Starting /dee2/code/volunteer_pipeline.sh SRR13857038 current disk space = 3052949975040 free memory = 1506488400 SRR13857038 SRAfilesize 9a8c5d097a0835c9af6f07b132db8d9b SRR13857038.sra SRR13857038.sra file validated SRR13857038 is paired end SRR13857038 is conventional basespace SRR13857038 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857038_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.03875 32.0 32.0 32.0 2.0 32.0 2 31.405 32.0 32.0 32.0 32.0 32.0 3 34.6425 37.0 32.0 37.0 32.0 37.0 4 35.6525 37.0 37.0 37.0 32.0 37.0 5 35.9975 37.0 37.0 37.0 32.0 37.0 6 39.24325 41.0 41.0 41.0 37.0 41.0 7 39.40925 41.0 41.0 41.0 37.0 41.0 8 39.2545 41.0 41.0 41.0 37.0 41.0 9 39.38925 41.0 41.0 41.0 37.0 41.0 10-14 39.37065 41.0 41.0 41.0 37.0 41.0 15-19 39.211 41.0 41.0 41.0 37.0 41.0 20-24 38.94775 41.0 41.0 41.0 34.0 41.0 25-29 38.742999999999995 41.0 41.0 41.0 32.0 41.0 30-34 38.34565 41.0 40.2 41.0 32.0 41.0 35-39 38.37825 41.0 41.0 41.0 32.0 41.0 40-44 38.16329999999999 41.0 39.4 41.0 30.0 41.0 45-49 37.97405 41.0 37.8 41.0 27.0 41.0 50-54 37.8526 41.0 37.0 41.0 28.0 41.0 55-59 37.6631 41.0 37.0 41.0 27.0 41.0 60-64 37.38785 41.0 37.0 41.0 27.0 41.0 65-69 37.23819999999999 41.0 37.0 41.0 27.0 41.0 70-74 37.0735 41.0 37.0 41.0 27.0 41.0 75-79 36.6631 41.0 36.0 41.0 24.0 41.0 80-84 37.000699999999995 41.0 37.0 41.0 23.0 41.0 85-89 37.16745 41.0 37.0 41.0 25.0 41.0 90-94 36.8815 41.0 37.0 41.0 22.0 41.0 95-99 36.72945 41.0 37.0 41.0 22.0 41.0 100-104 36.540549999999996 41.0 37.0 41.0 22.0 41.0 105-109 36.4697 41.0 37.0 41.0 22.0 41.0 110-114 36.24305 41.0 37.0 41.0 22.0 41.0 115-119 35.84159999999999 41.0 36.0 41.0 22.0 41.0 120-124 35.5796 41.0 33.0 41.0 22.0 41.0 125-129 35.3076 41.0 33.0 41.0 16.0 41.0 130-134 34.98225 41.0 32.0 41.0 12.0 41.0 135-139 34.4379 41.0 32.0 41.0 12.0 41.0 140-144 34.25515 41.0 32.0 41.0 12.0 41.0 145-149 33.664199999999994 41.0 27.0 41.0 12.0 41.0 150 33.55075 41.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 8.0 23 47.0 24 83.0 25 87.0 26 82.0 27 91.0 28 90.0 29 110.0 30 99.0 31 107.0 32 95.0 33 108.0 34 112.0 35 122.0 36 124.0 37 170.0 38 255.0 39 373.0 40 1837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.874469889737066 28.696635566864575 15.889171614362455 43.539722929035904 2 14.174999999999999 26.125 44.45 15.25 3 14.6 29.575000000000003 35.125 20.7 4 16.25 26.25 37.0 20.5 5 26.650000000000002 26.724999999999998 28.275 18.35 6 19.825 26.700000000000003 34.125 19.35 7 25.7 27.125 28.249999999999996 18.925 8 16.725 23.974999999999998 40.775 18.525 9 19.325 23.925 37.925 18.825 10-14 22.36 28.065 29.025000000000002 20.549999999999997 15-19 23.195 27.200000000000003 27.74 21.865000000000002 20-24 22.175 27.99 28.384999999999998 21.45 25-29 22.045 28.27 28.144999999999996 21.54 30-34 22.595000000000002 28.125 28.125 21.154999999999998 35-39 22.205 28.64 27.560000000000002 21.595 40-44 22.905 27.915 27.675 21.505 45-49 22.425 27.845 27.91 21.82 50-54 22.2 28.095 27.76 21.945 55-59 22.395 27.994999999999997 27.13 22.48 60-64 22.384999999999998 27.339999999999996 27.884999999999998 22.39 65-69 21.965 28.105000000000004 27.400000000000002 22.53 70-74 22.24 28.1 27.675 21.985 75-79 22.115000000000002 28.189999999999998 27.389999999999997 22.305 80-84 22.18 27.925 27.26 22.634999999999998 85-89 22.3 28.89 26.900000000000002 21.91 90-94 22.21 28.535 26.590000000000003 22.665 95-99 22.335 28.449999999999996 26.540000000000003 22.675 100-104 22.567256725672564 28.102810281028102 26.787678767876788 22.542254225422543 105-109 22.075 27.975 27.055 22.895 110-114 22.24111205560278 28.641432071603578 27.01635081754088 22.101105055252763 115-119 22.33 28.475 27.04 22.155 120-124 22.214442888577715 27.940588117623527 27.28045609121824 22.564512902580518 125-129 22.1 29.12 26.700000000000003 22.08 130-134 22.2 28.615000000000002 26.935 22.25 135-139 22.30061042729911 29.52066446512559 26.548584008806163 21.630141098769137 140-144 22.785 29.7 26.02 21.495 145-149 22.605 30.345 25.580000000000002 21.47 150 21.85 29.4 26.424999999999997 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 4.0 2 4.0 3 4.5 4 5.5 5 3.5 6 0.5 7 0.5 8 1.0 9 1.0 10 1.0 11 1.5 12 0.5 13 1.5 14 2.0 15 2.5 16 3.0 17 3.5 18 6.5 19 6.5 20 7.5 21 7.5 22 7.5 23 15.5 24 20.0 25 23.0 26 29.5 27 27.5 28 32.5 29 40.0 30 47.0 31 62.5 32 69.0 33 80.5 34 87.0 35 100.0 36 114.0 37 116.0 38 122.0 39 140.0 40 156.5 41 154.0 42 164.0 43 178.5 44 191.0 45 191.0 46 164.5 47 146.5 48 147.0 49 140.0 50 133.0 51 117.5 52 102.0 53 107.5 54 93.0 55 70.5 56 64.5 57 62.0 58 61.5 59 57.5 60 51.5 61 36.5 62 26.0 63 29.0 64 29.0 65 23.5 66 16.5 67 14.5 68 12.0 69 9.5 70 9.5 71 8.5 72 7.5 73 6.0 74 3.5 75 2.0 76 2.5 77 3.5 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.575000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.06999999999999999 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67769706752757 87.05000000000001 2 5.380683346785042 10.0 3 0.6725854183481302 1.875 4 0.18832391713747645 0.7000000000000001 5 0.08071025020177562 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit TGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACATTGTCAGGTGGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTCAC 10 0.007017266 143.7 7 CTTTGTG 45 2.0008883E-11 127.73334 1 TTTGTGT 50 1.8189894E-12 114.96 2 GTTTGAA 20 3.718598E-4 107.774994 7 GTGTTTG 70 2.0008883E-11 82.11429 5 TGTTTGA 75 3.8198777E-11 76.64 6 TTGTGTT 75 3.8198777E-11 76.64 3 TGTGTTT 80 6.730261E-11 71.85 4 GATCGGA 40 1.0714053E-5 25.147501 140-144 ATCGGAA 30 0.0015215602 23.949999 140-144 AGATCGG 35 0.003726122 20.528572 140-144 >>END_MODULE SRR13857038 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857038_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.5525 12.0 2.0 32.0 2.0 32.0 2 30.94 32.0 32.0 32.0 32.0 32.0 3 31.765 32.0 32.0 37.0 22.0 37.0 4 32.8225 37.0 27.0 37.0 27.0 37.0 5 34.48375 37.0 37.0 37.0 27.0 37.0 6 37.27325 41.0 37.0 41.0 27.0 41.0 7 37.71275 41.0 37.0 41.0 27.0 41.0 8 38.3005 41.0 37.0 41.0 32.0 41.0 9 37.9195 41.0 37.0 41.0 27.0 41.0 10-14 38.22995 41.0 37.8 41.0 32.0 41.0 15-19 38.07365 41.0 37.0 41.0 32.0 41.0 20-24 37.94025 41.0 37.0 41.0 29.0 41.0 25-29 37.91095 41.0 37.0 41.0 29.0 41.0 30-34 37.59544999999999 41.0 37.0 41.0 28.0 41.0 35-39 37.71585 41.0 37.0 41.0 27.0 41.0 40-44 37.333400000000005 41.0 37.0 41.0 27.0 41.0 45-49 37.12505 41.0 37.0 41.0 27.0 41.0 50-54 36.943349999999995 41.0 37.0 41.0 27.0 41.0 55-59 36.949749999999995 41.0 37.0 41.0 27.0 41.0 60-64 36.7568 41.0 37.0 41.0 26.0 41.0 65-69 36.849199999999996 41.0 37.0 41.0 25.0 41.0 70-74 36.57385 41.0 37.0 41.0 22.0 41.0 75-79 35.7503 40.2 35.0 41.0 22.0 41.0 80-84 36.57275 41.0 37.0 41.0 24.0 41.0 85-89 36.332750000000004 41.0 37.0 41.0 22.0 41.0 90-94 35.88985 41.0 36.0 41.0 22.0 41.0 95-99 35.732150000000004 41.0 36.0 41.0 20.0 41.0 100-104 35.11749999999999 41.0 32.0 41.0 22.0 41.0 105-109 34.95615 41.0 32.0 41.0 16.0 41.0 110-114 34.40915 41.0 32.0 41.0 14.0 41.0 115-119 33.9006 39.4 30.0 41.0 12.0 41.0 120-124 33.3951 37.0 27.0 41.0 12.0 41.0 125-129 32.946749999999994 37.0 27.0 41.0 12.0 41.0 130-134 32.2397 37.0 27.0 41.0 12.0 41.0 135-139 31.792 37.0 26.0 41.0 12.0 41.0 140-144 31.2754 37.0 23.0 41.0 12.0 41.0 145-149 30.64235 36.0 22.0 41.0 12.0 41.0 150 29.92375 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 12.0 23 51.0 24 77.0 25 94.0 26 106.0 27 123.0 28 138.0 29 136.0 30 154.0 31 157.0 32 157.0 33 154.0 34 188.0 35 209.0 36 219.0 37 256.0 38 312.0 39 594.0 40 861.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.178654292343387 27.331786542923435 17.16937354988399 42.32018561484919 2 15.2 25.6 43.05 16.150000000000002 3 15.55 29.925 35.449999999999996 19.075 4 17.25 25.75 36.225 20.775 5 27.6 26.05 28.225 18.125 6 20.625 26.275 35.175 17.925 7 24.224999999999998 27.224999999999998 29.75 18.8 8 16.400000000000002 23.45 41.725 18.425 9 19.75 23.925 38.15 18.175 10-14 22.02 27.99 29.485 20.505000000000003 15-19 22.21 26.61 28.854999999999997 22.325 20-24 21.245 27.150000000000002 30.19 21.415 25-29 21.755 26.755000000000003 29.815 21.675 30-34 22.189999999999998 26.77 29.799999999999997 21.240000000000002 35-39 22.39 26.44 29.335 21.834999999999997 40-44 22.720000000000002 26.755000000000003 29.285 21.240000000000002 45-49 22.305 26.58 29.304999999999996 21.81 50-54 22.45 26.479999999999997 29.42 21.65 55-59 22.66 26.43 28.7 22.21 60-64 22.34 26.125 29.73 21.805 65-69 22.55 26.85 28.999999999999996 21.6 70-74 21.66 26.465 29.580000000000002 22.295 75-79 22.255 26.400000000000002 29.25 22.095000000000002 80-84 22.54 26.0 29.470000000000002 21.990000000000002 85-89 22.470000000000002 26.47 29.110000000000003 21.95 90-94 22.1 27.145000000000003 28.615000000000002 22.14 95-99 22.36 26.584999999999997 29.035 22.02 100-104 22.32 25.575 29.945 22.16 105-109 22.025 26.26 29.98 21.735 110-114 22.46 26.06 29.354999999999997 22.125 115-119 22.189999999999998 25.679999999999996 29.465000000000003 22.665 120-124 21.62 26.195 29.845 22.34 125-129 21.7 26.529999999999998 30.04 21.73 130-134 21.92 26.21 29.93 21.94 135-139 21.6 26.365 30.15 21.884999999999998 140-144 22.475 27.435 28.689999999999998 21.4 145-149 22.085 28.02 28.410000000000004 21.485000000000003 150 20.724999999999998 26.950000000000003 30.675 21.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.5 2 4.0 3 5.5 4 5.0 5 3.0 6 2.0 7 2.0 8 1.0 9 4.0 10 6.0 11 3.0 12 1.5 13 1.0 14 2.0 15 4.0 16 8.5 17 11.0 18 9.0 19 7.5 20 6.0 21 5.5 22 10.0 23 11.5 24 14.0 25 27.0 26 36.0 27 33.5 28 35.0 29 44.5 30 51.5 31 53.5 32 61.0 33 85.5 34 106.0 35 107.0 36 116.5 37 127.0 38 128.0 39 135.0 40 146.5 41 157.0 42 165.0 43 188.5 44 207.5 45 181.5 46 140.0 47 131.0 48 137.5 49 140.0 50 136.5 51 123.5 52 108.0 53 92.0 54 83.0 55 69.0 56 55.5 57 61.5 58 66.5 59 55.0 60 35.0 61 24.5 62 22.5 63 28.5 64 30.0 65 18.5 66 15.5 67 17.0 68 19.0 69 20.5 70 11.5 71 4.0 72 3.0 73 2.0 74 2.0 75 3.0 76 4.5 77 5.0 78 5.0 79 3.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 46.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1829428797052 90.4 2 4.448539089234009 8.450000000000001 3 0.2895498815477757 0.8250000000000001 4 0.052645433008686494 0.2 5 0.026322716504343247 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.075 0.0 0.0 0.0 0.0 134-135 0.425 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138 2.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTG 75 0.005652223 53.4093 1 TTTGTGT 100 2.264178E-6 43.061253 2 GTGTTTG 110 4.363439E-6 39.14659 5 TGTTTGA 115 5.9231133E-6 37.444565 6 TTGTGTT 115 5.9231133E-6 37.444565 3 TGTGTTT 120 7.9344845E-6 35.884373 4 GAGATCG 20 0.006236504 28.707497 140-144 ATCGGAA 30 0.0015316203 23.922916 140-144 GATCGGA 45 7.0138753E-4 19.138332 140-144 AGATCGG 40 0.0081159 17.942186 140-144 >>END_MODULE Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra Read 1408584 spots for SRR13857038.sra Written 1408584 spots for SRR13857038.sra Read 1408567 spots for SRR13857038.sra Written 1408567 spots for SRR13857038.sra SRR ids: ['SRR13857038.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1f10cdnw SRR13857038.sra spots: 28171357 blocks: [[1, 1408567], [1408568, 2817134], [2817135, 4225701], [4225702, 5634268], [5634269, 7042835], [7042836, 8451402], [8451403, 9859969], [9859970, 11268536], [11268537, 12677103], [12677104, 14085670], [14085671, 15494237], [15494238, 16902804], [16902805, 18311371], [18311372, 19719938], [19719939, 21128505], [21128506, 22537072], [22537073, 23945639], [23945640, 25354206], [25354207, 26762773], [26762774, 28171357]] SRR13857038 file size 9497137 SRR13857038 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857038 SRR13857038_1.fastq SRR13857038_2.fastq Input file: SRR13857038_1.fastq Paired file: SRR13857038_2.fastq trimmed: SRR13857038-trimmed-pair1.fastq, SRR13857038-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:42:59 2025 >> started Tue Feb 11 20:43:32 2025 >> done (32.196s) 28171357 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 41 ( 0.00%) empty read pairs filtered out after trimming by size control 28171311 (100.00%) read pairs available; of these: 3463227 (12.29%) trimmed read pairs available after processing 24708084 (87.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 13 0.00% 25 7 0.00% 26 6 0.00% 27 6 0.00% 28 14 0.00% 29 10 0.00% 30 13 0.00% 31 29 0.00% 32 7 0.00% 33 37 0.00% 34 23 0.00% 35 31 0.00% 36 26 0.00% 37 25 0.00% 38 23 0.00% 39 42 0.00% 40 24 0.00% 41 43 0.00% 42 26 0.00% 43 56 0.00% 44 31 0.00% 45 54 0.00% 46 45 0.00% 47 61 0.00% 48 49 0.00% 49 78 0.00% 50 56 0.00% 51 87 0.00% 52 75 0.00% 53 104 0.00% 54 73 0.00% 55 81 0.00% 56 108 0.00% 57 78 0.00% 58 81 0.00% 59 148 0.00% 60 83 0.00% 61 144 0.00% 62 127 0.00% 63 188 0.00% 64 126 0.00% 65 209 0.00% 66 170 0.00% 67 275 0.00% 68 261 0.00% 69 197 0.00% 70 248 0.00% 71 155 0.00% 72 644 0.00% 73 146 0.00% 74 190 0.00% 75 178 0.00% 76 156 0.00% 77 166 0.00% 78 135 0.00% 79 158 0.00% 80 159 0.00% 81 152 0.00% 82 155 0.00% 83 151 0.00% 84 161 0.00% 85 136 0.00% 86 117 0.00% 87 166 0.00% 88 174 0.00% 89 130 0.00% 90 154 0.00% 91 242 0.00% 92 153 0.00% 93 154 0.00% 94 124 0.00% 95 127 0.00% 96 199 0.00% 97 160 0.00% 98 173 0.00% 99 168 0.00% 100 151 0.00% 101 169 0.00% 102 136 0.00% 103 138 0.00% 104 157 0.00% 105 180 0.00% 106 145 0.00% 107 145 0.00% 108 150 0.00% 109 157 0.00% 110 141 0.00% 111 168 0.00% 112 191 0.00% 113 196 0.00% 114 194 0.00% 115 174 0.00% 116 213 0.00% 117 219 0.00% 118 276 0.00% 119 304 0.00% 120 321 0.00% 121 364 0.00% 122 380 0.00% 123 406 0.00% 124 448 0.00% 125 453 0.00% 126 521 0.00% 127 529 0.00% 128 470 0.00% 129 533 0.00% 130 480 0.00% 131 491 0.00% 132 468 0.00% 133 1495 0.01% 134 117628 0.42% 135 123211 0.44% 136 125351 0.44% 137 129274 0.46% 138 131058 0.47% 139 137027 0.49% 140 136688 0.49% 141 143699 0.51% 142 143907 0.51% 143 149855 0.53% 144 150869 0.54% 145 155735 0.55% 146 157444 0.56% 147 172597 0.61% 148 250122 0.89% 149 1218992 4.33% 150 24708084 87.71% 28171311 reads passed initial QC criterion=sequence-density sequence-density=4.27 sequence-density-rank=1 fanout-score=1.12 fanout-score-rank=39 prefix-density=1.19 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=63.81 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=8.03 sequence-density-rank=1 fanout-score=1.87 fanout-score-rank=45 prefix-density=9.83 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.44 sequence-density-rank=35 fanout-score=53.51 fanout-score-rank=1 prefix-density=16.42 prefix-fanout=1.4 sequence=TGTGTTTGATTGG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857038 SRR13857038_1.fastq SRR13857038_2.fastq Input file: SRR13857038_1.fastq Paired file: SRR13857038_2.fastq trimmed: SRR13857038-trimmed-pair1.fastq, SRR13857038-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:46:58 2025 >> started Tue Feb 11 20:47:18 2025 >> done (19.915s) 20122365 read pairs processed; of these: 143914 ( 0.72%) short read pairs filtered out after trimming by size control 114554 ( 0.57%) empty read pairs filtered out after trimming by size control 19863897 (98.72%) read pairs available; of these: 14927 ( 0.08%) trimmed read pairs available after processing 19848970 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 12 0.00% 25 6 0.00% 26 5 0.00% 27 3 0.00% 28 13 0.00% 29 9 0.00% 30 8 0.00% 31 22 0.00% 32 7 0.00% 33 29 0.00% 34 16 0.00% 35 25 0.00% 36 19 0.00% 37 17 0.00% 38 16 0.00% 39 30 0.00% 40 18 0.00% 41 32 0.00% 42 20 0.00% 43 37 0.00% 44 22 0.00% 45 34 0.00% 46 29 0.00% 47 48 0.00% 48 32 0.00% 49 57 0.00% 50 43 0.00% 51 71 0.00% 52 49 0.00% 53 73 0.00% 54 49 0.00% 55 59 0.00% 56 74 0.00% 57 50 0.00% 58 53 0.00% 59 102 0.00% 60 58 0.00% 61 108 0.00% 62 83 0.00% 63 126 0.00% 64 86 0.00% 65 159 0.00% 66 119 0.00% 67 184 0.00% 68 189 0.00% 69 152 0.00% 70 187 0.00% 71 118 0.00% 72 456 0.00% 73 106 0.00% 74 137 0.00% 75 133 0.00% 76 117 0.00% 77 126 0.00% 78 100 0.00% 79 117 0.00% 80 113 0.00% 81 108 0.00% 82 106 0.00% 83 108 0.00% 84 114 0.00% 85 98 0.00% 86 99 0.00% 87 115 0.00% 88 119 0.00% 89 89 0.00% 90 116 0.00% 91 180 0.00% 92 96 0.00% 93 99 0.00% 94 94 0.00% 95 98 0.00% 96 135 0.00% 97 125 0.00% 98 117 0.00% 99 124 0.00% 100 111 0.00% 101 120 0.00% 102 97 0.00% 103 97 0.00% 104 120 0.00% 105 124 0.00% 106 112 0.00% 107 101 0.00% 108 115 0.00% 109 112 0.00% 110 94 0.00% 111 128 0.00% 112 129 0.00% 113 129 0.00% 114 144 0.00% 115 129 0.00% 116 155 0.00% 117 149 0.00% 118 193 0.00% 119 219 0.00% 120 241 0.00% 121 258 0.00% 122 253 0.00% 123 276 0.00% 124 314 0.00% 125 305 0.00% 126 362 0.00% 127 388 0.00% 128 343 0.00% 129 374 0.00% 130 353 0.00% 131 349 0.00% 132 337 0.00% 133 1065 0.01% 134 83224 0.42% 135 86932 0.44% 136 88689 0.45% 137 91427 0.46% 138 93009 0.47% 139 96615 0.49% 140 96224 0.48% 141 101292 0.51% 142 101991 0.51% 143 105887 0.53% 144 106636 0.54% 145 110299 0.56% 146 116604 0.59% 147 126690 0.64% 148 179705 0.90% 149 847862 4.27% 150 17416691 87.68% criterion=sequence-density sequence-density=3.78 sequence-density-rank=1 fanout-score=1.11 fanout-score-rank=39 prefix-density=1.20 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=88.94 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=1.0 sequence=CGAGAGACCTCGGAGAACCTACTACAGGAGAGGTCAGCCTCTTGGGCTTTACTCTTCTTGGTCAATCTTCACAATGGTTCATCACCTTATTGTGTGGGTTTCAGCCGAGGCTGCATATCCCGGGGTTGACTTTCATGACTATGCTATATTAGGCGATGATTTAGTCATAGGTGATGCTGAGGTCGCTAAGAATTATGCTATTATGCTCGAGGCGAGTGGGGGAGTATTATCTAAGGATAAGTCTCTCATATCGGATCGAGGGTGCTGTGAATTCGCAAAGCGATTTATCATGAATAATCATTTGGCATCTAGAGTGGATGTAAGTCCACTCTCTATGCCTCTGGTTAGAGTGCTAGATCGTTATTCACCACCGTTTGTTTTCTCCAAACTGGAAGTACCAGATTTAAAAGGTGCTTTTCGGTTAAAAGGGGCAGGTTATAAGGTGTATTCAAAACTTCAGGCAAATAGGGATCCTTGTAAAGTGATGGATTCTTTGAGTCGGAAGTGGAGA criterion=sequence-density sequence-density=7.29 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=42 prefix-density=9.83 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.45 sequence-density-rank=34 fanout-score=49.79 fanout-score-rank=1 prefix-density=11.69 prefix-fanout=1.9 sequence=TTGTGTTTGATA SRR13857038 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:09:47 Started mapping on | Feb 11 21:09:47 Finished on | Feb 11 21:17:31 Mapping speed, Million of reads per hour | 216.56 Number of input reads | 27912570 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 12637981 Uniquely mapped reads % | 45.28% Average mapped length | 265.71 Number of splices: Total | 5611399 Number of splices: Annotated (sjdb) | 5360495 Number of splices: GT/AG | 5416982 Number of splices: GC/AG | 82847 Number of splices: AT/AC | 11768 Number of splices: Non-canonical | 99802 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.02% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 719189 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 8057592 % of reads mapped to too many loci | 28.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.08% % of reads unmapped: other | 7.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14555415 14555415 14555415 N_multimapping 719189 719189 719189 N_noFeature 3634292 8365436 7773556 N_ambiguous 252927 57125 63233 UnstrandedReadsAssigned:8750762 PositiveStrandReadsAssigned:4215420 NegativeStrandReadsAssigned:4801192 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857038 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857038-trimmed-pair1.fastq SRR13857038-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,912,570 reads, 20,791,694 reads pseudoaligned [quant] estimated average fragment length: 185.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR13857038.ke.tsv 34699 SRR13857038.se.tsv 87100 total ==> SRR13857038.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.86 365 6.96201 Potri.005G024800.1.v4.1 1035 850.865 27 1.10997 Potri.004G059700.1.v4.1 961 776.871 138 6.21354 Potri.007G009000.2.v4.1 1416 1231.86 0 0 Potri.003G141000.2.v4.1 2943 2758.86 180.335 2.28644 Potri.016G087400.1.v4.1 270 101.429 329.563 113.655 Potri.015G069301.1.v4.1 564 379.994 0 0 Potri.010G195200.1.v4.1 1773 1588.86 0 0 Potri.012G127500.1.v4.1 977 792.871 7 0.30882 ==> SRR13857038.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 212 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 66 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857038 completed mapping pipeline successfully