Starting /dee2/code/volunteer_pipeline.sh SRR13857036 current disk space = 3053283463168 free memory = 1289744148 SRR13857036 SRAfilesize 37050a6afb9a230bb66874d80e0cd616 SRR13857036.sra SRR13857036.sra file validated SRR13857036 is paired end SRR13857036 is conventional basespace SRR13857036 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857036_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3275 32.0 32.0 32.0 2.0 32.0 2 31.44375 32.0 32.0 32.0 32.0 32.0 3 35.07375 37.0 32.0 37.0 32.0 37.0 4 35.98875 37.0 37.0 37.0 32.0 37.0 5 36.31875 37.0 37.0 37.0 37.0 37.0 6 39.72125 41.0 41.0 41.0 37.0 41.0 7 39.88975 41.0 41.0 41.0 37.0 41.0 8 39.8895 41.0 41.0 41.0 37.0 41.0 9 39.83925 41.0 41.0 41.0 37.0 41.0 10-14 39.96265 41.0 41.0 41.0 37.0 41.0 15-19 39.8769 41.0 41.0 41.0 37.0 41.0 20-24 39.83585 41.0 41.0 41.0 37.0 41.0 25-29 39.678549999999994 41.0 41.0 41.0 37.0 41.0 30-34 39.570299999999996 41.0 41.0 41.0 37.0 41.0 35-39 39.485 41.0 41.0 41.0 37.0 41.0 40-44 39.27055 41.0 41.0 41.0 37.0 41.0 45-49 39.1394 41.0 41.0 41.0 37.0 41.0 50-54 39.13615 41.0 41.0 41.0 37.0 41.0 55-59 39.02365 41.0 41.0 41.0 36.0 41.0 60-64 38.913 41.0 41.0 41.0 33.0 41.0 65-69 38.874300000000005 41.0 41.0 41.0 32.0 41.0 70-74 38.8439 41.0 41.0 41.0 32.0 41.0 75-79 38.457049999999995 41.0 40.2 41.0 32.0 41.0 80-84 38.74715 41.0 41.0 41.0 32.0 41.0 85-89 38.682849999999995 41.0 41.0 41.0 32.0 41.0 90-94 38.55345 41.0 41.0 41.0 32.0 41.0 95-99 38.469899999999996 41.0 41.0 41.0 32.0 41.0 100-104 38.33655 41.0 41.0 41.0 32.0 41.0 105-109 38.4088 41.0 41.0 41.0 32.0 41.0 110-114 38.227 41.0 41.0 41.0 32.0 41.0 115-119 37.89525 41.0 37.8 41.0 28.0 41.0 120-124 37.7468 41.0 37.0 41.0 27.0 41.0 125-129 37.56635 41.0 37.0 41.0 27.0 41.0 130-134 37.153499999999994 41.0 37.0 41.0 27.0 41.0 135-139 36.81914999999999 41.0 37.0 41.0 24.0 41.0 140-144 36.81715 41.0 37.0 41.0 24.0 41.0 145-149 36.24465000000001 41.0 37.0 41.0 22.0 41.0 150 36.2215 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 23.0 24 25.0 25 46.0 26 37.0 27 42.0 28 45.0 29 54.0 30 50.0 31 63.0 32 64.0 33 71.0 34 93.0 35 119.0 36 122.0 37 159.0 38 205.0 39 369.0 40 2409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.461538461538462 29.426573426573427 16.363636363636363 39.748251748251754 2 17.5 24.425 43.95 14.124999999999998 3 15.65 28.625 33.7 22.025 4 18.925 25.1 33.85 22.125 5 27.474999999999998 25.05 27.700000000000003 19.775000000000002 6 20.549999999999997 26.1 31.15 22.2 7 24.75 27.175 27.400000000000002 20.674999999999997 8 17.724999999999998 23.674999999999997 36.25 22.35 9 20.65 23.150000000000002 35.125 21.075 10-14 23.02 26.650000000000002 27.655 22.675 15-19 23.415 25.979999999999997 27.145000000000003 23.46 20-24 22.36 26.474999999999998 27.51 23.655 25-29 23.155 25.895000000000003 27.04 23.91 30-34 23.01 26.3 26.855 23.835 35-39 23.599999999999998 26.490000000000002 26.87 23.04 40-44 22.78 26.615 26.779999999999998 23.825 45-49 23.01 26.805 26.540000000000003 23.645 50-54 23.09 26.534999999999997 26.810000000000002 23.565 55-59 22.965 25.945 26.93 24.16 60-64 23.465 26.345000000000002 26.834999999999997 23.355 65-69 22.439999999999998 26.715 26.674999999999997 24.169999999999998 70-74 23.189999999999998 26.229999999999997 26.784999999999997 23.794999999999998 75-79 23.244999999999997 26.005 26.815 23.935000000000002 80-84 23.1 26.384999999999998 26.77 23.745 85-89 23.22 26.68 26.479999999999997 23.62 90-94 23.835 26.465 26.205000000000002 23.494999999999997 95-99 23.330000000000002 25.919999999999998 26.575 24.175 100-104 24.01100275068767 26.486621655413856 25.831457864466117 23.670917729432357 105-109 22.845 27.045 26.16 23.95 110-114 23.66973394678936 26.875375075015 25.79015803160632 23.664732946589318 115-119 23.376168808440422 27.05635281764088 26.431321566078303 23.13615680784039 120-124 22.96303706297204 27.499624868704046 25.653978892612418 23.8833591757115 125-129 23.575 27.05 25.6 23.775 130-134 23.07 27.200000000000003 26.035000000000004 23.695 135-139 22.947210407805855 27.73580185138854 26.129597197898423 23.18739054290718 140-144 23.169999999999998 28.79 25.195 22.845 145-149 23.599999999999998 28.694999999999997 24.755 22.95 150 23.150000000000002 29.5 24.75 22.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 2.0 15 4.0 16 3.5 17 3.0 18 2.5 19 2.0 20 4.0 21 6.0 22 4.0 23 5.5 24 10.0 25 14.5 26 16.0 27 15.0 28 17.5 29 23.5 30 25.0 31 26.0 32 30.5 33 37.0 34 52.0 35 64.5 36 78.0 37 89.5 38 101.5 39 116.5 40 142.0 41 163.0 42 164.0 43 180.0 44 198.5 45 202.5 46 191.5 47 191.5 48 193.0 49 183.0 50 175.0 51 154.0 52 131.5 53 122.5 54 101.5 55 78.5 56 77.5 57 75.0 58 78.0 59 80.5 60 62.0 61 38.0 62 32.5 63 35.5 64 26.5 65 21.5 66 19.5 67 20.0 68 21.5 69 14.5 70 12.0 71 11.0 72 8.5 73 5.5 74 2.5 75 3.0 76 5.0 77 8.0 78 8.0 79 2.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.02 115-119 0.005 120-124 0.034999999999999996 125-129 0.0 130-134 0.0 135-139 0.075 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.84455391351943 83.89999999999999 2 7.060755336617405 12.9 3 0.9031198686371099 2.475 4 0.16420361247947454 0.6 5 0.027367268746579094 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATTAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGG 15 1.1758804E-4 143.9125 8 ACCGGCG 10 0.0069863307 143.91249 8 TTGAGGG 10 0.0069863307 143.91249 9 TCTACCG 10 0.0069863307 143.91249 5 TACCGGC 10 0.0069863307 143.91249 7 CCTTCTA 10 0.0069863307 143.91249 2 TTCTACC 10 0.0069863307 143.91249 4 CTTCTAC 10 0.0069863307 143.91249 3 CCGGCGA 10 0.0069863307 143.91249 9 GTGTTTG 30 1.465636E-5 95.941666 5 TTTGTGT 30 1.465636E-5 95.941666 2 CTTTGTG 35 1.9755484E-5 90.12133 1 GTTTGAG 25 8.9778804E-4 86.3475 7 TGTTTGA 35 3.150676E-5 82.23571 6 TGTGTTT 35 3.150676E-5 82.23571 4 TTGTGTT 55 2.954291E-4 52.331818 3 >>END_MODULE SRR13857036 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857036_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.83375 27.0 2.0 32.0 2.0 32.0 2 30.67 32.0 32.0 32.0 27.0 32.0 3 32.44625 32.0 32.0 37.0 32.0 37.0 4 33.88625 37.0 32.0 37.0 27.0 37.0 5 34.79625 37.0 37.0 37.0 27.0 37.0 6 37.9025 41.0 37.0 41.0 27.0 41.0 7 37.92225 41.0 37.0 41.0 32.0 41.0 8 38.64375 41.0 41.0 41.0 32.0 41.0 9 38.509 41.0 41.0 41.0 32.0 41.0 10-14 38.7197 41.0 41.0 41.0 33.0 41.0 15-19 38.541000000000004 41.0 41.0 41.0 32.0 41.0 20-24 38.47875 41.0 41.0 41.0 32.0 41.0 25-29 38.49565 41.0 41.0 41.0 32.0 41.0 30-34 38.329950000000004 41.0 39.4 41.0 31.0 41.0 35-39 38.50509999999999 41.0 41.0 41.0 32.0 41.0 40-44 38.434250000000006 41.0 40.2 41.0 32.0 41.0 45-49 38.28869999999999 41.0 40.2 41.0 31.0 41.0 50-54 38.201499999999996 41.0 37.0 41.0 32.0 41.0 55-59 38.16825 41.0 37.8 41.0 32.0 41.0 60-64 38.01344999999999 41.0 37.0 41.0 31.0 41.0 65-69 38.23285 41.0 39.4 41.0 32.0 41.0 70-74 38.045049999999996 41.0 37.0 41.0 31.0 41.0 75-79 37.2857 40.2 36.0 41.0 29.0 41.0 80-84 38.00115 41.0 37.0 41.0 31.0 41.0 85-89 37.84665 41.0 37.0 41.0 30.0 41.0 90-94 37.44065 41.0 37.0 41.0 27.0 41.0 95-99 37.41495 41.0 37.0 41.0 28.0 41.0 100-104 37.11775 41.0 37.0 41.0 27.0 41.0 105-109 36.898849999999996 41.0 37.0 41.0 26.0 41.0 110-114 36.48995000000001 41.0 37.0 41.0 24.0 41.0 115-119 36.122299999999996 41.0 34.0 41.0 23.0 41.0 120-124 35.840799999999994 41.0 32.0 41.0 22.0 41.0 125-129 35.47235 41.0 32.0 41.0 22.0 41.0 130-134 34.815149999999996 41.0 32.0 41.0 20.0 41.0 135-139 34.629749999999994 41.0 32.0 41.0 18.0 41.0 140-144 33.968900000000005 38.6 28.0 41.0 14.0 41.0 145-149 33.509249999999994 37.0 28.0 41.0 12.0 41.0 150 32.603 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 12.0 23 28.0 24 46.0 25 54.0 26 62.0 27 53.0 28 83.0 29 101.0 30 111.0 31 108.0 32 128.0 33 101.0 34 151.0 35 162.0 36 198.0 37 227.0 38 325.0 39 635.0 40 1415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.672496025437203 29.252782193958666 18.40222575516693 38.672496025437205 2 17.275 24.525 43.375 14.825 3 17.375 28.9 32.550000000000004 21.175 4 20.4 24.45 33.25 21.9 5 28.575 24.275 27.275 19.875 6 20.525 27.05 31.474999999999998 20.95 7 24.175 25.674999999999997 29.4 20.75 8 17.549999999999997 22.75 37.65 22.05 9 21.0 22.6 34.75 21.65 10-14 23.330000000000002 26.005 28.4 22.264999999999997 15-19 24.285 25.895000000000003 26.900000000000002 22.919999999999998 20-24 22.955000000000002 26.02 28.075 22.95 25-29 23.724999999999998 25.275 27.994999999999997 23.005 30-34 23.035 25.91 27.73 23.325000000000003 35-39 23.14 26.015 27.675 23.169999999999998 40-44 24.165 26.14 27.245 22.45 45-49 23.86 25.575 27.43 23.135 50-54 24.0 27.095000000000002 26.495 22.41 55-59 23.39 25.695 27.27 23.645 60-64 23.815 25.85 27.229999999999997 23.105 65-69 23.39 26.13 27.525 22.955000000000002 70-74 23.84 25.41 27.839999999999996 22.91 75-79 23.474999999999998 26.005 27.21 23.31 80-84 23.605 26.384999999999998 27.21 22.8 85-89 23.085 26.88 27.224999999999998 22.81 90-94 23.77 25.935000000000002 27.029999999999998 23.265 95-99 23.89 26.314999999999998 26.745 23.05 100-104 23.505000000000003 26.57 26.674999999999997 23.25 105-109 23.225 26.119999999999997 27.279999999999998 23.375 110-114 23.369999999999997 25.679999999999996 27.615000000000002 23.335 115-119 23.565 26.0 27.925 22.509999999999998 120-124 23.785 26.169999999999998 27.655 22.39 125-129 23.745 25.635 27.58 23.04 130-134 23.330000000000002 26.474999999999998 27.125 23.07 135-139 23.73 26.865 26.889999999999997 22.515 140-144 23.605 27.1 26.82 22.475 145-149 24.77 27.145000000000003 25.585 22.5 150 24.8 27.925 25.3 21.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 1.0 7 1.5 8 2.0 9 1.0 10 1.5 11 2.5 12 2.0 13 1.0 14 1.5 15 1.0 16 4.5 17 6.0 18 2.5 19 4.5 20 6.0 21 6.5 22 9.5 23 7.5 24 7.5 25 11.5 26 10.0 27 11.5 28 16.5 29 22.5 30 27.0 31 33.0 32 39.5 33 42.0 34 50.0 35 67.5 36 74.5 37 72.5 38 91.5 39 118.0 40 136.0 41 158.5 42 175.0 43 194.0 44 219.5 45 214.0 46 190.5 47 179.0 48 190.5 49 189.0 50 156.5 51 150.5 52 146.5 53 127.0 54 101.5 55 85.5 56 87.5 57 83.5 58 73.0 59 63.0 60 55.5 61 41.0 62 35.0 63 35.5 64 35.0 65 27.0 66 14.0 67 10.5 68 13.0 69 12.5 70 9.0 71 7.0 72 5.0 73 6.0 74 4.5 75 1.0 76 2.0 77 3.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 37.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4591728525981 89.075 2 5.063626723223754 9.55 3 0.4506892895015907 1.275 4 0.02651113467656416 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra Read 1187749 spots for SRR13857036.sra Written 1187749 spots for SRR13857036.sra Read 1187745 spots for SRR13857036.sra Written 1187745 spots for SRR13857036.sra SRR ids: ['SRR13857036.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ylqmxrb SRR13857036.sra spots: 23754904 blocks: [[1, 1187745], [1187746, 2375490], [2375491, 3563235], [3563236, 4750980], [4750981, 5938725], [5938726, 7126470], [7126471, 8314215], [8314216, 9501960], [9501961, 10689705], [10689706, 11877450], [11877451, 13065195], [13065196, 14252940], [14252941, 15440685], [15440686, 16628430], [16628431, 17816175], [17816176, 19003920], [19003921, 20191665], [20191666, 21379410], [21379411, 22567155], [22567156, 23754904]] SRR13857036 file size 8004858 SRR13857036 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857036 SRR13857036_1.fastq SRR13857036_2.fastq Input file: SRR13857036_1.fastq Paired file: SRR13857036_2.fastq trimmed: SRR13857036-trimmed-pair1.fastq, SRR13857036-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:44:33 2025 >> started Tue Feb 11 19:45:02 2025 >> done (28.358s) 23754904 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 22 ( 0.00%) empty read pairs filtered out after trimming by size control 23754870 (100.00%) read pairs available; of these: 2931306 (12.34%) trimmed read pairs available after processing 20823564 (87.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 6 0.00% 23 7 0.00% 24 5 0.00% 25 15 0.00% 26 16 0.00% 27 11 0.00% 28 11 0.00% 29 10 0.00% 30 18 0.00% 31 14 0.00% 32 12 0.00% 33 11 0.00% 34 19 0.00% 35 21 0.00% 36 22 0.00% 37 22 0.00% 38 14 0.00% 39 31 0.00% 40 27 0.00% 41 18 0.00% 42 15 0.00% 43 32 0.00% 44 17 0.00% 45 31 0.00% 46 27 0.00% 47 47 0.00% 48 28 0.00% 49 38 0.00% 50 38 0.00% 51 57 0.00% 52 46 0.00% 53 64 0.00% 54 38 0.00% 55 52 0.00% 56 49 0.00% 57 64 0.00% 58 49 0.00% 59 86 0.00% 60 43 0.00% 61 100 0.00% 62 67 0.00% 63 115 0.00% 64 63 0.00% 65 141 0.00% 66 112 0.00% 67 154 0.00% 68 149 0.00% 69 91 0.00% 70 166 0.00% 71 95 0.00% 72 344 0.00% 73 99 0.00% 74 95 0.00% 75 111 0.00% 76 95 0.00% 77 116 0.00% 78 103 0.00% 79 94 0.00% 80 106 0.00% 81 89 0.00% 82 91 0.00% 83 108 0.00% 84 91 0.00% 85 97 0.00% 86 94 0.00% 87 106 0.00% 88 113 0.00% 89 94 0.00% 90 100 0.00% 91 126 0.00% 92 90 0.00% 93 78 0.00% 94 74 0.00% 95 90 0.00% 96 105 0.00% 97 81 0.00% 98 79 0.00% 99 116 0.00% 100 70 0.00% 101 104 0.00% 102 85 0.00% 103 79 0.00% 104 87 0.00% 105 76 0.00% 106 66 0.00% 107 88 0.00% 108 75 0.00% 109 90 0.00% 110 86 0.00% 111 113 0.00% 112 98 0.00% 113 123 0.00% 114 101 0.00% 115 108 0.00% 116 104 0.00% 117 119 0.00% 118 123 0.00% 119 157 0.00% 120 148 0.00% 121 174 0.00% 122 207 0.00% 123 181 0.00% 124 228 0.00% 125 264 0.00% 126 264 0.00% 127 243 0.00% 128 247 0.00% 129 325 0.00% 130 271 0.00% 131 319 0.00% 132 292 0.00% 133 1035 0.00% 134 110895 0.47% 135 116052 0.49% 136 120878 0.51% 137 123581 0.52% 138 127999 0.54% 139 132021 0.56% 140 134674 0.57% 141 138927 0.58% 142 140802 0.59% 143 145701 0.61% 144 147489 0.62% 145 152568 0.64% 146 155382 0.65% 147 165434 0.70% 148 204740 0.86% 149 802634 3.38% 150 20823564 87.66% 23754870 reads passed initial QC criterion=sequence-density sequence-density=2.16 sequence-density-rank=1 fanout-score=1.11 fanout-score-rank=41 prefix-density=0.54 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=101.37 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=4.30 sequence-density-rank=1 fanout-score=1.73 fanout-score-rank=48 prefix-density=4.87 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.29 sequence-density-rank=31 fanout-score=43.75 fanout-score-rank=1 prefix-density=8.83 prefix-fanout=1.4 sequence=TGTGTTTGAGCT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857036 SRR13857036_1.fastq SRR13857036_2.fastq Input file: SRR13857036_1.fastq Paired file: SRR13857036_2.fastq trimmed: SRR13857036-trimmed-pair1.fastq, SRR13857036-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:47:05 2025 >> started Tue Feb 11 19:47:18 2025 >> done (12.847s) 11877435 read pairs processed; of these: 66669 ( 0.56%) short read pairs filtered out after trimming by size control 32161 ( 0.27%) empty read pairs filtered out after trimming by size control 11778605 (99.17%) read pairs available; of these: 1822 ( 0.02%) trimmed read pairs available after processing 11776783 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 8 0.00% 26 7 0.00% 27 5 0.00% 28 6 0.00% 29 5 0.00% 30 8 0.00% 31 9 0.00% 32 5 0.00% 33 5 0.00% 34 8 0.00% 35 12 0.00% 36 14 0.00% 37 8 0.00% 38 8 0.00% 39 13 0.00% 40 13 0.00% 41 9 0.00% 42 7 0.00% 43 14 0.00% 44 8 0.00% 45 14 0.00% 46 12 0.00% 47 29 0.00% 48 14 0.00% 49 22 0.00% 50 24 0.00% 51 18 0.00% 52 23 0.00% 53 35 0.00% 54 18 0.00% 55 25 0.00% 56 21 0.00% 57 31 0.00% 58 24 0.00% 59 46 0.00% 60 18 0.00% 61 49 0.00% 62 35 0.00% 63 56 0.00% 64 41 0.00% 65 66 0.00% 66 59 0.00% 67 84 0.00% 68 73 0.00% 69 45 0.00% 70 88 0.00% 71 45 0.00% 72 162 0.00% 73 45 0.00% 74 48 0.00% 75 47 0.00% 76 37 0.00% 77 53 0.00% 78 51 0.00% 79 47 0.00% 80 45 0.00% 81 47 0.00% 82 50 0.00% 83 48 0.00% 84 42 0.00% 85 40 0.00% 86 49 0.00% 87 42 0.00% 88 57 0.00% 89 49 0.00% 90 57 0.00% 91 65 0.00% 92 35 0.00% 93 42 0.00% 94 38 0.00% 95 45 0.00% 96 47 0.00% 97 44 0.00% 98 36 0.00% 99 59 0.00% 100 33 0.00% 101 50 0.00% 102 41 0.00% 103 40 0.00% 104 32 0.00% 105 45 0.00% 106 32 0.00% 107 43 0.00% 108 36 0.00% 109 43 0.00% 110 38 0.00% 111 64 0.00% 112 55 0.00% 113 61 0.00% 114 53 0.00% 115 45 0.00% 116 49 0.00% 117 66 0.00% 118 54 0.00% 119 80 0.00% 120 74 0.00% 121 78 0.00% 122 105 0.00% 123 95 0.00% 124 113 0.00% 125 131 0.00% 126 126 0.00% 127 106 0.00% 128 113 0.00% 129 150 0.00% 130 130 0.00% 131 166 0.00% 132 178 0.00% 133 504 0.00% 134 55044 0.47% 135 57462 0.49% 136 59749 0.51% 137 61208 0.52% 138 63580 0.54% 139 65707 0.56% 140 66612 0.57% 141 68995 0.59% 142 70110 0.60% 143 72206 0.61% 144 72899 0.62% 145 76079 0.65% 146 77637 0.66% 147 82380 0.70% 148 102074 0.87% 149 397040 3.37% 150 10324165 87.65% criterion=sequence-density sequence-density=1.83 sequence-density-rank=1 fanout-score=1.12 fanout-score-rank=41 prefix-density=0.55 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=103.43 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=3.77 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=46 prefix-density=4.79 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.27 sequence-density-rank=34 fanout-score=45.14 fanout-score-rank=1 prefix-density=8.43 prefix-fanout=1.4 sequence=TGTGTTTGAGCT SRR13857036 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 20:06:58 Started mapping on | Feb 11 20:06:58 Finished on | Feb 11 20:12:33 Mapping speed, Million of reads per hour | 254.21 Number of input reads | 23655810 Average input read length | 270 UNIQUE READS: Uniquely mapped reads number | 10603849 Uniquely mapped reads % | 44.83% Average mapped length | 262.36 Number of splices: Total | 5839174 Number of splices: Annotated (sjdb) | 5698552 Number of splices: GT/AG | 5710825 Number of splices: GC/AG | 78815 Number of splices: AT/AC | 8101 Number of splices: Non-canonical | 41433 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465609 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 7418517 % of reads mapped to too many loci | 31.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.16% % of reads unmapped: other | 5.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 12586352 12586352 12586352 N_multimapping 465609 465609 465609 N_noFeature 2962782 6772007 6700214 N_ambiguous 205897 55342 56394 UnstrandedReadsAssigned:7435170 PositiveStrandReadsAssigned:3776500 NegativeStrandReadsAssigned:3847241 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR13857036 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857036-trimmed-pair1.fastq SRR13857036-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,655,810 reads, 18,275,583 reads pseudoaligned [quant] estimated average fragment length: 169.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR13857036.ke.tsv 34699 SRR13857036.se.tsv 87100 total ==> SRR13857036.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1849.37 195 4.71379 Potri.005G024800.1.v4.1 1035 866.371 2 0.103201 Potri.004G059700.1.v4.1 961 792.371 88 4.96493 Potri.007G009000.2.v4.1 1416 1247.37 0 0 Potri.003G141000.2.v4.1 2943 2774.37 150.137 2.41925 Potri.016G087400.1.v4.1 270 110.18 235 95.3508 Potri.015G069301.1.v4.1 564 395.437 0 0 Potri.010G195200.1.v4.1 1773 1604.37 0 0 Potri.012G127500.1.v4.1 977 808.371 3 0.165909 ==> SRR13857036.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 475 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857036 completed mapping pipeline successfully