Starting /dee2/code/volunteer_pipeline.sh SRR13857039 current disk space = 3052903129088 free memory = 1479307564 SRR13857039 SRAfilesize 73e5d77efd01d66e02575f24f6d40f45 SRR13857039.sra SRR13857039.sra file validated SRR13857039 is paired end SRR13857039 is conventional basespace SRR13857039 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857039_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.0225 32.0 32.0 32.0 2.0 32.0 2 31.40875 32.0 32.0 32.0 32.0 32.0 3 34.71375 37.0 32.0 37.0 32.0 37.0 4 35.84125 37.0 37.0 37.0 32.0 37.0 5 36.18625 37.0 37.0 37.0 37.0 37.0 6 39.57375 41.0 41.0 41.0 37.0 41.0 7 39.8565 41.0 41.0 41.0 37.0 41.0 8 39.77925 41.0 41.0 41.0 37.0 41.0 9 39.69075 41.0 41.0 41.0 37.0 41.0 10-14 39.7803 41.0 41.0 41.0 37.0 41.0 15-19 39.683949999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.46470000000001 41.0 41.0 41.0 37.0 41.0 25-29 39.42625 41.0 41.0 41.0 37.0 41.0 30-34 39.170049999999996 41.0 41.0 41.0 37.0 41.0 35-39 39.0694 41.0 41.0 41.0 36.0 41.0 40-44 39.006249999999994 41.0 41.0 41.0 37.0 41.0 45-49 38.884800000000006 41.0 41.0 41.0 36.0 41.0 50-54 38.827999999999996 41.0 41.0 41.0 32.0 41.0 55-59 38.57305 41.0 41.0 41.0 32.0 41.0 60-64 38.54495000000001 41.0 41.0 41.0 32.0 41.0 65-69 38.215650000000004 41.0 41.0 41.0 31.0 41.0 70-74 38.2647 41.0 41.0 41.0 32.0 41.0 75-79 37.81699999999999 41.0 39.4 41.0 30.0 41.0 80-84 38.1472 41.0 41.0 41.0 32.0 41.0 85-89 38.0466 41.0 41.0 41.0 31.0 41.0 90-94 38.00775 41.0 41.0 41.0 30.0 41.0 95-99 37.71705 41.0 39.4 41.0 28.0 41.0 100-104 37.5401 41.0 37.8 41.0 27.0 41.0 105-109 37.560100000000006 41.0 37.8 41.0 27.0 41.0 110-114 37.44085 41.0 37.0 41.0 27.0 41.0 115-119 37.25945 41.0 37.0 41.0 25.0 41.0 120-124 36.93725 41.0 37.0 41.0 22.0 41.0 125-129 36.52905 41.0 37.0 41.0 22.0 41.0 130-134 36.3128 41.0 37.0 41.0 22.0 41.0 135-139 36.12665 41.0 37.0 41.0 22.0 41.0 140-144 35.937 41.0 37.0 41.0 22.0 41.0 145-149 35.4888 41.0 32.0 41.0 20.0 41.0 150 35.51175 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 25.0 24 45.0 25 53.0 26 56.0 27 66.0 28 71.0 29 80.0 30 66.0 31 69.0 32 86.0 33 85.0 34 82.0 35 110.0 36 147.0 37 134.0 38 223.0 39 382.0 40 2215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.103291713961408 28.547105561861517 18.359818388195233 38.98978433598184 2 15.375 27.750000000000004 43.25 13.625000000000002 3 18.35 27.625 33.95 20.075000000000003 4 18.575 24.575 37.574999999999996 19.275000000000002 5 28.025 23.3 30.525000000000002 18.15 6 19.575 24.4 37.275000000000006 18.75 7 27.6 25.5 28.65 18.25 8 16.35 22.925 41.0 19.725 9 22.725 21.425 37.7 18.15 10-14 23.5 26.56 29.265 20.674999999999997 15-19 24.065 25.8 27.97 22.165000000000003 20-24 22.64 26.8 28.884999999999998 21.675 25-29 22.365 26.700000000000003 28.050000000000004 22.884999999999998 30-34 23.155 27.08 27.36 22.405 35-39 22.585 27.150000000000002 27.750000000000004 22.515 40-44 22.97 27.865000000000002 26.88 22.285 45-49 23.145 27.634999999999998 26.700000000000003 22.52 50-54 23.150000000000002 27.555000000000003 27.045 22.25 55-59 23.09 27.150000000000002 27.089999999999996 22.67 60-64 22.525000000000002 26.61 27.595 23.27 65-69 22.73 27.589999999999996 27.339999999999996 22.34 70-74 22.18 27.245 27.92 22.655 75-79 22.305 27.425 27.175 23.095 80-84 22.91 27.935 26.995 22.16 85-89 21.995 28.22 27.145000000000003 22.64 90-94 21.46 28.63 26.915 22.994999999999997 95-99 22.48 28.29 26.840000000000003 22.39 100-104 23.139255702280913 27.270908363345335 26.795718287314923 22.794117647058822 105-109 21.3 27.99 27.375 23.335 110-114 22.22889155662265 27.170868347338935 27.70608243297319 22.894157663065226 115-119 21.971098554927746 27.701385069253465 27.101355067753385 23.226161308065404 120-124 22.405082287029163 27.572407583412534 27.18723425541494 22.835275874143367 125-129 22.39 28.365000000000002 27.11 22.134999999999998 130-134 22.38 27.725 27.555000000000003 22.34 135-139 22.642453349342137 28.14047726249437 27.19995997798789 22.017109410175596 140-144 22.314999999999998 29.195 26.32 22.17 145-149 23.365 29.375 25.374999999999996 21.884999999999998 150 22.575 28.775000000000002 25.8 22.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.5 2 4.5 3 7.5 4 13.5 5 11.5 6 5.5 7 3.5 8 1.5 9 2.0 10 1.5 11 1.5 12 1.5 13 2.0 14 5.0 15 7.0 16 5.5 17 5.5 18 5.5 19 3.5 20 5.0 21 9.0 22 10.0 23 9.5 24 12.0 25 13.5 26 15.5 27 21.5 28 28.5 29 31.0 30 35.0 31 43.5 32 46.5 33 58.5 34 79.5 35 87.0 36 84.5 37 91.5 38 111.5 39 114.5 40 114.5 41 144.0 42 176.5 43 195.5 44 216.0 45 216.5 46 177.5 47 143.5 48 149.0 49 165.5 50 160.0 51 135.5 52 112.0 53 103.5 54 94.5 55 80.5 56 72.0 57 68.5 58 69.0 59 66.0 60 64.0 61 46.5 62 30.0 63 28.5 64 25.5 65 25.0 66 26.5 67 25.0 68 17.0 69 12.0 70 12.0 71 7.5 72 4.0 73 5.0 74 2.5 75 1.5 76 1.0 77 1.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.899999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.04 115-119 0.005 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.055 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43569844789357 82.475 2 7.123059866962306 12.85 3 1.0532150776053215 2.85 4 0.19401330376940135 0.7000000000000001 5 0.08314855875831485 0.375 6 0.05543237250554324 0.3 7 0.0 0.0 8 0.02771618625277162 0.2 9 0.0 0.0 >10 0.02771618625277162 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 10 0.25 No Hit AACTTTGTGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit CATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAA 6 0.15 No Hit CTTTGTGTTTGAGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGA 6 0.15 No Hit TTGTGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CTTTGTGTTTGACTGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTC 5 0.125 No Hit GGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 0.9249999999999999 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAG 30 0.0018524947 71.95 7 CTTTGTG 45 6.409037E-5 71.06173 1 TGTGTTT 45 1.0954702E-4 63.95555 4 GTGTTTG 50 1.8451513E-4 57.560005 5 TGTTTGA 50 1.8451513E-4 57.560005 6 TTTGTGT 50 1.8451513E-4 57.560005 2 TTGTGTT 60 4.5417887E-4 47.966663 3 >>END_MODULE SRR13857039 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857039_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.2925 32.0 2.0 32.0 2.0 32.0 2 30.50125 32.0 32.0 32.0 27.0 32.0 3 31.84625 32.0 32.0 37.0 22.0 37.0 4 32.9925 37.0 27.0 37.0 27.0 37.0 5 34.7975 37.0 37.0 37.0 27.0 37.0 6 37.52575 41.0 37.0 41.0 27.0 41.0 7 38.28075 41.0 37.0 41.0 32.0 41.0 8 38.4655 41.0 41.0 41.0 32.0 41.0 9 38.18525 41.0 37.0 41.0 32.0 41.0 10-14 38.3969 41.0 39.4 41.0 32.0 41.0 15-19 38.54425 41.0 41.0 41.0 32.0 41.0 20-24 38.39815 41.0 39.4 41.0 32.0 41.0 25-29 38.422000000000004 41.0 39.4 41.0 32.0 41.0 30-34 38.3014 41.0 38.6 41.0 32.0 41.0 35-39 38.3078 41.0 38.6 41.0 32.0 41.0 40-44 38.108850000000004 41.0 37.8 41.0 30.0 41.0 45-49 37.9693 41.0 37.0 41.0 30.0 41.0 50-54 37.8397 41.0 37.0 41.0 28.0 41.0 55-59 37.83185 41.0 37.0 41.0 30.0 41.0 60-64 37.71065 41.0 37.0 41.0 28.0 41.0 65-69 37.6254 41.0 37.0 41.0 27.0 41.0 70-74 37.503 41.0 37.0 41.0 27.0 41.0 75-79 36.718 40.2 36.0 41.0 25.0 41.0 80-84 37.39815 41.0 37.0 41.0 27.0 41.0 85-89 37.39115 41.0 37.0 41.0 27.0 41.0 90-94 36.92495 41.0 37.0 41.0 25.0 41.0 95-99 36.84355 41.0 37.0 41.0 24.0 41.0 100-104 36.438199999999995 41.0 37.0 41.0 23.0 41.0 105-109 36.19725 41.0 36.0 41.0 22.0 41.0 110-114 35.892999999999994 41.0 34.0 41.0 22.0 41.0 115-119 35.46055 41.0 32.0 41.0 22.0 41.0 120-124 35.0324 41.0 32.0 41.0 18.0 41.0 125-129 34.6704 41.0 32.0 41.0 12.0 41.0 130-134 34.15304999999999 40.2 30.0 41.0 12.0 41.0 135-139 33.7948 37.8 27.0 41.0 12.0 41.0 140-144 33.26445 37.0 27.0 41.0 12.0 41.0 145-149 32.86385 37.0 27.0 41.0 12.0 41.0 150 32.32975 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 8.0 23 28.0 24 42.0 25 66.0 26 95.0 27 92.0 28 115.0 29 97.0 30 110.0 31 122.0 32 135.0 33 149.0 34 134.0 35 165.0 36 206.0 37 224.0 38 324.0 39 635.0 40 1252.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.104524180967239 28.822152886115443 21.489859594383777 36.58346333853354 2 15.425 26.700000000000003 44.375 13.5 3 19.275000000000002 27.650000000000002 33.324999999999996 19.75 4 18.675 24.425 38.05 18.85 5 28.449999999999996 23.825 30.349999999999998 17.375 6 19.525000000000002 24.775 38.125 17.575 7 26.924999999999997 25.25 30.049999999999997 17.775 8 16.55 22.2 42.35 18.9 9 22.475 21.925 37.2 18.4 10-14 23.369999999999997 26.46 29.26 20.91 15-19 23.599999999999998 25.979999999999997 28.815 21.605 20-24 22.865 26.474999999999998 29.12 21.54 25-29 21.88 26.195 29.585 22.34 30-34 23.14 26.31 28.945 21.605 35-39 22.965 26.14 28.875 22.02 40-44 23.095 26.865 28.235 21.805 45-49 23.71 25.97 28.49 21.83 50-54 22.86 26.640000000000004 28.54 21.959999999999997 55-59 23.09 26.435 28.18 22.295 60-64 23.145 25.445 28.935 22.475 65-69 23.585 25.759999999999998 28.999999999999996 21.654999999999998 70-74 22.11 27.215 28.62 22.055 75-79 23.244999999999997 26.22 28.93 21.605 80-84 23.355 26.185000000000002 28.96 21.5 85-89 22.945 27.04 28.37 21.645 90-94 22.625 26.685 29.18 21.51 95-99 23.025000000000002 26.474999999999998 28.16 22.34 100-104 23.13 26.075 28.68 22.115000000000002 105-109 22.845 25.840000000000003 29.275000000000002 22.040000000000003 110-114 21.945 26.025 29.925 22.105 115-119 22.15 26.015 29.515 22.32 120-124 22.115000000000002 26.155 29.12 22.61 125-129 22.545 26.345000000000002 29.175 21.935 130-134 22.045 26.19 29.54 22.225 135-139 22.045 26.865 29.385 21.705 140-144 23.215 27.750000000000004 27.439999999999998 21.595 145-149 22.875 28.205000000000002 27.815 21.105 150 22.775000000000002 26.625 29.325000000000003 21.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.5 2 3.5 3 9.5 4 11.5 5 7.5 6 5.0 7 3.5 8 3.0 9 4.5 10 6.5 11 7.0 12 4.5 13 3.5 14 5.0 15 6.0 16 7.5 17 6.5 18 5.5 19 5.5 20 8.0 21 12.0 22 13.5 23 12.0 24 9.5 25 12.0 26 19.5 27 21.0 28 20.5 29 33.5 30 41.0 31 43.0 32 45.5 33 48.5 34 58.0 35 72.0 36 88.5 37 93.0 38 110.5 39 129.5 40 141.0 41 145.5 42 174.0 43 214.5 44 225.5 45 229.5 46 196.5 47 162.5 48 146.5 49 150.5 50 137.5 51 117.0 52 125.0 53 117.0 54 94.0 55 76.0 56 66.0 57 56.0 58 58.0 59 55.5 60 51.0 61 43.5 62 31.0 63 30.5 64 25.5 65 18.5 66 18.5 67 17.0 68 15.0 69 10.0 70 8.0 71 8.0 72 3.5 73 3.5 74 4.0 75 2.0 76 5.5 77 8.0 78 3.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content fail #Base N-Count 1 35.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.60107095046854 87.4 2 5.970548862115127 11.15 3 0.2677376171352075 0.75 4 0.08032128514056225 0.3 5 0.0535475234270415 0.25 6 0.02677376171352075 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 6 0.15 No Hit CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit CTTTGTGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.975 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACAGC 10 0.0070282277 143.625 8 AACAGCA 10 0.0070282277 143.625 9 TTTGTGT 100 2.254692E-6 43.0875 2 GTTTGAG 70 9.802589E-4 41.035713 7 TTGTGTT 115 5.8983605E-6 37.46739 3 TGTGTTT 135 1.7722628E-5 31.916668 4 GTGTTTG 140 2.2733939E-5 30.776787 5 TGTTTGA 150 3.6441008E-5 28.724998 6 >>END_MODULE Read 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383674 spots for SRR13857039.sra Written 1383674 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra Read 1383665 spots for SRR13857039.sra Written 1383665 spots for SRR13857039.sra SRR ids: ['SRR13857039.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gi3l91y_ SRR13857039.sra spots: 27673309 blocks: [[1, 1383665], [1383666, 2767330], [2767331, 4150995], [4150996, 5534660], [5534661, 6918325], [6918326, 8301990], [8301991, 9685655], [9685656, 11069320], [11069321, 12452985], [12452986, 13836650], [13836651, 15220315], [15220316, 16603980], [16603981, 17987645], [17987646, 19371310], [19371311, 20754975], [20754976, 22138640], [22138641, 23522305], [23522306, 24905970], [24905971, 26289635], [26289636, 27673309]] SRR13857039 file size 9328851 SRR13857039 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857039 SRR13857039_1.fastq SRR13857039_2.fastq Input file: SRR13857039_1.fastq Paired file: SRR13857039_2.fastq trimmed: SRR13857039-trimmed-pair1.fastq, SRR13857039-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:45:36 2025 >> started Tue Feb 11 20:46:51 2025 >> done (75.486s) 27673309 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 27 ( 0.00%) empty read pairs filtered out after trimming by size control 27673263 (100.00%) read pairs available; of these: 3379309 (12.21%) trimmed read pairs available after processing 24293954 (87.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 5 0.00% 21 14 0.00% 22 9 0.00% 23 13 0.00% 24 19 0.00% 25 10 0.00% 26 6 0.00% 27 15 0.00% 28 12 0.00% 29 16 0.00% 30 28 0.00% 31 26 0.00% 32 21 0.00% 33 31 0.00% 34 18 0.00% 35 36 0.00% 36 32 0.00% 37 41 0.00% 38 32 0.00% 39 34 0.00% 40 33 0.00% 41 51 0.00% 42 26 0.00% 43 34 0.00% 44 35 0.00% 45 58 0.00% 46 38 0.00% 47 70 0.00% 48 56 0.00% 49 71 0.00% 50 75 0.00% 51 98 0.00% 52 96 0.00% 53 90 0.00% 54 98 0.00% 55 92 0.00% 56 93 0.00% 57 91 0.00% 58 84 0.00% 59 176 0.00% 60 80 0.00% 61 137 0.00% 62 113 0.00% 63 237 0.00% 64 106 0.00% 65 180 0.00% 66 177 0.00% 67 203 0.00% 68 181 0.00% 69 159 0.00% 70 199 0.00% 71 157 0.00% 72 501 0.00% 73 147 0.00% 74 156 0.00% 75 152 0.00% 76 132 0.00% 77 152 0.00% 78 131 0.00% 79 129 0.00% 80 108 0.00% 81 136 0.00% 82 109 0.00% 83 116 0.00% 84 127 0.00% 85 114 0.00% 86 125 0.00% 87 142 0.00% 88 165 0.00% 89 126 0.00% 90 134 0.00% 91 175 0.00% 92 121 0.00% 93 118 0.00% 94 87 0.00% 95 138 0.00% 96 136 0.00% 97 127 0.00% 98 133 0.00% 99 127 0.00% 100 124 0.00% 101 173 0.00% 102 136 0.00% 103 133 0.00% 104 111 0.00% 105 131 0.00% 106 120 0.00% 107 135 0.00% 108 130 0.00% 109 158 0.00% 110 131 0.00% 111 162 0.00% 112 150 0.00% 113 153 0.00% 114 164 0.00% 115 168 0.00% 116 173 0.00% 117 179 0.00% 118 220 0.00% 119 229 0.00% 120 232 0.00% 121 278 0.00% 122 295 0.00% 123 308 0.00% 124 375 0.00% 125 350 0.00% 126 439 0.00% 127 374 0.00% 128 420 0.00% 129 436 0.00% 130 386 0.00% 131 374 0.00% 132 394 0.00% 133 1214 0.00% 134 127075 0.46% 135 132643 0.48% 136 134809 0.49% 137 139268 0.50% 138 141735 0.51% 139 147642 0.53% 140 147252 0.53% 141 154803 0.56% 142 154763 0.56% 143 160339 0.58% 144 162138 0.59% 145 168813 0.61% 146 169621 0.61% 147 183377 0.66% 148 236106 0.85% 149 1002089 3.62% 150 24293954 87.79% 27673263 reads passed initial QC criterion=sequence-density sequence-density=5.00 sequence-density-rank=1 fanout-score=1.04 fanout-score-rank=39 prefix-density=2.88 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=2.07 sequence-density-rank=4 fanout-score=47.73 fanout-score-rank=1 prefix-density=3.80 prefix-fanout=26.0 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=8.18 sequence-density-rank=1 fanout-score=1.74 fanout-score-rank=45 prefix-density=10.24 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.48 sequence-density-rank=33 fanout-score=41.18 fanout-score-rank=1 prefix-density=11.92 prefix-fanout=1.6 sequence=TTGTGTTTGAAGG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857039 SRR13857039_1.fastq SRR13857039_2.fastq Input file: SRR13857039_1.fastq Paired file: SRR13857039_2.fastq trimmed: SRR13857039-trimmed-pair1.fastq, SRR13857039-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:50:48 2025 >> started Tue Feb 11 20:51:07 2025 >> done (18.682s) 19766617 read pairs processed; of these: 180893 ( 0.92%) short read pairs filtered out after trimming by size control 188095 ( 0.95%) empty read pairs filtered out after trimming by size control 19397629 (98.13%) read pairs available; of these: 23574 ( 0.12%) trimmed read pairs available after processing 19374055 (99.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 5 0.00% 21 12 0.00% 22 7 0.00% 23 10 0.00% 24 13 0.00% 25 8 0.00% 26 3 0.00% 27 13 0.00% 28 10 0.00% 29 12 0.00% 30 19 0.00% 31 14 0.00% 32 18 0.00% 33 20 0.00% 34 13 0.00% 35 29 0.00% 36 17 0.00% 37 29 0.00% 38 25 0.00% 39 29 0.00% 40 24 0.00% 41 39 0.00% 42 20 0.00% 43 18 0.00% 44 22 0.00% 45 41 0.00% 46 25 0.00% 47 51 0.00% 48 45 0.00% 49 55 0.00% 50 47 0.00% 51 67 0.00% 52 69 0.00% 53 72 0.00% 54 66 0.00% 55 65 0.00% 56 62 0.00% 57 65 0.00% 58 56 0.00% 59 132 0.00% 60 55 0.00% 61 99 0.00% 62 76 0.00% 63 177 0.00% 64 73 0.00% 65 125 0.00% 66 124 0.00% 67 154 0.00% 68 138 0.00% 69 115 0.00% 70 138 0.00% 71 107 0.00% 72 353 0.00% 73 112 0.00% 74 101 0.00% 75 105 0.00% 76 98 0.00% 77 112 0.00% 78 101 0.00% 79 85 0.00% 80 79 0.00% 81 89 0.00% 82 77 0.00% 83 85 0.00% 84 91 0.00% 85 80 0.00% 86 87 0.00% 87 95 0.00% 88 119 0.00% 89 81 0.00% 90 91 0.00% 91 124 0.00% 92 86 0.00% 93 91 0.00% 94 57 0.00% 95 105 0.00% 96 91 0.00% 97 88 0.00% 98 95 0.00% 99 86 0.00% 100 83 0.00% 101 127 0.00% 102 96 0.00% 103 103 0.00% 104 74 0.00% 105 97 0.00% 106 93 0.00% 107 101 0.00% 108 83 0.00% 109 118 0.00% 110 95 0.00% 111 113 0.00% 112 116 0.00% 113 101 0.00% 114 105 0.00% 115 133 0.00% 116 108 0.00% 117 130 0.00% 118 161 0.00% 119 151 0.00% 120 160 0.00% 121 204 0.00% 122 214 0.00% 123 229 0.00% 124 277 0.00% 125 244 0.00% 126 318 0.00% 127 261 0.00% 128 297 0.00% 129 312 0.00% 130 276 0.00% 131 266 0.00% 132 309 0.00% 133 875 0.00% 134 89340 0.46% 135 93220 0.48% 136 95040 0.49% 137 97988 0.51% 138 99828 0.51% 139 103485 0.53% 140 102942 0.53% 141 108439 0.56% 142 108988 0.56% 143 112899 0.58% 144 113520 0.59% 145 118439 0.61% 146 127555 0.66% 147 136940 0.71% 148 170683 0.88% 149 684347 3.53% 150 17021951 87.75% criterion=sequence-density sequence-density=4.23 sequence-density-rank=1 fanout-score=1.04 fanout-score-rank=39 prefix-density=2.91 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=51.98 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=2.0 sequence=CCTCTCCGGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATACGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGGATGGGGGCCGGCGATGCG criterion=sequence-density sequence-density=7.15 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=44 prefix-density=10.30 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=55.10 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=2.0 sequence=CCTCTCCGGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATACGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGGATGGGGGCCGGCGATGCG SRR13857039 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:13:22 Started mapping on | Feb 11 21:13:26 Finished on | Feb 11 21:21:14 Mapping speed, Million of reads per hour | 210.03 Number of input reads | 27303918 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 11647227 Uniquely mapped reads % | 42.66% Average mapped length | 266.84 Number of splices: Total | 5544980 Number of splices: Annotated (sjdb) | 5316670 Number of splices: GT/AG | 5359883 Number of splices: GC/AG | 85110 Number of splices: AT/AC | 9399 Number of splices: Non-canonical | 90588 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 652398 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 8631944 % of reads mapped to too many loci | 31.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.99% % of reads unmapped: other | 7.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 15004312 15004312 15004312 N_multimapping 652398 652398 652398 N_noFeature 3209988 7685121 7050856 N_ambiguous 237901 54902 62292 UnstrandedReadsAssigned:8199338 PositiveStrandReadsAssigned:3907204 NegativeStrandReadsAssigned:4534079 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857039 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857039-trimmed-pair1.fastq SRR13857039-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,303,918 reads, 20,708,812 reads pseudoaligned [quant] estimated average fragment length: 180.636 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR13857039.ke.tsv 34699 SRR13857039.se.tsv 87100 total ==> SRR13857039.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.36 320 5.50631 Potri.005G024800.1.v4.1 1035 855.364 88 3.25442 Potri.004G059700.1.v4.1 961 781.376 172 6.96323 Potri.007G009000.2.v4.1 1416 1236.36 0 0 Potri.003G141000.2.v4.1 2943 2763.36 137 1.56828 Potri.016G087400.1.v4.1 270 102.815 279 85.8397 Potri.015G069301.1.v4.1 564 384.467 0 0 Potri.010G195200.1.v4.1 1773 1593.36 10 0.198531 Potri.012G127500.1.v4.1 977 797.376 46 1.82489 ==> SRR13857039.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 340 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 73 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857039 completed mapping pipeline successfully