Starting /dee2/code/volunteer_pipeline.sh SRR13857040 current disk space = 3053253386240 free memory = 1415097112 SRR13857040 SRAfilesize edd950a8af8e0c49b435b2da01d14bfa SRR13857040.sra SRR13857040.sra file validated SRR13857040 is paired end SRR13857040 is conventional basespace SRR13857040 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857040_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.10625 32.0 32.0 32.0 2.0 32.0 2 31.4025 32.0 32.0 32.0 32.0 32.0 3 34.57875 37.0 32.0 37.0 32.0 37.0 4 35.56 37.0 37.0 37.0 32.0 37.0 5 35.99625 37.0 37.0 37.0 32.0 37.0 6 39.259 41.0 41.0 41.0 37.0 41.0 7 39.522 41.0 41.0 41.0 37.0 41.0 8 39.38025 41.0 41.0 41.0 37.0 41.0 9 39.314 41.0 41.0 41.0 37.0 41.0 10-14 39.31285 41.0 41.0 41.0 37.0 41.0 15-19 39.11455 41.0 41.0 41.0 36.0 41.0 20-24 38.89435 41.0 41.0 41.0 34.0 41.0 25-29 38.48315 41.0 41.0 41.0 32.0 41.0 30-34 38.1729 41.0 39.4 41.0 30.0 41.0 35-39 38.2113 41.0 39.4 41.0 32.0 41.0 40-44 38.06055 41.0 37.8 41.0 29.0 41.0 45-49 37.7477 41.0 37.0 41.0 27.0 41.0 50-54 37.56965 41.0 37.0 41.0 27.0 41.0 55-59 37.484049999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.3746 41.0 37.0 41.0 27.0 41.0 65-69 37.0133 41.0 37.0 41.0 27.0 41.0 70-74 36.95815 41.0 37.0 41.0 26.0 41.0 75-79 36.49865 41.0 36.0 41.0 24.0 41.0 80-84 36.6429 41.0 37.0 41.0 23.0 41.0 85-89 36.863 41.0 37.0 41.0 23.0 41.0 90-94 36.649950000000004 41.0 37.0 41.0 22.0 41.0 95-99 36.36455 41.0 36.0 41.0 22.0 41.0 100-104 36.0981 41.0 37.0 41.0 22.0 41.0 105-109 36.20205 41.0 37.0 41.0 22.0 41.0 110-114 36.004450000000006 41.0 37.0 41.0 22.0 41.0 115-119 35.577200000000005 41.0 33.0 41.0 22.0 41.0 120-124 35.222 41.0 33.0 41.0 18.0 41.0 125-129 34.932550000000006 41.0 32.0 41.0 12.0 41.0 130-134 34.74875 41.0 32.0 41.0 12.0 41.0 135-139 34.17360000000001 41.0 32.0 41.0 12.0 41.0 140-144 34.02275 41.0 32.0 41.0 12.0 41.0 145-149 33.210950000000004 41.0 27.0 41.0 12.0 41.0 150 33.02975 41.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 9.0 23 46.0 24 73.0 25 87.0 26 93.0 27 107.0 28 106.0 29 115.0 30 94.0 31 130.0 32 121.0 33 116.0 34 121.0 35 127.0 36 140.0 37 161.0 38 218.0 39 328.0 40 1808.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.997736276174306 30.164119977362763 17.430673457838143 40.407470288624786 2 14.75 26.825 43.375 15.049999999999999 3 15.15 29.225 34.675 20.95 4 16.925 26.575 36.375 20.125 5 25.3 26.0 30.8 17.9 6 18.95 27.900000000000002 33.475 19.675 7 22.75 29.575000000000003 29.475 18.2 8 16.925 26.125 38.5 18.45 9 19.025 25.5 37.15 18.325 10-14 21.08 27.935 30.975 20.01 15-19 21.645 27.57 29.244999999999997 21.54 20-24 20.82 28.139999999999997 30.020000000000003 21.02 25-29 20.8 28.15 29.59 21.46 30-34 21.465 28.455000000000002 28.970000000000002 21.11 35-39 20.695 28.544999999999998 29.37 21.39 40-44 21.12 28.485 28.994999999999997 21.4 45-49 21.205 28.525 29.115000000000002 21.154999999999998 50-54 21.12 28.465 28.494999999999997 21.92 55-59 21.029999999999998 28.435 28.63 21.905 60-64 20.985 28.59 28.54 21.884999999999998 65-69 20.880000000000003 28.439999999999998 28.59 22.09 70-74 20.735 28.985 28.62 21.66 75-79 21.01 28.360000000000003 28.720000000000002 21.91 80-84 21.08 28.405 28.115000000000002 22.400000000000002 85-89 20.785 29.744999999999997 27.76 21.709999999999997 90-94 21.04 29.24 27.785 21.935 95-99 21.2 29.23 27.639999999999997 21.93 100-104 20.70224578602511 29.09018156354724 28.219876956934925 21.98769569349272 105-109 20.605 29.18 28.34 21.875 110-114 20.572200270094534 29.345270844795678 28.094833191617063 21.98769569349272 115-119 20.285 29.925 28.005000000000003 21.785 120-124 20.717430458274965 29.512707624574748 27.851711026615973 21.91815089053432 125-129 21.029999999999998 29.925 27.46 21.584999999999997 130-134 20.674999999999997 29.744999999999997 28.155 21.425 135-139 20.503453107797018 30.112100890801724 27.805024522069864 21.579421479331398 140-144 20.830000000000002 30.28 27.685 21.205 145-149 21.48 30.54 26.974999999999998 21.005 150 21.224999999999998 31.5 26.375 20.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 8.0 2 9.0 3 10.0 4 9.5 5 6.0 6 3.5 7 4.0 8 3.0 9 1.5 10 2.5 11 2.0 12 1.5 13 3.0 14 4.0 15 5.5 16 5.5 17 6.5 18 7.0 19 7.5 20 10.0 21 13.0 22 11.5 23 10.5 24 17.5 25 23.5 26 27.5 27 41.5 28 51.5 29 55.5 30 69.5 31 76.5 32 73.5 33 82.5 34 98.5 35 107.0 36 115.5 37 120.0 38 131.0 39 146.0 40 158.5 41 174.0 42 171.5 43 178.0 44 207.5 45 206.0 46 167.0 47 141.5 48 142.0 49 134.5 50 110.5 51 89.5 52 82.5 53 83.0 54 72.0 55 55.5 56 51.5 57 51.5 58 50.0 59 50.5 60 43.0 61 31.0 62 24.5 63 24.5 64 22.0 65 16.0 66 13.0 67 12.5 68 12.5 69 8.5 70 6.0 71 3.5 72 1.5 73 2.0 74 2.0 75 2.0 76 2.5 77 6.0 78 4.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.034999999999999996 115-119 0.0 120-124 0.06 125-129 0.0 130-134 0.0 135-139 0.09 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.53915823122003 88.725 2 4.714970697922216 8.85 3 0.5594033031433138 1.575 4 0.13319126265316997 0.5 5 0.02663825253063399 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02663825253063399 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit CTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACGAGAACAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGACAC 10 0.0055150697 155.59459 1 TTTGTGT 20 3.6955212E-4 107.94375 2 GTGTTTG 30 0.0018512175 71.9625 3 GTTTGAG 30 0.0018512175 71.9625 7 TGTTTGA 30 0.0018512175 71.9625 4 TGTGTTT 35 0.003411565 61.68214 2 AGATCGG 20 0.006154893 28.784998 140-144 >>END_MODULE SRR13857040 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857040_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.255 32.0 2.0 32.0 2.0 32.0 2 31.1625 32.0 32.0 32.0 32.0 32.0 3 31.90625 32.0 32.0 37.0 22.0 37.0 4 33.4525 37.0 32.0 37.0 27.0 37.0 5 34.82 37.0 37.0 37.0 27.0 37.0 6 37.69275 41.0 37.0 41.0 27.0 41.0 7 38.19925 41.0 37.0 41.0 32.0 41.0 8 38.88775 41.0 41.0 41.0 37.0 41.0 9 38.468 41.0 41.0 41.0 32.0 41.0 10-14 38.39215 41.0 38.6 41.0 32.0 41.0 15-19 38.24745 41.0 37.8 41.0 32.0 41.0 20-24 38.22575 41.0 37.8 41.0 32.0 41.0 25-29 38.1211 41.0 37.0 41.0 32.0 41.0 30-34 37.9871 41.0 37.0 41.0 30.0 41.0 35-39 37.987100000000005 41.0 37.0 41.0 31.0 41.0 40-44 37.361050000000006 41.0 37.0 41.0 27.0 41.0 45-49 37.007999999999996 41.0 37.0 41.0 27.0 41.0 50-54 37.030449999999995 41.0 37.0 41.0 27.0 41.0 55-59 36.966499999999996 41.0 37.0 41.0 27.0 41.0 60-64 36.76435 41.0 37.0 41.0 24.0 41.0 65-69 36.8998 41.0 37.0 41.0 26.0 41.0 70-74 36.53405 41.0 37.0 41.0 23.0 41.0 75-79 35.615449999999996 40.2 35.0 41.0 22.0 41.0 80-84 36.40145 41.0 37.0 41.0 22.0 41.0 85-89 36.32725 41.0 36.0 41.0 22.0 41.0 90-94 36.012350000000005 41.0 37.0 41.0 22.0 41.0 95-99 35.5664 41.0 34.0 41.0 20.0 41.0 100-104 34.8368 41.0 32.0 41.0 16.0 41.0 105-109 34.81314999999999 41.0 32.0 41.0 20.0 41.0 110-114 34.28395 40.2 32.0 41.0 12.0 41.0 115-119 33.7607 40.2 29.0 41.0 12.0 41.0 120-124 33.40305 37.0 27.0 41.0 12.0 41.0 125-129 32.986900000000006 37.0 27.0 41.0 12.0 41.0 130-134 32.2021 37.0 27.0 41.0 12.0 41.0 135-139 31.935450000000003 37.0 27.0 41.0 12.0 41.0 140-144 31.3053 37.0 23.0 41.0 12.0 41.0 145-149 30.8421 36.0 22.0 41.0 12.0 41.0 150 29.91825 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 37.0 24 85.0 25 84.0 26 94.0 27 122.0 28 139.0 29 155.0 30 154.0 31 167.0 32 176.0 33 170.0 34 192.0 35 198.0 36 203.0 37 234.0 38 306.0 39 524.0 40 956.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.422222222222222 30.266666666666666 18.577777777777776 39.733333333333334 2 14.674999999999999 27.250000000000004 42.95 15.125 3 15.8 28.799999999999997 34.75 20.65 4 16.525000000000002 26.25 36.575 20.65 5 25.424999999999997 25.6 31.225 17.75 6 18.5 28.025 34.475 19.0 7 22.2 27.825 32.074999999999996 17.9 8 15.8 25.55 39.7 18.95 9 20.375 24.95 35.575 19.1 10-14 21.125 27.785 31.540000000000003 19.55 15-19 21.529999999999998 27.35 30.36 20.76 20-24 21.555 27.565 31.03 19.85 25-29 20.79 27.41 31.419999999999998 20.380000000000003 30-34 21.834999999999997 26.645000000000003 31.574999999999996 19.945 35-39 21.7 27.805000000000003 30.455 20.04 40-44 22.02 27.584999999999997 30.385 20.01 45-49 22.715 26.919999999999998 30.709999999999997 19.655 50-54 21.91 27.005000000000003 31.055 20.03 55-59 22.205 26.085 31.624999999999996 20.085 60-64 21.63 26.105 31.574999999999996 20.69 65-69 22.61 25.669999999999998 31.385 20.335 70-74 21.515 26.884999999999998 31.0 20.599999999999998 75-79 21.154999999999998 27.13 30.945 20.77 80-84 21.91 27.05 30.475 20.565 85-89 22.16 26.505000000000003 31.365 19.97 90-94 21.834999999999997 26.979999999999997 31.025000000000002 20.16 95-99 22.185 26.590000000000003 30.5 20.724999999999998 100-104 21.58 26.8 31.16 20.46 105-109 21.035 26.815 31.674999999999997 20.474999999999998 110-114 21.25 26.13 32.1 20.52 115-119 21.15 27.485 31.790000000000003 19.575 120-124 20.615 27.145000000000003 31.264999999999997 20.974999999999998 125-129 21.215 27.185 31.44 20.16 130-134 21.515 27.015 31.235000000000003 20.235 135-139 20.635 28.199999999999996 31.014999999999997 20.150000000000002 140-144 21.81 27.61 30.25 20.330000000000002 145-149 22.43 28.494999999999997 29.5 19.575 150 23.1 28.075 28.799999999999997 20.025000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 7.0 2 8.0 3 10.5 4 9.0 5 8.5 6 8.5 7 7.0 8 6.5 9 4.5 10 3.5 11 4.0 12 4.5 13 7.5 14 9.5 15 8.5 16 8.0 17 11.0 18 11.5 19 9.5 20 11.5 21 13.0 22 12.5 23 16.0 24 19.0 25 21.0 26 30.5 27 45.5 28 50.0 29 49.5 30 62.0 31 77.5 32 80.0 33 77.0 34 88.0 35 106.5 36 126.0 37 144.0 38 148.5 39 142.0 40 152.0 41 183.5 42 185.0 43 178.5 44 186.5 45 176.5 46 156.5 47 158.0 48 157.5 49 130.0 50 110.0 51 96.5 52 75.5 53 65.5 54 65.5 55 54.0 56 44.0 57 47.0 58 45.5 59 42.0 60 42.5 61 32.5 62 21.0 63 18.0 64 16.5 65 14.0 66 11.0 67 14.5 68 16.5 69 9.5 70 4.5 71 3.0 72 3.5 73 2.5 74 0.5 75 2.0 76 2.5 77 0.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 43.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.89649764767381 91.725 2 3.7637219027705178 7.199999999999999 3 0.26136957658128596 0.75 4 0.052273915316257184 0.2 5 0.026136957658128592 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.28750000000000003 0.0 0.0 0.0 0.0 136-137 1.175 0.0 0.0 0.0 0.0 138 1.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0037506341 20.505358 45-49 >>END_MODULE Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372412 spots for SRR13857040.sra Written 1372412 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra Read 1372411 spots for SRR13857040.sra Written 1372411 spots for SRR13857040.sra SRR ids: ['SRR13857040.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oth3ss2d SRR13857040.sra spots: 27448221 blocks: [[1, 1372411], [1372412, 2744822], [2744823, 4117233], [4117234, 5489644], [5489645, 6862055], [6862056, 8234466], [8234467, 9606877], [9606878, 10979288], [10979289, 12351699], [12351700, 13724110], [13724111, 15096521], [15096522, 16468932], [16468933, 17841343], [17841344, 19213754], [19213755, 20586165], [20586166, 21958576], [21958577, 23330987], [23330988, 24703398], [24703399, 26075809], [26075810, 27448221]] SRR13857040 file size 9252796 SRR13857040 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857040 SRR13857040_1.fastq SRR13857040_2.fastq Input file: SRR13857040_1.fastq Paired file: SRR13857040_2.fastq trimmed: SRR13857040-trimmed-pair1.fastq, SRR13857040-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:57:36 2025 >> started Tue Feb 11 19:58:26 2025 >> done (49.618s) 27448221 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 35 ( 0.00%) empty read pairs filtered out after trimming by size control 27448178 (100.00%) read pairs available; of these: 3239746 (11.80%) trimmed read pairs available after processing 24208432 (88.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 5 0.00% 21 10 0.00% 22 6 0.00% 23 13 0.00% 24 9 0.00% 25 9 0.00% 26 17 0.00% 27 12 0.00% 28 21 0.00% 29 18 0.00% 30 15 0.00% 31 19 0.00% 32 21 0.00% 33 33 0.00% 34 23 0.00% 35 43 0.00% 36 27 0.00% 37 36 0.00% 38 23 0.00% 39 41 0.00% 40 29 0.00% 41 38 0.00% 42 39 0.00% 43 56 0.00% 44 41 0.00% 45 55 0.00% 46 41 0.00% 47 67 0.00% 48 38 0.00% 49 77 0.00% 50 68 0.00% 51 108 0.00% 52 78 0.00% 53 73 0.00% 54 77 0.00% 55 91 0.00% 56 88 0.00% 57 85 0.00% 58 75 0.00% 59 133 0.00% 60 84 0.00% 61 160 0.00% 62 114 0.00% 63 222 0.00% 64 105 0.00% 65 158 0.00% 66 164 0.00% 67 201 0.00% 68 195 0.00% 69 166 0.00% 70 208 0.00% 71 137 0.00% 72 512 0.00% 73 168 0.00% 74 178 0.00% 75 169 0.00% 76 136 0.00% 77 175 0.00% 78 142 0.00% 79 169 0.00% 80 122 0.00% 81 146 0.00% 82 120 0.00% 83 150 0.00% 84 163 0.00% 85 164 0.00% 86 114 0.00% 87 151 0.00% 88 165 0.00% 89 145 0.00% 90 137 0.00% 91 193 0.00% 92 143 0.00% 93 121 0.00% 94 127 0.00% 95 130 0.00% 96 174 0.00% 97 128 0.00% 98 142 0.00% 99 120 0.00% 100 147 0.00% 101 148 0.00% 102 138 0.00% 103 159 0.00% 104 141 0.00% 105 155 0.00% 106 126 0.00% 107 150 0.00% 108 154 0.00% 109 179 0.00% 110 181 0.00% 111 199 0.00% 112 213 0.00% 113 182 0.00% 114 235 0.00% 115 208 0.00% 116 249 0.00% 117 227 0.00% 118 280 0.00% 119 314 0.00% 120 357 0.00% 121 399 0.00% 122 454 0.00% 123 408 0.00% 124 497 0.00% 125 472 0.00% 126 562 0.00% 127 527 0.00% 128 568 0.00% 129 624 0.00% 130 563 0.00% 131 536 0.00% 132 586 0.00% 133 1437 0.01% 134 109237 0.40% 135 112967 0.41% 136 114187 0.42% 137 119205 0.43% 138 122842 0.45% 139 127059 0.46% 140 127312 0.46% 141 131765 0.48% 142 134394 0.49% 143 137571 0.50% 144 138358 0.50% 145 145150 0.53% 146 147464 0.54% 147 161779 0.59% 148 235581 0.86% 149 1154918 4.21% 150 24208432 88.20% 27448178 reads passed initial QC criterion=sequence-density sequence-density=3.41 sequence-density-rank=1 fanout-score=35.48 fanout-score-rank=1 prefix-density=5.14 prefix-fanout=23.5 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=fanout-score sequence-density=3.41 sequence-density-rank=1 fanout-score=35.48 fanout-score-rank=1 prefix-density=5.14 prefix-fanout=23.5 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=9.18 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=40 prefix-density=14.28 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.67 sequence-density-rank=29 fanout-score=46.45 fanout-score-rank=1 prefix-density=16.65 prefix-fanout=1.9 sequence=TTGTGTTTGACC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCAAACACAAAGTTACCTAAACTATAGAAG -y TTTGTGTTTGAG -o SRR13857040 SRR13857040_1.fastq SRR13857040_2.fastq Input file: SRR13857040_1.fastq Paired file: SRR13857040_2.fastq trimmed: SRR13857040-trimmed-pair1.fastq, SRR13857040-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TCAAACACAAAGTTACCTAAACTATAGAAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:01:05 2025 >> started Tue Feb 11 20:01:38 2025 >> done (32.557s) 19605842 read pairs processed; of these: 66691 ( 0.34%) short read pairs filtered out after trimming by size control 61996 ( 0.32%) empty read pairs filtered out after trimming by size control 19477155 (99.34%) read pairs available; of these: 26293 ( 0.13%) trimmed read pairs available after processing 19450862 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 5 0.00% 21 8 0.00% 22 5 0.00% 23 10 0.00% 24 8 0.00% 25 7 0.00% 26 9 0.00% 27 10 0.00% 28 15 0.00% 29 16 0.00% 30 12 0.00% 31 16 0.00% 32 17 0.00% 33 24 0.00% 34 14 0.00% 35 30 0.00% 36 20 0.00% 37 27 0.00% 38 17 0.00% 39 31 0.00% 40 20 0.00% 41 29 0.00% 42 30 0.00% 43 36 0.00% 44 30 0.00% 45 39 0.00% 46 31 0.00% 47 51 0.00% 48 25 0.00% 49 55 0.00% 50 44 0.00% 51 79 0.00% 52 59 0.00% 53 44 0.00% 54 53 0.00% 55 61 0.00% 56 65 0.00% 57 68 0.00% 58 53 0.00% 59 97 0.00% 60 59 0.00% 61 114 0.00% 62 84 0.00% 63 168 0.00% 64 77 0.00% 65 116 0.00% 66 119 0.00% 67 143 0.00% 68 143 0.00% 69 116 0.00% 70 164 0.00% 71 97 0.00% 72 369 0.00% 73 124 0.00% 74 119 0.00% 75 112 0.00% 76 94 0.00% 77 129 0.00% 78 105 0.00% 79 115 0.00% 80 85 0.00% 81 103 0.00% 82 90 0.00% 83 100 0.00% 84 120 0.00% 85 125 0.00% 86 90 0.00% 87 105 0.00% 88 119 0.00% 89 104 0.00% 90 103 0.00% 91 132 0.00% 92 95 0.00% 93 82 0.00% 94 95 0.00% 95 87 0.00% 96 122 0.00% 97 83 0.00% 98 103 0.00% 99 82 0.00% 100 104 0.00% 101 106 0.00% 102 105 0.00% 103 106 0.00% 104 96 0.00% 105 121 0.00% 106 90 0.00% 107 114 0.00% 108 105 0.00% 109 133 0.00% 110 128 0.00% 111 133 0.00% 112 167 0.00% 113 137 0.00% 114 154 0.00% 115 148 0.00% 116 179 0.00% 117 165 0.00% 118 194 0.00% 119 231 0.00% 120 261 0.00% 121 281 0.00% 122 312 0.00% 123 287 0.00% 124 363 0.00% 125 341 0.00% 126 398 0.00% 127 375 0.00% 128 386 0.00% 129 438 0.00% 130 393 0.00% 131 385 0.00% 132 450 0.00% 133 1020 0.01% 134 77659 0.40% 135 80194 0.41% 136 81213 0.42% 137 85104 0.44% 138 87386 0.45% 139 90653 0.47% 140 90301 0.46% 141 93423 0.48% 142 95926 0.49% 143 97562 0.50% 144 98178 0.50% 145 103088 0.53% 146 105202 0.54% 147 116269 0.60% 148 187584 0.96% 149 797184 4.09% 150 17175958 88.19% criterion=sequence-density sequence-density=3.21 sequence-density-rank=1 fanout-score=1.13 fanout-score-rank=32 prefix-density=1.16 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=3.11 sequence-density-rank=2 fanout-score=36.42 fanout-score-rank=1 prefix-density=4.75 prefix-fanout=23.8 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=8.33 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=40 prefix-density=14.42 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.51 sequence-density-rank=34 fanout-score=51.85 fanout-score-rank=1 prefix-density=17.99 prefix-fanout=1.5 sequence=TGTGTTTGATTGG SRR13857040 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 20:29:34 Started mapping on | Feb 11 20:29:34 Finished on | Feb 11 20:40:06 Mapping speed, Million of reads per hour | 155.62 Number of input reads | 27319146 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 13184383 Uniquely mapped reads % | 48.26% Average mapped length | 263.80 Number of splices: Total | 6223598 Number of splices: Annotated (sjdb) | 5967052 Number of splices: GT/AG | 6018180 Number of splices: GC/AG | 97429 Number of splices: AT/AC | 11753 Number of splices: Non-canonical | 96236 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 691873 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 6224281 % of reads mapped to too many loci | 22.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.57% % of reads unmapped: other | 6.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13442908 13442908 13442908 N_multimapping 691873 691873 691873 N_noFeature 3016121 8620956 7451505 N_ambiguous 258929 58321 73261 UnstrandedReadsAssigned:9909333 PositiveStrandReadsAssigned:4505106 NegativeStrandReadsAssigned:5659617 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857040 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857040-trimmed-pair1.fastq SRR13857040-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,319,146 reads, 20,207,945 reads pseudoaligned [quant] estimated average fragment length: 183.113 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR13857040.ke.tsv 34699 SRR13857040.se.tsv 87100 total ==> SRR13857040.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1835.89 520 10.2398 Potri.005G024800.1.v4.1 1035 852.887 65 2.75521 Potri.004G059700.1.v4.1 961 778.894 171 7.93689 Potri.007G009000.2.v4.1 1416 1233.89 0 0 Potri.003G141000.2.v4.1 2943 2760.89 119.071 1.55915 Potri.016G087400.1.v4.1 270 101.116 385 137.648 Potri.015G069301.1.v4.1 564 381.988 0 0 Potri.010G195200.1.v4.1 1773 1590.89 0 0 Potri.012G127500.1.v4.1 977 794.894 37 1.68277 ==> SRR13857040.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 276 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 74 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857040 completed mapping pipeline successfully