74 24.515 25.019999999999996 26.11 24.355 75-79 24.41 24.8 25.974999999999998 24.815 80-84 25.185000000000002 24.365000000000002 25.674999999999997 24.775 85-89 24.58 25.765 25.295 24.36 90-94 24.775 26.255 24.815 24.154999999999998 95-99 24.245 25.674999999999997 25.05 25.03 100-104 24.845 24.83 25.35 24.975 105-109 24.08 25.074999999999996 25.619999999999997 25.224999999999998 110-114 24.205 25.055 26.82 23.919999999999998 115-119 24.7 24.92 25.5 24.88 120-124 24.884999999999998 24.79 25.319999999999997 25.005 125-129 24.58 24.985 25.88 24.555 130-134 23.985 25.0 26.265 24.75 135-139 24.285 25.865 25.215 24.635 140-144 25.380000000000003 25.96 24.6 24.060000000000002 145-149 25.28 26.640000000000004 24.404999999999998 23.674999999999997 150 25.874999999999996 26.5 24.65 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 1.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.5 13 1.5 14 1.5 15 2.0 16 3.5 17 3.5 18 1.5 19 2.5 20 2.5 21 2.0 22 3.0 23 3.5 24 4.0 25 5.0 26 8.5 27 9.5 28 13.5 29 14.0 30 12.0 31 16.5 32 17.0 33 21.0 34 36.0 35 40.5 36 40.5 37 55.0 38 59.0 39 73.5 40 104.0 41 130.0 42 159.0 43 173.0 44 208.5 45 226.0 46 192.5 47 184.0 48 185.0 49 179.5 50 171.5 51 160.0 52 151.5 53 147.0 54 138.5 55 114.0 56 108.0 57 112.0 58 98.5 59 85.5 60 75.5 61 62.0 62 48.0 63 51.5 64 49.5 65 36.0 66 30.0 67 25.5 68 25.5 69 21.5 70 15.0 71 12.0 72 11.0 73 7.5 74 5.0 75 5.0 76 5.5 77 10.5 78 10.5 79 4.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 40.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.66702878870178 85.3 2 6.219445953286257 11.450000000000001 3 0.9234111895708854 2.55 4 0.19011406844106463 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1625 0.0 0.0 0.0 0.0 136-137 0.975 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACG 10 0.0070373793 143.5625 6 TAAATCA 10 0.0070373793 143.5625 6 TTGACGG 10 0.0070373793 143.5625 7 TTAAATC 10 0.0070373793 143.5625 5 TGACGGG 10 0.0070373793 143.5625 8 CTTTGTG 35 3.302015E-4 109.38096 1 TTTGTGT 35 3.188973E-5 82.03572 2 TTGTGTT 50 1.8667046E-4 57.425 3 GTTTGAG 40 0.0058474327 53.835938 7 TGTGTTT 65 6.818814E-4 44.173077 2 GTGTTTG 70 9.823617E-4 41.01786 3 TGTTTGA 70 9.823617E-4 41.01786 4 >>END_MODULE Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350913 spots for SRR13857034.sra Written 1350913 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra Read 1350908 spots for SRR13857034.sra Written 1350908 spots for SRR13857034.sra SRR ids: ['SRR13857034.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g9517tm9 SRR13857034.sra spots: 27018165 blocks: [[1, 1350908], [1350909, 2701816], [2701817, 4052724], [4052725, 5403632], [5403633, 6754540], [6754541, 8105448], [8105449, 9456356], [9456357, 10807264], [10807265, 12158172], [12158173, 13509080], [13509081, 14859988], [14859989, 16210896], [16210897, 17561804], [17561805, 18912712], [18912713, 20263620], [20263621, 21614528], [21614529, 22965436], [22965437, 24316344], [24316345, 25667252], [25667253, 27018165]] SRR13857034 file size 9107484 SRR13857034 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857034 SRR13857034_1.fastq SRR13857034_2.fastq Input file: SRR13857034_1.fastq Paired file: SRR13857034_2.fastq trimmed: SRR13857034-trimmed-pair1.fastq, SRR13857034-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:53:38 2025 >> started Tue Feb 11 19:54:09 2025 >> done (31.504s) 27018165 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 20 ( 0.00%) empty read pairs filtered out after trimming by size control 27018138 (100.00%) read pairs available; of these: 3209086 (11.88%) trimmed read pairs available after processing 23809052 (88.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 1 0.00% 21 6 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 8 0.00% 27 12 0.00% 28 7 0.00% 29 12 0.00% 30 12 0.00% 31 18 0.00% 32 13 0.00% 33 18 0.00% 34 8 0.00% 35 28 0.00% 36 16 0.00% 37 20 0.00% 38 13 0.00% 39 18 0.00% 40 12 0.00% 41 22 0.00% 42 17 0.00% 43 24 0.00% 44 18 0.00% 45 20 0.00% 46 18 0.00% 47 21 0.00% 48 19 0.00% 49 27 0.00% 50 22 0.00% 51 20 0.00% 52 27 0.00% 53 38 0.00% 54 22 0.00% 55 28 0.00% 56 27 0.00% 57 37 0.00% 58 27 0.00% 59 48 0.00% 60 18 0.00% 61 49 0.00% 62 34 0.00% 63 44 0.00% 64 33 0.00% 65 47 0.00% 66 67 0.00% 67 75 0.00% 68 67 0.00% 69 49 0.00% 70 90 0.00% 71 53 0.00% 72 172 0.00% 73 53 0.00% 74 56 0.00% 75 45 0.00% 76 68 0.00% 77 54 0.00% 78 45 0.00% 79 47 0.00% 80 53 0.00% 81 59 0.00% 82 61 0.00% 83 59 0.00% 84 53 0.00% 85 44 0.00% 86 52 0.00% 87 71 0.00% 88 61 0.00% 89 51 0.00% 90 55 0.00% 91 93 0.00% 92 58 0.00% 93 63 0.00% 94 38 0.00% 95 42 0.00% 96 58 0.00% 97 58 0.00% 98 52 0.00% 99 59 0.00% 100 47 0.00% 101 50 0.00% 102 49 0.00% 103 51 0.00% 104 53 0.00% 105 56 0.00% 106 72 0.00% 107 49 0.00% 108 53 0.00% 109 71 0.00% 110 65 0.00% 111 77 0.00% 112 78 0.00% 113 71 0.00% 114 67 0.00% 115 75 0.00% 116 81 0.00% 117 92 0.00% 118 102 0.00% 119 121 0.00% 120 148 0.00% 121 170 0.00% 122 187 0.00% 123 170 0.00% 124 203 0.00% 125 194 0.00% 126 191 0.00% 127 189 0.00% 128 235 0.00% 129 223 0.00% 130 236 0.00% 131 234 0.00% 132 228 0.00% 133 1177 0.00% 134 116833 0.43% 135 124776 0.46% 136 127465 0.47% 137 130484 0.48% 138 134930 0.50% 139 138106 0.51% 140 141390 0.52% 141 145564 0.54% 142 149051 0.55% 143 153283 0.57% 144 155338 0.57% 145 160506 0.59% 146 163709 0.61% 147 172351 0.64% 148 218183 0.81% 149 968920 3.59% 150 23809052 88.12% 27018138 reads passed initial QC criterion=sequence-density sequence-density=3.80 sequence-density-rank=1 fanout-score=1.07 fanout-score-rank=46 prefix-density=1.03 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.56 sequence-density-rank=13 fanout-score=82.41 fanout-score-rank=1 prefix-density=1.55 prefix-fanout=29.8 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=4.76 sequence-density-rank=1 fanout-score=1.27 fanout-score-rank=48 prefix-density=3.44 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=48 fanout-score=59.06 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=1.0 sequence=TGCTTACCAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857034 SRR13857034_1.fastq SRR13857034_2.fastq Input file: SRR13857034_1.fastq Paired file: SRR13857034_2.fastq trimmed: SRR13857034-trimmed-pair1.fastq, SRR13857034-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:56:20 2025 >> started Tue Feb 11 19:56:34 2025 >> done (14.356s) 16210883 read pairs processed; of these: 167695 ( 1.03%) short read pairs filtered out after trimming by size control 82500 ( 0.51%) empty read pairs filtered out after trimming by size control 15960688 (98.46%) read pairs available; of these: 4423 ( 0.03%) trimmed read pairs available after processing 15956265 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 5 0.00% 27 5 0.00% 28 3 0.00% 29 6 0.00% 30 4 0.00% 31 9 0.00% 32 5 0.00% 33 8 0.00% 34 2 0.00% 35 15 0.00% 36 9 0.00% 37 10 0.00% 38 5 0.00% 39 12 0.00% 40 6 0.00% 41 12 0.00% 42 11 0.00% 43 15 0.00% 44 10 0.00% 45 16 0.00% 46 12 0.00% 47 10 0.00% 48 10 0.00% 49 15 0.00% 50 12 0.00% 51 12 0.00% 52 21 0.00% 53 23 0.00% 54 13 0.00% 55 15 0.00% 56 15 0.00% 57 27 0.00% 58 20 0.00% 59 38 0.00% 60 11 0.00% 61 34 0.00% 62 17 0.00% 63 25 0.00% 64 21 0.00% 65 27 0.00% 66 37 0.00% 67 50 0.00% 68 39 0.00% 69 32 0.00% 70 53 0.00% 71 39 0.00% 72 111 0.00% 73 33 0.00% 74 34 0.00% 75 26 0.00% 76 35 0.00% 77 33 0.00% 78 31 0.00% 79 23 0.00% 80 30 0.00% 81 32 0.00% 82 37 0.00% 83 36 0.00% 84 32 0.00% 85 29 0.00% 86 35 0.00% 87 41 0.00% 88 33 0.00% 89 31 0.00% 90 32 0.00% 91 53 0.00% 92 28 0.00% 93 34 0.00% 94 25 0.00% 95 25 0.00% 96 31 0.00% 97 31 0.00% 98 32 0.00% 99 37 0.00% 100 30 0.00% 101 24 0.00% 102 30 0.00% 103 28 0.00% 104 36 0.00% 105 31 0.00% 106 36 0.00% 107 32 0.00% 108 31 0.00% 109 40 0.00% 110 38 0.00% 111 53 0.00% 112 51 0.00% 113 46 0.00% 114 42 0.00% 115 40 0.00% 116 48 0.00% 117 56 0.00% 118 65 0.00% 119 72 0.00% 120 85 0.00% 121 100 0.00% 122 112 0.00% 123 99 0.00% 124 117 0.00% 125 108 0.00% 126 114 0.00% 127 115 0.00% 128 132 0.00% 129 128 0.00% 130 148 0.00% 131 132 0.00% 132 146 0.00% 133 695 0.00% 134 69007 0.43% 135 74084 0.46% 136 75660 0.47% 137 77133 0.48% 138 80307 0.50% 139 81885 0.51% 140 83288 0.52% 141 85954 0.54% 142 88135 0.55% 143 90749 0.57% 144 91877 0.58% 145 94947 0.59% 146 98276 0.62% 147 103371 0.65% 148 130007 0.81% 149 568476 3.56% 150 14062667 88.11% criterion=sequence-density sequence-density=3.18 sequence-density-rank=1 fanout-score=1.08 fanout-score-rank=45 prefix-density=1.02 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.54 sequence-density-rank=13 fanout-score=85.06 fanout-score-rank=1 prefix-density=1.46 prefix-fanout=31.4 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=3.93 sequence-density-rank=1 fanout-score=1.28 fanout-score-rank=48 prefix-density=3.46 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=48 fanout-score=73.12 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=1.0 sequence=TGCTTACCAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGG SRR13857034 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:57:43 Started mapping on | Feb 11 19:57:43 Finished on | Feb 11 20:09:17 Mapping speed, Million of reads per hour | 138.85 Number of input reads | 26767943 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 8704636 Uniquely mapped reads % | 32.52% Average mapped length | 289.35 Number of splices: Total | 3936757 Number of splices: Annotated (sjdb) | 3744845 Number of splices: GT/AG | 3805764 Number of splices: GC/AG | 56900 Number of splices: AT/AC | 5629 Number of splices: Non-canonical | 68464 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 737943 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 12757558 % of reads mapped to too many loci | 47.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.68% % of reads unmapped: other | 10.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 17325364 17325364 17325364 N_multimapping 737943 737943 737943 N_noFeature 3150808 5911139 5838181 N_ambiguous 155848 24397 25618 UnstrandedReadsAssigned:5397980 PositiveStrandReadsAssigned:2769100 NegativeStrandReadsAssigned:2840837 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857034 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857034-trimmed-pair1.fastq SRR13857034-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,767,943 reads, 21,429,177 reads pseudoaligned [quant] estimated average fragment length: 205.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR13857034.ke.tsv 34699 SRR13857034.se.tsv 87100 total ==> SRR13857034.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.9 162 2.73425 Potri.005G024800.1.v4.1 1035 830.901 3 0.110537 Potri.004G059700.1.v4.1 961 756.901 234 9.46484 Potri.007G009000.2.v4.1 1416 1211.9 0 0 Potri.003G141000.2.v4.1 2943 2738.9 83.0605 0.928441 Potri.016G087400.1.v4.1 270 82.7805 209 77.2956 Potri.015G069301.1.v4.1 564 360.119 0 0 Potri.010G195200.1.v4.1 1773 1568.9 0 0 Potri.012G127500.1.v4.1 977 772.901 4 0.158443 ==> SRR13857034.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 401 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 104 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 91 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857034 completed mapping pipeline successfully