Starting /dee2/code/volunteer_pipeline.sh SRR13857035 current disk space = 3053047013376 free memory = 1578218268 SRR13857035 SRAfilesize 689a2d4840b0a771c5881252848b4195 SRR13857035.sra SRR13857035.sra file validated SRR13857035 is paired end SRR13857035 is conventional basespace SRR13857035 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857035_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3425 32.0 32.0 32.0 2.0 32.0 2 31.61375 32.0 32.0 32.0 32.0 32.0 3 35.1775 37.0 32.0 37.0 32.0 37.0 4 36.31625 37.0 37.0 37.0 37.0 37.0 5 36.42 37.0 37.0 37.0 37.0 37.0 6 39.979 41.0 41.0 41.0 37.0 41.0 7 40.01775 41.0 41.0 41.0 37.0 41.0 8 40.1095 41.0 41.0 41.0 37.0 41.0 9 40.213 41.0 41.0 41.0 37.0 41.0 10-14 40.19775 41.0 41.0 41.0 37.8 41.0 15-19 40.2037 41.0 41.0 41.0 37.8 41.0 20-24 40.103750000000005 41.0 41.0 41.0 37.8 41.0 25-29 40.059 41.0 41.0 41.0 37.0 41.0 30-34 39.987350000000006 41.0 41.0 41.0 37.0 41.0 35-39 39.84665 41.0 41.0 41.0 37.0 41.0 40-44 39.9379 41.0 41.0 41.0 37.0 41.0 45-49 39.84335 41.0 41.0 41.0 37.0 41.0 50-54 39.78365 41.0 41.0 41.0 37.0 41.0 55-59 39.55559999999999 41.0 41.0 41.0 37.0 41.0 60-64 39.65115 41.0 41.0 41.0 37.0 41.0 65-69 39.63085 41.0 41.0 41.0 37.0 41.0 70-74 39.4931 41.0 41.0 41.0 37.0 41.0 75-79 39.3253 41.0 40.2 41.0 36.0 41.0 80-84 39.615950000000005 41.0 41.0 41.0 37.0 41.0 85-89 39.478699999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.41935 41.0 41.0 41.0 37.0 41.0 95-99 39.3746 41.0 41.0 41.0 37.0 41.0 100-104 39.3227 41.0 41.0 41.0 37.0 41.0 105-109 39.12245 41.0 41.0 41.0 37.0 41.0 110-114 39.0041 41.0 41.0 41.0 37.0 41.0 115-119 39.06615000000001 41.0 41.0 41.0 37.0 41.0 120-124 38.86925 41.0 41.0 41.0 34.0 41.0 125-129 38.68900000000001 41.0 41.0 41.0 33.0 41.0 130-134 38.47205 41.0 41.0 41.0 32.0 41.0 135-139 37.82655 41.0 38.6 41.0 30.0 41.0 140-144 37.74400000000001 41.0 37.0 41.0 30.0 41.0 145-149 37.727999999999994 41.0 37.8 41.0 27.0 41.0 150 37.619 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 15.0 25 19.0 26 24.0 27 24.0 28 27.0 29 23.0 30 32.0 31 42.0 32 43.0 33 47.0 34 53.0 35 96.0 36 100.0 37 127.0 38 253.0 39 410.0 40 2659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.9289540456724 26.19114744854807 15.787989850577953 42.09190865520158 2 19.759879939969984 22.71135567783892 42.54627313656829 14.982491245622812 3 19.1 23.799999999999997 33.6 23.5 4 20.599999999999998 22.6 33.975 22.825 5 29.625 21.775 28.125 20.474999999999998 6 22.125 22.925 31.95 23.0 7 28.1 23.549999999999997 27.075 21.275 8 19.525000000000002 21.325 36.1 23.05 9 22.45 21.224999999999998 33.650000000000006 22.675 10-14 24.610000000000003 24.759999999999998 26.5 24.13 15-19 25.045 24.125 25.759999999999998 25.069999999999997 20-24 24.585 25.045 25.895000000000003 24.474999999999998 25-29 23.974999999999998 25.045 26.125 24.855 30-34 24.654999999999998 24.29 26.06 24.995 35-39 24.745 25.224999999999998 25.335 24.695 40-44 24.64 24.925 25.119999999999997 25.314999999999998 45-49 25.415 25.009999999999998 24.745 24.83 50-54 24.445 25.22 25.480000000000004 24.855 55-59 24.355 25.485000000000003 25.540000000000003 24.62 60-64 24.385 24.7 25.245 25.669999999999998 65-69 25.011250562528126 24.366218310915546 25.91629581479074 24.706235311765585 70-74 24.310000000000002 24.265 25.919999999999998 25.505 75-79 24.555 24.665 25.915 24.865000000000002 80-84 24.665 25.09 24.755 25.490000000000002 85-89 24.86 25.255 25.16 24.725 90-94 24.77 25.805 24.825 24.6 95-99 25.540000000000003 24.92 24.755 24.785 100-104 24.649859943977592 25.04501800720288 25.055022008803522 25.250100040016004 105-109 24.775 24.490000000000002 25.629999999999995 25.105 110-114 24.623693554033103 24.96874531179677 26.038905835875383 24.368655298294744 115-119 24.62246224622462 25.577557755775576 24.98249824982498 24.817481748174817 120-124 25.121328863761445 25.686696352629205 24.495922349527195 24.69605243408215 125-129 25.42262678803641 25.487646293888165 24.00220066019806 25.087526257877364 130-134 25.041260315078766 24.781195298824706 25.441360340085023 24.736184046011502 135-139 24.72596226037339 25.73702387506882 24.79103058211122 24.745983282446566 140-144 25.276319079769944 26.65166291572893 24.031007751937985 24.04101025256314 145-149 25.335 27.015 23.599999999999998 24.05 150 25.4 26.950000000000003 22.675 24.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.5 25 5.0 26 5.5 27 6.0 28 8.5 29 10.0 30 10.5 31 14.5 32 14.0 33 15.0 34 28.0 35 40.0 36 45.0 37 49.5 38 53.5 39 67.5 40 84.5 41 111.0 42 136.0 43 165.5 44 211.0 45 211.5 46 179.0 47 176.5 48 199.5 49 213.5 50 207.5 51 194.0 52 185.0 53 165.5 54 147.5 55 135.0 56 121.0 57 101.0 58 79.5 59 83.0 60 81.0 61 60.5 62 55.5 63 51.5 64 35.5 65 28.5 66 20.5 67 21.5 68 32.0 69 27.5 70 19.5 71 13.5 72 9.0 73 10.0 74 8.0 75 5.0 76 6.0 77 9.5 78 9.0 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.325000000000001 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.015 115-119 0.01 120-124 0.065 125-129 0.03 130-134 0.025 135-139 0.105 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.175 #Duplication Level Percentage of deduplicated Percentage of total 1 89.45279274170683 78.875 2 8.364048766657216 14.75 3 1.587751630280692 4.2 4 0.5387014459880919 1.9 5 0.02835270768358378 0.125 6 0.02835270768358378 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATAGACTCGTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACAT 6 0.15 No Hit CTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 1.175 0.0 0.0 0.0 0.0 138 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGT 10 0.006993593 143.86249 8 TTGAGTG 10 0.006993593 143.86249 9 ATCTGAC 10 0.006993593 143.86249 7 TTTGTGT 40 2.5465852E-11 125.879684 2 GTTTGAG 35 1.540684E-9 123.31071 7 TTTGAGG 25 5.93235E-6 115.090004 8 GTGTTTG 45 6.366463E-11 111.89305 5 TGTGTTT 45 6.366463E-11 111.89305 4 CTTTGTG 55 9.094947E-11 106.14361 1 TGTTTGA 50 1.4551915E-10 100.70375 6 TTGTGTT 60 6.202754E-10 83.91979 3 >>END_MODULE SRR13857035 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857035_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.52625 32.0 2.0 32.0 2.0 32.0 2 30.045 32.0 32.0 32.0 27.0 32.0 3 32.045 32.0 32.0 37.0 32.0 37.0 4 32.84875 37.0 27.0 37.0 27.0 37.0 5 34.54625 37.0 37.0 37.0 27.0 37.0 6 37.445 41.0 37.0 41.0 27.0 41.0 7 37.8645 41.0 37.0 41.0 32.0 41.0 8 38.60825 41.0 41.0 41.0 32.0 41.0 9 38.78275 41.0 41.0 41.0 37.0 41.0 10-14 38.8382 41.0 41.0 41.0 34.0 41.0 15-19 38.8292 41.0 41.0 41.0 34.0 41.0 20-24 39.0209 41.0 41.0 41.0 37.0 41.0 25-29 38.8725 41.0 41.0 41.0 33.0 41.0 30-34 38.902249999999995 41.0 41.0 41.0 33.0 41.0 35-39 38.8247 41.0 41.0 41.0 32.0 41.0 40-44 38.88745 41.0 41.0 41.0 34.0 41.0 45-49 38.54545 41.0 39.4 41.0 32.0 41.0 50-54 38.63674999999999 41.0 41.0 41.0 32.0 41.0 55-59 38.6526 41.0 41.0 41.0 32.0 41.0 60-64 38.680800000000005 41.0 41.0 41.0 32.0 41.0 65-69 38.4188 41.0 38.6 41.0 32.0 41.0 70-74 38.736749999999994 41.0 41.0 41.0 32.0 41.0 75-79 37.8489 40.2 37.6 41.0 31.0 41.0 80-84 38.61325 41.0 41.0 41.0 32.0 41.0 85-89 38.570499999999996 41.0 39.4 41.0 32.0 41.0 90-94 38.40215 41.0 37.0 41.0 32.0 41.0 95-99 38.1828 41.0 37.0 41.0 32.0 41.0 100-104 38.00815 41.0 37.0 41.0 32.0 41.0 105-109 37.656400000000005 41.0 37.0 41.0 30.0 41.0 110-114 37.36985 41.0 37.0 41.0 28.0 41.0 115-119 36.995999999999995 41.0 37.0 41.0 27.0 41.0 120-124 36.654599999999995 41.0 37.0 41.0 27.0 41.0 125-129 36.285399999999996 41.0 37.0 41.0 23.0 41.0 130-134 35.7308 41.0 33.0 41.0 22.0 41.0 135-139 35.37765 41.0 32.0 41.0 22.0 41.0 140-144 34.6946 41.0 32.0 41.0 22.0 41.0 145-149 34.51684999999999 38.6 32.0 41.0 22.0 41.0 150 34.103 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 7.0 23 21.0 24 24.0 25 34.0 26 48.0 27 39.0 28 59.0 29 73.0 30 72.0 31 82.0 32 96.0 33 121.0 34 116.0 35 148.0 36 209.0 37 278.0 38 367.0 39 830.0 40 1376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.28225806451613 24.233870967741936 19.838709677419356 40.64516129032258 2 19.3 22.425 42.65 15.625 3 19.725 24.0 33.35 22.925 4 20.95 20.599999999999998 35.175 23.275000000000002 5 30.9 21.55 27.375 20.175 6 21.75 23.225 34.449999999999996 20.575 7 26.450000000000003 22.8 29.475 21.275 8 19.1 21.975 38.3 20.625 9 23.9 20.25 35.075 20.775 10-14 24.891244562228113 25.29626481324066 26.451322566128304 23.36116805840292 15-19 25.635 23.995 25.424999999999997 24.945 20-24 24.536226811340565 24.556227811390567 26.651332566628334 24.25621281064053 25-29 24.255 25.36 25.86 24.525 30-34 24.71123556177809 24.851242562128107 25.591279563978198 24.846242312115603 35-39 25.011250562528126 24.761238061903097 25.591279563978198 24.636231811590577 40-44 24.511225561278064 25.641282064103205 25.031251562578127 24.8162408120406 45-49 25.752575257525752 24.887488748874887 24.53745374537454 24.822482248224823 50-54 24.36 25.314999999999998 25.135 25.19 55-59 25.095 24.88 25.05 24.975 60-64 24.755 24.495 25.855 24.895 65-69 25.131256562828142 24.64623231161558 25.386269313465675 24.836241812090602 70-74 24.279999999999998 24.665 26.150000000000002 24.905 75-79 24.610000000000003 24.86 25.185000000000002 25.345000000000002 80-84 24.81 25.314999999999998 25.28 24.595 85-89 24.485 25.235000000000003 25.230000000000004 25.05 90-94 24.610000000000003 26.015 24.945 24.43 95-99 24.865000000000002 25.019999999999996 24.48 25.635 100-104 25.174999999999997 25.025 25.230000000000004 24.57 105-109 24.39 24.9 25.474999999999998 25.235000000000003 110-114 24.404999999999998 24.875 25.95 24.77 115-119 24.465 25.009999999999998 25.28 25.245 120-124 24.645 25.415 25.255 24.685000000000002 125-129 25.419999999999998 24.610000000000003 24.490000000000002 25.480000000000004 130-134 24.779999999999998 24.93 26.16 24.13 135-139 24.755 25.715 25.119999999999997 24.41 140-144 25.46 26.119999999999997 24.34 24.08 145-149 25.474999999999998 26.640000000000004 23.465 24.42 150 26.825 25.575 22.15 25.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.5 21 1.5 22 2.0 23 2.5 24 2.5 25 1.5 26 6.5 27 8.0 28 6.5 29 6.5 30 8.5 31 11.5 32 18.5 33 23.5 34 24.5 35 34.5 36 46.0 37 57.5 38 65.5 39 64.5 40 87.0 41 120.0 42 136.5 43 174.5 44 204.0 45 214.5 46 199.0 47 174.0 48 186.0 49 225.5 50 224.5 51 182.0 52 162.0 53 155.0 54 146.0 55 130.0 56 114.0 57 98.5 58 92.0 59 99.0 60 84.5 61 56.0 62 47.5 63 46.0 64 33.5 65 26.5 66 26.5 67 26.0 68 30.0 69 23.0 70 11.0 71 8.0 72 8.5 73 7.5 74 8.5 75 7.0 76 9.5 77 10.0 78 3.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 38.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.005 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97817189631651 84.275 2 7.121418826739427 13.05 3 0.7094133697135061 1.95 4 0.1637107776261937 0.6 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCGC 10 9.186966E-4 280.02438 1 CCGCCCG 10 0.007044714 143.5125 4 TCCGCCC 15 1.1889927E-4 143.5125 3 TTTGTGT 30 1.4860407E-5 95.674995 2 GTTTGAG 35 0.0034505918 61.505356 5 GTGTTTG 55 2.995194E-4 52.186363 5 TGTTTGA 55 2.995194E-4 52.186363 6 TGTGTTT 60 4.6026285E-4 47.837498 4 TTGTGTT 65 6.8305345E-4 44.15769 3 >>END_MODULE Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260812 spots for SRR13857035.sra Written 1260812 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra Read 1260793 spots for SRR13857035.sra Written 1260793 spots for SRR13857035.sra SRR ids: ['SRR13857035.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j7zi27oi SRR13857035.sra spots: 25215879 blocks: [[1, 1260793], [1260794, 2521586], [2521587, 3782379], [3782380, 5043172], [5043173, 6303965], [6303966, 7564758], [7564759, 8825551], [8825552, 10086344], [10086345, 11347137], [11347138, 12607930], [12607931, 13868723], [13868724, 15129516], [15129517, 16390309], [16390310, 17651102], [17651103, 18911895], [18911896, 20172688], [20172689, 21433481], [21433482, 22694274], [22694275, 23955067], [23955068, 25215879]] SRR13857035 file size 8498508 SRR13857035 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857035 SRR13857035_1.fastq SRR13857035_2.fastq Input file: SRR13857035_1.fastq Paired file: SRR13857035_2.fastq trimmed: SRR13857035-trimmed-pair1.fastq, SRR13857035-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:37:56 2025 >> started Tue Feb 11 20:38:22 2025 >> done (26.863s) 25215879 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 29 ( 0.00%) empty read pairs filtered out after trimming by size control 25215833 (100.00%) read pairs available; of these: 3098934 (12.29%) trimmed read pairs available after processing 22116899 (87.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 5 0.00% 22 8 0.00% 23 11 0.00% 24 11 0.00% 25 7 0.00% 26 23 0.00% 27 19 0.00% 28 7 0.00% 29 20 0.00% 30 18 0.00% 31 21 0.00% 32 22 0.00% 33 27 0.00% 34 18 0.00% 35 38 0.00% 36 21 0.00% 37 23 0.00% 38 21 0.00% 39 39 0.00% 40 20 0.00% 41 22 0.00% 42 20 0.00% 43 32 0.00% 44 20 0.00% 45 36 0.00% 46 24 0.00% 47 38 0.00% 48 37 0.00% 49 48 0.00% 50 50 0.00% 51 65 0.00% 52 64 0.00% 53 52 0.00% 54 60 0.00% 55 55 0.00% 56 58 0.00% 57 77 0.00% 58 57 0.00% 59 89 0.00% 60 58 0.00% 61 99 0.00% 62 63 0.00% 63 110 0.00% 64 60 0.00% 65 103 0.00% 66 120 0.00% 67 163 0.00% 68 151 0.00% 69 114 0.00% 70 171 0.00% 71 105 0.00% 72 264 0.00% 73 110 0.00% 74 84 0.00% 75 100 0.00% 76 71 0.00% 77 91 0.00% 78 77 0.00% 79 87 0.00% 80 91 0.00% 81 99 0.00% 82 75 0.00% 83 94 0.00% 84 82 0.00% 85 83 0.00% 86 90 0.00% 87 106 0.00% 88 100 0.00% 89 72 0.00% 90 88 0.00% 91 108 0.00% 92 86 0.00% 93 83 0.00% 94 53 0.00% 95 66 0.00% 96 118 0.00% 97 65 0.00% 98 102 0.00% 99 78 0.00% 100 87 0.00% 101 77 0.00% 102 73 0.00% 103 85 0.00% 104 76 0.00% 105 70 0.00% 106 62 0.00% 107 66 0.00% 108 57 0.00% 109 68 0.00% 110 75 0.00% 111 86 0.00% 112 84 0.00% 113 87 0.00% 114 66 0.00% 115 83 0.00% 116 87 0.00% 117 94 0.00% 118 112 0.00% 119 113 0.00% 120 113 0.00% 121 119 0.00% 122 154 0.00% 123 149 0.00% 124 181 0.00% 125 190 0.00% 126 184 0.00% 127 168 0.00% 128 175 0.00% 129 211 0.00% 130 197 0.00% 131 209 0.00% 132 198 0.00% 133 947 0.00% 134 116593 0.46% 135 124393 0.49% 136 126021 0.50% 137 129745 0.51% 138 135281 0.54% 139 138773 0.55% 140 140281 0.56% 141 147019 0.58% 142 150048 0.60% 143 155319 0.62% 144 158207 0.63% 145 164114 0.65% 146 167091 0.66% 147 177386 0.70% 148 220020 0.87% 149 838602 3.33% 150 22116899 87.71% 25215833 reads passed initial QC criterion=sequence-density sequence-density=4.07 sequence-density-rank=1 fanout-score=1.03 fanout-score-rank=42 prefix-density=1.26 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.79 sequence-density-rank=8 fanout-score=69.94 fanout-score-rank=1 prefix-density=1.95 prefix-fanout=28.4 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=5.26 sequence-density-rank=1 fanout-score=1.29 fanout-score-rank=47 prefix-density=3.63 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=46 fanout-score=51.25 fanout-score-rank=1 prefix-density=1.71 prefix-fanout=1.8 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTGAGAATC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857035 SRR13857035_1.fastq SRR13857035_2.fastq Input file: SRR13857035_1.fastq Paired file: SRR13857035_2.fastq trimmed: SRR13857035-trimmed-pair1.fastq, SRR13857035-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:40:31 2025 >> started Tue Feb 11 20:40:48 2025 >> done (16.972s) 16810555 read pairs processed; of these: 175655 ( 1.04%) short read pairs filtered out after trimming by size control 100257 ( 0.60%) empty read pairs filtered out after trimming by size control 16534643 (98.36%) read pairs available; of these: 1095 ( 0.01%) trimmed read pairs available after processing 16533548 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 7 0.00% 24 7 0.00% 25 2 0.00% 26 12 0.00% 27 15 0.00% 28 4 0.00% 29 11 0.00% 30 12 0.00% 31 14 0.00% 32 17 0.00% 33 21 0.00% 34 15 0.00% 35 24 0.00% 36 12 0.00% 37 17 0.00% 38 18 0.00% 39 24 0.00% 40 18 0.00% 41 15 0.00% 42 11 0.00% 43 24 0.00% 44 15 0.00% 45 24 0.00% 46 17 0.00% 47 24 0.00% 48 26 0.00% 49 30 0.00% 50 31 0.00% 51 47 0.00% 52 42 0.00% 53 29 0.00% 54 35 0.00% 55 38 0.00% 56 40 0.00% 57 48 0.00% 58 37 0.00% 59 58 0.00% 60 42 0.00% 61 62 0.00% 62 40 0.00% 63 69 0.00% 64 36 0.00% 65 72 0.00% 66 77 0.00% 67 102 0.00% 68 104 0.00% 69 69 0.00% 70 113 0.00% 71 74 0.00% 72 183 0.00% 73 72 0.00% 74 51 0.00% 75 64 0.00% 76 51 0.00% 77 52 0.00% 78 42 0.00% 79 57 0.00% 80 53 0.00% 81 64 0.00% 82 45 0.00% 83 54 0.00% 84 47 0.00% 85 53 0.00% 86 56 0.00% 87 61 0.00% 88 67 0.00% 89 47 0.00% 90 58 0.00% 91 65 0.00% 92 54 0.00% 93 56 0.00% 94 36 0.00% 95 45 0.00% 96 76 0.00% 97 36 0.00% 98 67 0.00% 99 59 0.00% 100 58 0.00% 101 47 0.00% 102 42 0.00% 103 57 0.00% 104 54 0.00% 105 49 0.00% 106 41 0.00% 107 50 0.00% 108 31 0.00% 109 43 0.00% 110 43 0.00% 111 54 0.00% 112 55 0.00% 113 61 0.00% 114 51 0.00% 115 57 0.00% 116 51 0.00% 117 55 0.00% 118 71 0.00% 119 79 0.00% 120 68 0.00% 121 74 0.00% 122 101 0.00% 123 93 0.00% 124 119 0.00% 125 132 0.00% 126 120 0.00% 127 115 0.00% 128 105 0.00% 129 133 0.00% 130 124 0.00% 131 129 0.00% 132 140 0.00% 133 579 0.00% 134 76584 0.46% 135 82158 0.50% 136 82935 0.50% 137 85430 0.52% 138 89207 0.54% 139 91174 0.55% 140 92551 0.56% 141 96454 0.58% 142 98758 0.60% 143 102312 0.62% 144 104013 0.63% 145 107726 0.65% 146 110161 0.67% 147 116427 0.70% 148 144882 0.88% 149 549326 3.32% 150 14498073 87.68% criterion=sequence-density sequence-density=3.42 sequence-density-rank=1 fanout-score=1.04 fanout-score-rank=41 prefix-density=1.26 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.74 sequence-density-rank=7 fanout-score=69.79 fanout-score-rank=1 prefix-density=1.78 prefix-fanout=29.1 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=4.37 sequence-density-rank=1 fanout-score=1.29 fanout-score-rank=47 prefix-density=3.57 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=46 fanout-score=49.51 fanout-score-rank=1 prefix-density=1.69 prefix-fanout=1.8 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTGAGAATC SRR13857035 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:00:44 Started mapping on | Feb 11 21:00:44 Finished on | Feb 11 21:08:32 Mapping speed, Million of reads per hour | 191.84 Number of input reads | 24939608 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 7683635 Uniquely mapped reads % | 30.81% Average mapped length | 269.71 Number of splices: Total | 2788668 Number of splices: Annotated (sjdb) | 2662665 Number of splices: GT/AG | 2688620 Number of splices: GC/AG | 37858 Number of splices: AT/AC | 4229 Number of splices: Non-canonical | 57961 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 3.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 592490 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 11683060 % of reads mapped to too many loci | 46.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.97% % of reads unmapped: other | 8.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16663497 16663497 16663497 N_multimapping 592490 592490 592490 N_noFeature 3552751 5603151 5559441 N_ambiguous 141159 34217 33341 UnstrandedReadsAssigned:3989725 PositiveStrandReadsAssigned:2046267 NegativeStrandReadsAssigned:2090853 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857035 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857035-trimmed-pair1.fastq SRR13857035-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,939,608 reads, 18,795,615 reads pseudoaligned [quant] estimated average fragment length: 177.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR13857035.ke.tsv 34699 SRR13857035.se.tsv 87100 total ==> SRR13857035.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.51 132 2.45267 Potri.005G024800.1.v4.1 1035 858.512 0 0 Potri.004G059700.1.v4.1 961 784.512 64 2.79139 Potri.007G009000.2.v4.1 1416 1239.51 0 0 Potri.003G141000.2.v4.1 2943 2766.51 118.428 1.46475 Potri.016G087400.1.v4.1 270 102.939 125 41.55 Potri.015G069301.1.v4.1 564 387.582 0 0 Potri.010G195200.1.v4.1 1773 1596.51 1 0.0214323 Potri.012G127500.1.v4.1 977 800.512 7 0.299206 ==> SRR13857035.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 222 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857035 completed mapping pipeline successfully