Starting /dee2/code/volunteer_pipeline.sh SRR13857037 current disk space = 3053408317440 free memory = 1415686808 SRR13857037 SRAfilesize 3b5fda683e7692348a1d1ec2d32d760e SRR13857037.sra SRR13857037.sra file validated SRR13857037 is paired end SRR13857037 is conventional basespace SRR13857037 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857037_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.44 32.0 32.0 32.0 2.0 32.0 2 31.46375 32.0 32.0 32.0 32.0 32.0 3 34.99125 37.0 32.0 37.0 32.0 37.0 4 35.85125 37.0 37.0 37.0 32.0 37.0 5 36.24875 37.0 37.0 37.0 37.0 37.0 6 39.757 41.0 41.0 41.0 37.0 41.0 7 40.04775 41.0 41.0 41.0 37.0 41.0 8 39.969 41.0 41.0 41.0 37.0 41.0 9 40.055 41.0 41.0 41.0 37.0 41.0 10-14 40.16785 41.0 41.0 41.0 37.0 41.0 15-19 39.8973 41.0 41.0 41.0 37.0 41.0 20-24 39.80095 41.0 41.0 41.0 37.0 41.0 25-29 39.7986 41.0 41.0 41.0 37.0 41.0 30-34 39.6982 41.0 41.0 41.0 37.0 41.0 35-39 39.6234 41.0 41.0 41.0 37.0 41.0 40-44 39.552299999999995 41.0 41.0 41.0 37.0 41.0 45-49 39.459199999999996 41.0 41.0 41.0 37.0 41.0 50-54 39.2545 41.0 41.0 41.0 37.0 41.0 55-59 39.1368 41.0 41.0 41.0 37.0 41.0 60-64 39.1129 41.0 41.0 41.0 37.0 41.0 65-69 39.0458 41.0 41.0 41.0 36.0 41.0 70-74 38.9793 41.0 41.0 41.0 35.0 41.0 75-79 38.739250000000006 41.0 40.2 41.0 33.0 41.0 80-84 38.79860000000001 41.0 41.0 41.0 32.0 41.0 85-89 38.8997 41.0 41.0 41.0 33.0 41.0 90-94 38.8156 41.0 41.0 41.0 32.0 41.0 95-99 38.59765 41.0 41.0 41.0 32.0 41.0 100-104 38.51365 41.0 41.0 41.0 32.0 41.0 105-109 38.6166 41.0 41.0 41.0 32.0 41.0 110-114 38.45880000000001 41.0 41.0 41.0 32.0 41.0 115-119 38.18865 41.0 39.4 41.0 32.0 41.0 120-124 38.016200000000005 41.0 37.8 41.0 30.0 41.0 125-129 37.87785 41.0 37.8 41.0 29.0 41.0 130-134 37.6775 41.0 37.0 41.0 27.0 41.0 135-139 37.3433 41.0 37.0 41.0 27.0 41.0 140-144 37.34265 41.0 37.0 41.0 27.0 41.0 145-149 36.88225 41.0 37.0 41.0 25.0 41.0 150 36.71775 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 11.0 24 36.0 25 33.0 26 32.0 27 34.0 28 37.0 29 48.0 30 50.0 31 54.0 32 61.0 33 75.0 34 84.0 35 78.0 36 117.0 37 154.0 38 213.0 39 417.0 40 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.738598442714126 26.418242491657395 17.71412680756396 41.12903225806452 2 17.875 23.799999999999997 44.65 13.675 3 18.725 24.9 34.325 22.05 4 18.9 22.875 36.975 21.25 5 31.0 22.7 27.725 18.575 6 19.85 24.275 35.199999999999996 20.674999999999997 7 29.375 24.875 27.35 18.4 8 17.224999999999998 22.275 39.95 20.549999999999997 9 22.35 20.5 38.125 19.025 10-14 24.52 25.81 28.225 21.445 15-19 25.474999999999998 24.87 26.06 23.595 20-24 23.61 26.590000000000003 26.555 23.244999999999997 25-29 23.169999999999998 25.080000000000002 27.6 24.15 30-34 24.18 26.240000000000002 26.025 23.555 35-39 24.240000000000002 26.045 26.13 23.585 40-44 24.705 26.165 25.4 23.73 45-49 24.115000000000002 26.55 25.615 23.72 50-54 24.34 26.040000000000003 26.200000000000003 23.419999999999998 55-59 24.685000000000002 25.729999999999997 25.224999999999998 24.36 60-64 23.635 25.53 26.174999999999997 24.66 65-69 24.169999999999998 26.290000000000003 25.669999999999998 23.87 70-74 23.935000000000002 25.895000000000003 26.57 23.599999999999998 75-79 23.155 25.729999999999997 27.075 24.04 80-84 23.49 26.52 25.564999999999998 24.425 85-89 23.915 26.965 25.46 23.66 90-94 23.625 27.37 24.985 24.02 95-99 24.245 26.66 25.575 23.52 100-104 24.67987194877951 26.215486194477787 24.99499799919968 24.109643857543016 105-109 23.485 26.245 26.095000000000002 24.175 110-114 23.15694708412524 26.597979393818143 26.482944883465038 23.76212863859158 115-119 23.7 25.81 26.729999999999997 23.76 120-124 23.40436174469788 26.880752300920367 25.82533013205282 23.88955582232893 125-129 24.245 26.645000000000003 25.365 23.745 130-134 23.415 26.33 26.43 23.825 135-139 23.724234540724435 27.256353812287372 25.365219131478888 23.654192515509305 140-144 24.240000000000002 28.32 24.545 22.895 145-149 24.240000000000002 28.005000000000003 24.62 23.135 150 24.675 28.175 23.674999999999997 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 2.0 15 2.5 16 1.5 17 2.0 18 2.5 19 3.0 20 4.5 21 4.5 22 4.0 23 5.5 24 5.5 25 6.0 26 8.0 27 11.5 28 17.0 29 18.5 30 19.5 31 22.0 32 28.5 33 38.5 34 49.0 35 63.0 36 70.5 37 67.5 38 71.0 39 87.5 40 110.0 41 137.5 42 155.5 43 176.5 44 207.0 45 219.5 46 195.0 47 168.0 48 188.0 49 208.0 50 187.0 51 157.5 52 151.5 53 137.0 54 123.0 55 114.5 56 100.5 57 92.5 58 78.5 59 76.0 60 69.5 61 47.0 62 31.5 63 36.5 64 37.5 65 27.0 66 21.0 67 19.5 68 18.0 69 17.0 70 11.0 71 7.0 72 9.5 73 8.5 74 5.0 75 3.0 76 7.5 77 8.5 78 5.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.100000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.04 125-129 0.0 130-134 0.0 135-139 0.06 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.253805701633 82.425 2 7.389980625518959 13.350000000000001 3 0.941046221976197 2.55 4 0.3044561306393579 1.0999999999999999 5 0.05535566011624688 0.25 6 0.02767783005812344 0.15 7 0.02767783005812344 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 7 0.17500000000000002 No Hit CTTTGTGTTTGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCAC 6 0.15 No Hit ATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACA 5 0.125 No Hit GTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0125 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.1875 0.0 0.0 0.0 0.0 136-137 0.9125 0.0 0.0 0.0 0.0 138 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTG 65 0.0 145.58061 1 TCGGTGG 10 0.0069863307 143.91249 6 TTTGATG 10 0.0069863307 143.91249 8 TTTGTGT 65 0.0 132.84232 2 TTGTGTT 90 0.0 95.94167 3 TGTGTTT 90 0.0 95.94167 4 GTGTTTG 95 0.0 90.8921 5 TGTTTGA 100 0.0 86.3475 6 TTTGAGG 50 2.0008374E-6 71.95625 8 GTTTGAG 90 1.9099389E-10 63.961113 7 >>END_MODULE SRR13857037 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857037_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.81625 32.0 2.0 32.0 2.0 32.0 2 30.63125 32.0 32.0 32.0 27.0 32.0 3 31.92 32.0 32.0 37.0 22.0 37.0 4 32.66375 37.0 27.0 37.0 22.0 37.0 5 33.8475 37.0 37.0 37.0 27.0 37.0 6 37.283 41.0 37.0 41.0 27.0 41.0 7 38.053 41.0 37.0 41.0 32.0 41.0 8 38.4035 41.0 41.0 41.0 32.0 41.0 9 38.16725 41.0 37.0 41.0 32.0 41.0 10-14 38.3448 41.0 39.4 41.0 32.0 41.0 15-19 38.41905 41.0 41.0 41.0 32.0 41.0 20-24 38.3858 41.0 41.0 41.0 32.0 41.0 25-29 38.50895 41.0 41.0 41.0 32.0 41.0 30-34 38.496599999999994 41.0 41.0 41.0 32.0 41.0 35-39 38.47585 41.0 41.0 41.0 32.0 41.0 40-44 38.28365000000001 41.0 38.6 41.0 31.0 41.0 45-49 38.179649999999995 41.0 38.6 41.0 31.0 41.0 50-54 37.99105 41.0 37.0 41.0 30.0 41.0 55-59 37.97475 41.0 37.0 41.0 32.0 41.0 60-64 37.82665 41.0 37.0 41.0 29.0 41.0 65-69 38.1259 41.0 38.6 41.0 31.0 41.0 70-74 37.8635 41.0 37.0 41.0 30.0 41.0 75-79 37.033449999999995 40.2 36.0 41.0 26.0 41.0 80-84 37.928000000000004 41.0 37.0 41.0 31.0 41.0 85-89 37.7787 41.0 37.0 41.0 29.0 41.0 90-94 37.56965 41.0 37.0 41.0 27.0 41.0 95-99 37.3989 41.0 37.0 41.0 27.0 41.0 100-104 36.96625 41.0 37.0 41.0 27.0 41.0 105-109 36.76425 41.0 37.0 41.0 27.0 41.0 110-114 36.32789999999999 41.0 37.0 41.0 23.0 41.0 115-119 36.19605 41.0 34.0 41.0 23.0 41.0 120-124 35.697250000000004 41.0 32.0 41.0 22.0 41.0 125-129 35.371050000000004 41.0 32.0 41.0 22.0 41.0 130-134 34.902750000000005 41.0 32.0 41.0 22.0 41.0 135-139 34.34815 39.4 31.0 41.0 14.0 41.0 140-144 33.9757 39.4 29.0 41.0 12.0 41.0 145-149 33.50545 37.0 28.0 41.0 12.0 41.0 150 33.00175 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 41.0 24 45.0 25 59.0 26 79.0 27 66.0 28 87.0 29 98.0 30 96.0 31 108.0 32 107.0 33 124.0 34 143.0 35 170.0 36 188.0 37 224.0 38 339.0 39 649.0 40 1372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.68993839835729 27.145790554414784 21.560574948665298 38.60369609856263 2 17.05 24.425 44.7 13.825000000000001 3 18.0 25.35 34.025 22.625 4 18.65 22.25 38.1 21.0 5 31.8 21.475 28.849999999999998 17.875 6 20.825 22.875 37.075 19.225 7 28.525 24.5 29.7 17.275 8 18.45 21.125 40.975 19.45 9 22.575 21.325 37.475 18.625 10-14 24.23 24.745 29.189999999999998 21.834999999999997 15-19 25.19 24.645 26.595000000000002 23.57 20-24 23.54 25.715 27.644999999999996 23.1 25-29 23.080000000000002 25.145 27.944999999999997 23.830000000000002 30-34 23.830000000000002 25.85 26.93 23.39 35-39 24.310000000000002 25.845000000000002 26.595000000000002 23.25 40-44 23.915 25.525 26.82 23.74 45-49 23.985 25.235000000000003 26.66 24.12 50-54 24.279999999999998 26.02 26.16 23.54 55-59 24.455 24.959999999999997 27.11 23.474999999999998 60-64 23.95 24.79 27.515 23.745 65-69 23.78 25.665 27.305 23.25 70-74 23.494999999999997 25.665 27.255000000000003 23.585 75-79 23.705000000000002 25.75 27.11 23.435 80-84 23.74 25.615 26.415 24.23 85-89 23.47 26.405 26.729999999999997 23.395 90-94 23.71 26.83 25.974999999999998 23.485 95-99 24.36 26.52 25.855 23.265 100-104 23.995 25.324999999999996 26.665 24.015 105-109 23.485 24.990000000000002 27.305 24.22 110-114 23.52 25.674999999999997 27.205000000000002 23.599999999999998 115-119 23.61 25.874999999999996 26.465 24.05 120-124 23.69 25.569999999999997 26.584999999999997 24.154999999999998 125-129 24.455 26.529999999999998 25.485000000000003 23.53 130-134 22.86 25.69 26.61 24.84 135-139 23.775 26.19 26.195 23.84 140-144 24.044999999999998 26.985 25.655 23.315 145-149 24.915000000000003 26.845000000000002 24.705 23.535 150 23.125 26.575 25.924999999999997 24.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.5 7 1.0 8 0.5 9 1.0 10 0.5 11 0.0 12 1.0 13 2.0 14 1.5 15 4.5 16 6.0 17 3.5 18 2.5 19 1.5 20 2.5 21 3.5 22 3.5 23 5.0 24 6.5 25 6.5 26 9.5 27 15.0 28 14.5 29 16.0 30 21.5 31 28.0 32 33.0 33 40.0 34 55.0 35 65.5 36 71.5 37 76.0 38 92.0 39 109.5 40 114.5 41 136.5 42 161.0 43 181.0 44 214.5 45 216.5 46 187.5 47 173.0 48 178.0 49 188.0 50 175.5 51 150.0 52 143.5 53 148.0 54 135.5 55 109.0 56 94.0 57 86.5 58 76.5 59 70.0 60 61.5 61 49.0 62 39.5 63 36.0 64 28.0 65 24.0 66 22.5 67 19.0 68 18.0 69 13.0 70 8.0 71 5.5 72 6.5 73 6.0 74 4.0 75 3.5 76 3.5 77 3.0 78 3.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 39.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.14281893554426 88.0 2 5.028082374966568 9.4 3 0.6686279753944906 1.875 4 0.05349023803155924 0.2 5 0.08023535704733886 0.375 6 0.02674511901577962 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTTTGTGTTTGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGC 6 0.15 No Hit CTTTGTGTTTGAGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGA 5 0.125 No Hit NAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCT 5 0.125 No Hit CTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.037500000000000006 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.2125 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTG 55 3.5035737E-7 95.0 1 TTTGTGT 70 2.0008883E-11 82.10715 2 GTTTGAC 30 0.0018633902 71.84375 7 TGTGTTT 90 1.9463187E-10 63.86111 4 TTGTGTT 95 3.1468517E-10 60.500004 3 GTGTTTG 105 7.6579454E-10 54.738094 5 TGTTTGA 115 1.718945E-9 49.97826 6 >>END_MODULE Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra Read 1332186 spots for SRR13857037.sra Written 1332186 spots for SRR13857037.sra Read 1332180 spots for SRR13857037.sra Written 1332180 spots for SRR13857037.sra SRR ids: ['SRR13857037.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1rnjis8c SRR13857037.sra spots: 26643606 blocks: [[1, 1332180], [1332181, 2664360], [2664361, 3996540], [3996541, 5328720], [5328721, 6660900], [6660901, 7993080], [7993081, 9325260], [9325261, 10657440], [10657441, 11989620], [11989621, 13321800], [13321801, 14653980], [14653981, 15986160], [15986161, 17318340], [17318341, 18650520], [18650521, 19982700], [19982701, 21314880], [21314881, 22647060], [22647061, 23979240], [23979241, 25311420], [25311421, 26643606]] SRR13857037 file size 8980924 SRR13857037 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857037 SRR13857037_1.fastq SRR13857037_2.fastq Input file: SRR13857037_1.fastq Paired file: SRR13857037_2.fastq trimmed: SRR13857037-trimmed-pair1.fastq, SRR13857037-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:04:02 2025 >> started Tue Feb 11 19:15:03 2025 >> done (660.502s) 26643606 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 44 ( 0.00%) empty read pairs filtered out after trimming by size control 26643538 (100.00%) read pairs available; of these: 3203251 (12.02%) trimmed read pairs available after processing 23440287 (87.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 7 0.00% 22 9 0.00% 23 10 0.00% 24 11 0.00% 25 10 0.00% 26 20 0.00% 27 25 0.00% 28 16 0.00% 29 13 0.00% 30 13 0.00% 31 21 0.00% 32 18 0.00% 33 36 0.00% 34 26 0.00% 35 43 0.00% 36 31 0.00% 37 42 0.00% 38 24 0.00% 39 33 0.00% 40 33 0.00% 41 40 0.00% 42 38 0.00% 43 67 0.00% 44 45 0.00% 45 58 0.00% 46 55 0.00% 47 77 0.00% 48 50 0.00% 49 77 0.00% 50 70 0.00% 51 117 0.00% 52 93 0.00% 53 84 0.00% 54 74 0.00% 55 114 0.00% 56 104 0.00% 57 124 0.00% 58 120 0.00% 59 193 0.00% 60 106 0.00% 61 163 0.00% 62 128 0.00% 63 195 0.00% 64 119 0.00% 65 190 0.00% 66 178 0.00% 67 259 0.00% 68 209 0.00% 69 194 0.00% 70 213 0.00% 71 151 0.00% 72 500 0.00% 73 156 0.00% 74 154 0.00% 75 174 0.00% 76 119 0.00% 77 177 0.00% 78 174 0.00% 79 164 0.00% 80 137 0.00% 81 151 0.00% 82 144 0.00% 83 164 0.00% 84 159 0.00% 85 141 0.00% 86 156 0.00% 87 172 0.00% 88 161 0.00% 89 158 0.00% 90 164 0.00% 91 213 0.00% 92 144 0.00% 93 121 0.00% 94 112 0.00% 95 137 0.00% 96 169 0.00% 97 131 0.00% 98 141 0.00% 99 130 0.00% 100 131 0.00% 101 147 0.00% 102 140 0.00% 103 118 0.00% 104 106 0.00% 105 116 0.00% 106 133 0.00% 107 125 0.00% 108 97 0.00% 109 113 0.00% 110 122 0.00% 111 150 0.00% 112 124 0.00% 113 118 0.00% 114 154 0.00% 115 130 0.00% 116 142 0.00% 117 127 0.00% 118 153 0.00% 119 200 0.00% 120 199 0.00% 121 229 0.00% 122 221 0.00% 123 235 0.00% 124 264 0.00% 125 278 0.00% 126 293 0.00% 127 298 0.00% 128 303 0.00% 129 312 0.00% 130 316 0.00% 131 292 0.00% 132 324 0.00% 133 1130 0.00% 134 113401 0.43% 135 120353 0.45% 136 123162 0.46% 137 127096 0.48% 138 130225 0.49% 139 135759 0.51% 140 137042 0.51% 141 143716 0.54% 142 144854 0.54% 143 150827 0.57% 144 154182 0.58% 145 160001 0.60% 146 162527 0.61% 147 177442 0.67% 148 228190 0.86% 149 978352 3.67% 150 23440287 87.98% 26643538 reads passed initial QC criterion=sequence-density sequence-density=5.55 sequence-density-rank=1 fanout-score=1.03 fanout-score-rank=44 prefix-density=2.24 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=1.35 sequence-density-rank=7 fanout-score=57.92 fanout-score-rank=1 prefix-density=2.91 prefix-fanout=26.9 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=7.61 sequence-density-rank=1 fanout-score=1.30 fanout-score-rank=45 prefix-density=6.96 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.48 sequence-density-rank=33 fanout-score=38.40 fanout-score-rank=1 prefix-density=14.56 prefix-fanout=1.3 sequence=TGTGTTTGAGGA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857037 SRR13857037_1.fastq SRR13857037_2.fastq Input file: SRR13857037_1.fastq Paired file: SRR13857037_2.fastq trimmed: SRR13857037-trimmed-pair1.fastq, SRR13857037-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:17:33 2025 >> started Tue Feb 11 19:18:04 2025 >> done (30.693s) 19031099 read pairs processed; of these: 224926 ( 1.18%) short read pairs filtered out after trimming by size control 163164 ( 0.86%) empty read pairs filtered out after trimming by size control 18643009 (97.96%) read pairs available; of these: 4245 ( 0.02%) trimmed read pairs available after processing 18638764 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 8 0.00% 23 7 0.00% 24 8 0.00% 25 4 0.00% 26 14 0.00% 27 21 0.00% 28 9 0.00% 29 12 0.00% 30 7 0.00% 31 15 0.00% 32 12 0.00% 33 19 0.00% 34 20 0.00% 35 28 0.00% 36 25 0.00% 37 29 0.00% 38 18 0.00% 39 27 0.00% 40 28 0.00% 41 29 0.00% 42 31 0.00% 43 50 0.00% 44 33 0.00% 45 35 0.00% 46 43 0.00% 47 54 0.00% 48 37 0.00% 49 53 0.00% 50 53 0.00% 51 85 0.00% 52 71 0.00% 53 51 0.00% 54 50 0.00% 55 82 0.00% 56 69 0.00% 57 83 0.00% 58 80 0.00% 59 135 0.00% 60 67 0.00% 61 118 0.00% 62 82 0.00% 63 139 0.00% 64 88 0.00% 65 139 0.00% 66 125 0.00% 67 177 0.00% 68 135 0.00% 69 145 0.00% 70 163 0.00% 71 104 0.00% 72 360 0.00% 73 117 0.00% 74 106 0.00% 75 129 0.00% 76 78 0.00% 77 118 0.00% 78 128 0.00% 79 116 0.00% 80 105 0.00% 81 108 0.00% 82 105 0.00% 83 109 0.00% 84 115 0.00% 85 93 0.00% 86 110 0.00% 87 128 0.00% 88 118 0.00% 89 110 0.00% 90 109 0.00% 91 156 0.00% 92 102 0.00% 93 81 0.00% 94 80 0.00% 95 97 0.00% 96 125 0.00% 97 82 0.00% 98 107 0.00% 99 86 0.00% 100 92 0.00% 101 94 0.00% 102 99 0.00% 103 86 0.00% 104 64 0.00% 105 85 0.00% 106 89 0.00% 107 84 0.00% 108 69 0.00% 109 85 0.00% 110 87 0.00% 111 100 0.00% 112 86 0.00% 113 92 0.00% 114 109 0.00% 115 92 0.00% 116 102 0.00% 117 90 0.00% 118 111 0.00% 119 146 0.00% 120 147 0.00% 121 164 0.00% 122 167 0.00% 123 171 0.00% 124 178 0.00% 125 207 0.00% 126 221 0.00% 127 212 0.00% 128 221 0.00% 129 224 0.00% 130 216 0.00% 131 206 0.00% 132 249 0.00% 133 774 0.00% 134 79724 0.43% 135 84656 0.45% 136 86626 0.46% 137 89384 0.48% 138 91866 0.49% 139 95076 0.51% 140 96179 0.52% 141 100926 0.54% 142 101736 0.55% 143 105633 0.57% 144 108194 0.58% 145 112273 0.60% 146 115326 0.62% 147 125163 0.67% 148 160529 0.86% 149 681913 3.66% 150 16396380 87.95% criterion=sequence-density sequence-density=4.70 sequence-density-rank=1 fanout-score=1.03 fanout-score-rank=43 prefix-density=2.26 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=1.30 sequence-density-rank=6 fanout-score=59.75 fanout-score-rank=1 prefix-density=2.73 prefix-fanout=28.4 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=6.49 sequence-density-rank=1 fanout-score=1.37 fanout-score-rank=45 prefix-density=6.85 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.46 sequence-density-rank=33 fanout-score=38.72 fanout-score-rank=1 prefix-density=13.96 prefix-fanout=1.3 sequence=TGTGTTTGACTT SRR13857037 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:20:18 Started mapping on | Feb 11 19:20:18 Finished on | Feb 11 19:33:04 Mapping speed, Million of reads per hour | 123.39 Number of input reads | 26255448 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10810473 Uniquely mapped reads % | 41.17% Average mapped length | 278.98 Number of splices: Total | 5138627 Number of splices: Annotated (sjdb) | 4923900 Number of splices: GT/AG | 4976699 Number of splices: GC/AG | 69884 Number of splices: AT/AC | 7571 Number of splices: Non-canonical | 84473 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672335 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 9779344 % of reads mapped to too many loci | 37.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.75% % of reads unmapped: other | 8.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14772640 14772640 14772640 N_multimapping 672335 672335 672335 N_noFeature 3789742 7274057 7220212 N_ambiguous 184638 38273 40831 UnstrandedReadsAssigned:6836093 PositiveStrandReadsAssigned:3498143 NegativeStrandReadsAssigned:3549430 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857037 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857037-trimmed-pair1.fastq SRR13857037-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,255,448 reads, 19,898,224 reads pseudoaligned [quant] estimated average fragment length: 190.325 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR13857037.ke.tsv 34699 SRR13857037.se.tsv 87100 total ==> SRR13857037.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.68 204 3.70808 Potri.005G024800.1.v4.1 1035 845.675 4 0.157221 Potri.004G059700.1.v4.1 961 771.675 37 1.59376 Potri.007G009000.2.v4.1 1416 1226.68 0 0 Potri.003G141000.2.v4.1 2943 2753.68 131 1.5813 Potri.016G087400.1.v4.1 270 94.0159 258 91.2166 Potri.015G069301.1.v4.1 564 374.772 0 0 Potri.010G195200.1.v4.1 1773 1583.68 0 0 Potri.012G127500.1.v4.1 977 787.675 2 0.0843992 ==> SRR13857037.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 469 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 70 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857037 completed mapping pipeline successfully