Starting /dee2/code/volunteer_pipeline.sh SRR13857041 current disk space = 3053057228800 free memory = 1573688540 SRR13857041 SRAfilesize e6798e2e848dbcfc7f069b14151204a8 SRR13857041.sra SRR13857041.sra file validated SRR13857041 is paired end SRR13857041 is conventional basespace SRR13857041 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857041_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3125 32.0 32.0 32.0 2.0 32.0 2 31.47125 32.0 32.0 32.0 32.0 32.0 3 34.9475 37.0 32.0 37.0 32.0 37.0 4 36.05125 37.0 37.0 37.0 32.0 37.0 5 36.16625 37.0 37.0 37.0 37.0 37.0 6 39.659 41.0 41.0 41.0 37.0 41.0 7 39.553 41.0 41.0 41.0 37.0 41.0 8 39.78275 41.0 41.0 41.0 37.0 41.0 9 39.812 41.0 41.0 41.0 37.0 41.0 10-14 39.93635 41.0 41.0 41.0 37.0 41.0 15-19 39.819199999999995 41.0 41.0 41.0 37.0 41.0 20-24 39.6873 41.0 41.0 41.0 37.0 41.0 25-29 39.5106 41.0 41.0 41.0 37.0 41.0 30-34 39.396 41.0 41.0 41.0 37.0 41.0 35-39 39.2787 41.0 41.0 41.0 37.0 41.0 40-44 39.2517 41.0 41.0 41.0 37.0 41.0 45-49 38.965050000000005 41.0 41.0 41.0 36.0 41.0 50-54 39.101749999999996 41.0 41.0 41.0 37.0 41.0 55-59 38.75665 41.0 41.0 41.0 33.0 41.0 60-64 38.82965 41.0 41.0 41.0 33.0 41.0 65-69 38.7079 41.0 41.0 41.0 32.0 41.0 70-74 38.58275 41.0 41.0 41.0 32.0 41.0 75-79 38.35795 41.0 39.4 41.0 32.0 41.0 80-84 38.69815 41.0 41.0 41.0 32.0 41.0 85-89 38.6307 41.0 41.0 41.0 32.0 41.0 90-94 38.6413 41.0 41.0 41.0 32.0 41.0 95-99 38.5167 41.0 41.0 41.0 32.0 41.0 100-104 38.4957 41.0 41.0 41.0 32.0 41.0 105-109 38.306 41.0 41.0 41.0 32.0 41.0 110-114 38.097249999999995 41.0 39.4 41.0 31.0 41.0 115-119 37.9914 41.0 37.0 41.0 30.0 41.0 120-124 37.71554999999999 41.0 37.0 41.0 27.0 41.0 125-129 37.50840000000001 41.0 37.0 41.0 27.0 41.0 130-134 37.44235 41.0 37.0 41.0 27.0 41.0 135-139 36.642849999999996 41.0 36.0 41.0 23.0 41.0 140-144 36.5665 41.0 37.0 41.0 23.0 41.0 145-149 36.49655 41.0 37.0 41.0 23.0 41.0 150 36.29975 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 17.0 24 37.0 25 40.0 26 43.0 27 46.0 28 41.0 29 55.0 30 59.0 31 61.0 32 64.0 33 72.0 34 92.0 35 94.0 36 124.0 37 158.0 38 244.0 39 442.0 40 2308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.522555337629587 27.486690949845894 16.419165032221912 40.571588680302604 2 17.75443860965241 22.58064516129032 44.26106526631658 15.403850962740684 3 17.025000000000002 26.775 32.35 23.849999999999998 4 17.775 24.349999999999998 35.0 22.875 5 28.7 24.625 27.425 19.25 6 21.725 24.5 33.025 20.75 7 26.25 25.75 27.375 20.625 8 18.5 23.275000000000002 38.4 19.825 9 22.45 21.575 34.725 21.25 10-14 24.58 25.985000000000003 27.439999999999998 21.995 15-19 24.195 25.66 26.085 24.060000000000002 20-24 23.54 24.9 28.015 23.544999999999998 25-29 23.28 26.185000000000002 26.790000000000003 23.745 30-34 23.35 25.935000000000002 26.69 24.025 35-39 24.044999999999998 26.19 26.13 23.635 40-44 23.61 26.474999999999998 26.185000000000002 23.73 45-49 23.355 26.815 26.135 23.695 50-54 24.26 25.674999999999997 26.345000000000002 23.72 55-59 24.185000000000002 26.040000000000003 26.040000000000003 23.735 60-64 23.575 25.624999999999996 26.295 24.505 65-69 23.785 25.8 26.47 23.945 70-74 23.794999999999998 25.995 26.33 23.880000000000003 75-79 23.525 26.085 25.97 24.42 80-84 23.76 26.87 25.685000000000002 23.685000000000002 85-89 23.825 26.590000000000003 26.11 23.474999999999998 90-94 23.605 26.395000000000003 26.465 23.535 95-99 23.265 26.775 26.02 23.94 100-104 24.201941358951267 25.86310417292104 25.662964074852397 24.271990393275292 105-109 23.150000000000002 26.91 25.985000000000003 23.955000000000002 110-114 23.580611275073785 26.36686508929018 26.266820069031066 23.785703566604973 115-119 23.651182559127957 26.416320816040802 25.956297814890743 23.976198809940495 120-124 23.630994093502853 26.684352788066874 25.69326258884773 23.99139052958254 125-129 23.82405924739792 27.071657325860688 25.58546837469976 23.518815052041635 130-134 23.450552748736932 26.717022660197088 26.20179080586264 23.630633785203344 135-139 23.126970622090987 27.586206896551722 25.539262299184223 23.747560182173064 140-144 23.57853678051708 28.004200630094516 24.978746812021804 23.438515777366607 145-149 24.37 28.375 24.365000000000002 22.89 150 23.225 28.025 24.55 24.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 3.0 4 3.0 5 1.5 6 1.0 7 0.5 8 0.0 9 1.0 10 1.5 11 1.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.5 18 2.0 19 2.5 20 2.0 21 5.0 22 6.0 23 4.5 24 5.5 25 5.0 26 12.0 27 18.0 28 15.5 29 19.5 30 25.0 31 26.5 32 33.0 33 41.5 34 52.5 35 70.5 36 76.5 37 75.5 38 91.0 39 103.0 40 109.0 41 137.5 42 170.0 43 183.5 44 204.5 45 211.5 46 177.5 47 165.0 48 185.0 49 186.0 50 166.5 51 147.5 52 132.5 53 123.5 54 118.5 55 100.5 56 79.5 57 76.0 58 76.0 59 88.0 60 86.0 61 51.0 62 40.0 63 45.5 64 35.0 65 26.5 66 21.0 67 25.0 68 30.5 69 21.5 70 13.0 71 10.0 72 8.5 73 5.0 74 5.0 75 5.5 76 6.5 77 7.0 78 5.0 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.775 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.045 115-119 0.005 120-124 0.11 125-129 0.08 130-134 0.045 135-139 0.095 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.44456611004654 84.425 2 6.077196824527785 11.1 3 1.094990418833835 3.0 4 0.32849712565015055 1.2 5 0.027374760470845878 0.125 6 0.027374760470845878 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGG 6 0.15 No Hit CTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.225 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGAGC 10 0.0069827023 143.9375 8 GTAGGAG 10 0.0069827023 143.9375 7 AATCGGT 10 0.0069827023 143.9375 2 AGGAGCG 10 0.0069827023 143.9375 9 CTTTGTG 25 4.2557604E-6 122.826675 1 TTTGTGT 30 1.464372E-5 95.95833 2 GTGTTTG 50 1.9987729E-6 71.96876 5 TGTGTTT 50 1.9987729E-6 71.96876 4 TGTTTGA 60 5.9029408E-6 59.973953 6 GTTTGAG 50 1.842775E-4 57.575005 7 TTGTGTT 50 1.842775E-4 57.575005 3 >>END_MODULE SRR13857041 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857041_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.70875 32.0 2.0 32.0 2.0 32.0 2 29.88625 32.0 32.0 32.0 27.0 32.0 3 31.8675 32.0 32.0 37.0 22.0 37.0 4 32.6025 37.0 27.0 37.0 22.0 37.0 5 34.37125 37.0 37.0 37.0 27.0 37.0 6 37.45475 41.0 37.0 41.0 27.0 41.0 7 38.13075 41.0 37.0 41.0 32.0 41.0 8 38.153 41.0 41.0 41.0 32.0 41.0 9 38.13975 41.0 37.0 41.0 32.0 41.0 10-14 37.96225 41.0 38.6 41.0 30.0 41.0 15-19 37.93255 41.0 38.6 41.0 29.0 41.0 20-24 38.230000000000004 41.0 37.8 41.0 31.0 41.0 25-29 38.18755 41.0 37.0 41.0 32.0 41.0 30-34 38.1231 41.0 37.0 41.0 32.0 41.0 35-39 38.00500000000001 41.0 37.0 41.0 31.0 41.0 40-44 37.975500000000004 41.0 37.0 41.0 30.0 41.0 45-49 37.731849999999994 41.0 37.0 41.0 28.0 41.0 50-54 37.537549999999996 41.0 37.0 41.0 28.0 41.0 55-59 37.8283 41.0 37.0 41.0 28.0 41.0 60-64 37.69715 41.0 37.0 41.0 28.0 41.0 65-69 37.606950000000005 41.0 37.0 41.0 27.0 41.0 70-74 37.627250000000004 41.0 37.0 41.0 27.0 41.0 75-79 36.67185 40.2 36.0 41.0 26.0 41.0 80-84 37.56085 41.0 37.0 41.0 27.0 41.0 85-89 37.4271 41.0 37.0 41.0 27.0 41.0 90-94 37.32809999999999 41.0 37.0 41.0 27.0 41.0 95-99 36.99634999999999 41.0 37.0 41.0 27.0 41.0 100-104 36.76925 41.0 37.0 41.0 26.0 41.0 105-109 36.3758 41.0 37.0 41.0 23.0 41.0 110-114 36.00345 41.0 34.0 41.0 22.0 41.0 115-119 35.2995 41.0 32.0 41.0 22.0 41.0 120-124 34.937400000000004 41.0 32.0 41.0 20.0 41.0 125-129 34.29359999999999 38.6 32.0 41.0 20.0 41.0 130-134 33.8584 37.0 28.0 41.0 14.0 41.0 135-139 33.46025 37.0 27.0 41.0 12.0 41.0 140-144 32.698449999999994 37.0 27.0 41.0 12.0 41.0 145-149 32.633050000000004 37.0 27.0 41.0 12.0 41.0 150 32.276 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 7.0 23 32.0 24 51.0 25 69.0 26 81.0 27 82.0 28 98.0 29 87.0 30 129.0 31 119.0 32 125.0 33 152.0 34 174.0 35 194.0 36 222.0 37 280.0 38 365.0 39 691.0 40 1042.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.752163650668765 27.45869394177813 17.38788355625492 40.40125885129819 2 16.675 24.25 44.4 14.674999999999999 3 18.224999999999998 25.900000000000002 32.925 22.95 4 18.875 24.3 33.900000000000006 22.925 5 28.249999999999996 23.575 29.025000000000002 19.15 6 21.224999999999998 24.0 34.449999999999996 20.325 7 25.05 25.5 29.225 20.225 8 18.35 22.8 38.35 20.5 9 21.875 22.15 35.85 20.125 10-14 23.251162558127906 25.67128356417821 28.931446572328618 22.146107305365266 15-19 24.32 24.740000000000002 26.965 23.974999999999998 20-24 23.101155057752887 25.506275313765688 28.616430821541076 22.776138806940345 25-29 23.385 25.424999999999997 27.744999999999997 23.445 30-34 23.755000000000003 25.525 27.42 23.3 35-39 24.211210560528027 25.256262813140655 27.04135206760338 23.491174558727938 40-44 24.09120456022801 25.711285564278214 27.076353817690883 23.121156057802892 45-49 24.591229561478073 25.751287564378217 27.341367068353417 22.31611580579029 50-54 24.44 25.115 27.045 23.400000000000002 55-59 24.43 25.385 26.52 23.665 60-64 24.12 24.58 27.384999999999998 23.915 65-69 23.65 25.535000000000004 27.08 23.735 70-74 23.43 25.095 27.93 23.544999999999998 75-79 23.48 26.19 26.495 23.835 80-84 23.665 26.115 26.435 23.785 85-89 23.76 26.58 26.595000000000002 23.064999999999998 90-94 23.65 26.46 26.55 23.34 95-99 23.830000000000002 25.685000000000002 26.685 23.799999999999997 100-104 24.15 25.415 26.345000000000002 24.09 105-109 23.265 25.31 26.97 24.455 110-114 23.599999999999998 25.619999999999997 27.150000000000002 23.630000000000003 115-119 24.060000000000002 25.790000000000003 26.424999999999997 23.724999999999998 120-124 24.085 25.900000000000002 26.205000000000002 23.810000000000002 125-129 23.474999999999998 26.095000000000002 26.584999999999997 23.845 130-134 23.36 25.685000000000002 27.96 22.994999999999997 135-139 23.580000000000002 26.235000000000003 26.435 23.75 140-144 24.25 26.5 25.790000000000003 23.46 145-149 24.725 26.640000000000004 25.75 22.884999999999998 150 23.9 25.75 26.400000000000002 23.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 1.5 7 1.0 8 0.5 9 0.5 10 1.0 11 1.5 12 2.0 13 2.0 14 1.5 15 2.0 16 1.5 17 3.0 18 4.0 19 3.0 20 3.5 21 4.5 22 5.5 23 7.0 24 8.5 25 8.5 26 11.5 27 15.0 28 18.5 29 18.0 30 20.5 31 30.5 32 33.0 33 32.5 34 51.0 35 68.0 36 71.0 37 83.5 38 94.5 39 105.0 40 128.5 41 152.5 42 152.0 43 181.5 44 232.5 45 217.0 46 188.0 47 177.0 48 169.0 49 180.5 50 172.0 51 149.0 52 137.5 53 130.5 54 119.5 55 95.5 56 88.0 57 96.0 58 85.0 59 64.5 60 52.0 61 44.5 62 46.5 63 43.0 64 31.0 65 25.5 66 22.0 67 19.0 68 17.0 69 12.5 70 8.0 71 9.0 72 8.5 73 5.0 74 3.0 75 2.0 76 4.0 77 6.5 78 5.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 36.449999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.18040558335528 90.35 2 4.398209112457203 8.35 3 0.31603897814063736 0.8999999999999999 4 0.10534632604687912 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.075 0.0 0.0 0.0 0.0 128-129 0.075 0.0 0.0 0.0 0.0 130-131 0.075 0.0 0.0 0.0 0.0 132-133 0.075 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAG 70 9.769052E-4 41.064285 7 TTTGTGT 70 9.769052E-4 41.064285 2 TGTTTGA 100 1.2212773E-4 35.93125 6 TTGTGTT 80 0.0018840677 35.93125 3 GTGTTTG 105 1.6276324E-4 34.220238 5 TGTGTTT 105 1.6276324E-4 34.220238 4 >>END_MODULE Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250916 spots for SRR13857041.sra Written 1250916 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra Read 1250897 spots for SRR13857041.sra Written 1250897 spots for SRR13857041.sra SRR ids: ['SRR13857041.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9bw3xtd4 SRR13857041.sra spots: 25017959 blocks: [[1, 1250897], [1250898, 2501794], [2501795, 3752691], [3752692, 5003588], [5003589, 6254485], [6254486, 7505382], [7505383, 8756279], [8756280, 10007176], [10007177, 11258073], [11258074, 12508970], [12508971, 13759867], [13759868, 15010764], [15010765, 16261661], [16261662, 17512558], [17512559, 18763455], [18763456, 20014352], [20014353, 21265249], [21265250, 22516146], [22516147, 23767043], [23767044, 25017959]] SRR13857041 file size 8431633 SRR13857041 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857041 SRR13857041_1.fastq SRR13857041_2.fastq Input file: SRR13857041_1.fastq Paired file: SRR13857041_2.fastq trimmed: SRR13857041-trimmed-pair1.fastq, SRR13857041-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:09:24 2025 >> started Tue Feb 11 21:09:50 2025 >> done (25.325s) 25017959 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 59 ( 0.00%) empty read pairs filtered out after trimming by size control 25017889 (100.00%) read pairs available; of these: 3169421 (12.67%) trimmed read pairs available after processing 21848468 (87.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 5 0.00% 21 14 0.00% 22 8 0.00% 23 7 0.00% 24 21 0.00% 25 16 0.00% 26 12 0.00% 27 20 0.00% 28 14 0.00% 29 18 0.00% 30 27 0.00% 31 23 0.00% 32 23 0.00% 33 30 0.00% 34 18 0.00% 35 32 0.00% 36 24 0.00% 37 30 0.00% 38 18 0.00% 39 31 0.00% 40 26 0.00% 41 30 0.00% 42 28 0.00% 43 38 0.00% 44 24 0.00% 45 42 0.00% 46 30 0.00% 47 60 0.00% 48 42 0.00% 49 60 0.00% 50 49 0.00% 51 84 0.00% 52 80 0.00% 53 79 0.00% 54 71 0.00% 55 72 0.00% 56 78 0.00% 57 92 0.00% 58 64 0.00% 59 150 0.00% 60 72 0.00% 61 138 0.00% 62 91 0.00% 63 193 0.00% 64 80 0.00% 65 163 0.00% 66 163 0.00% 67 176 0.00% 68 194 0.00% 69 131 0.00% 70 222 0.00% 71 128 0.00% 72 541 0.00% 73 138 0.00% 74 151 0.00% 75 149 0.00% 76 128 0.00% 77 137 0.00% 78 107 0.00% 79 115 0.00% 80 124 0.00% 81 130 0.00% 82 113 0.00% 83 141 0.00% 84 87 0.00% 85 138 0.00% 86 92 0.00% 87 163 0.00% 88 122 0.00% 89 147 0.00% 90 97 0.00% 91 167 0.00% 92 118 0.00% 93 86 0.00% 94 78 0.00% 95 115 0.00% 96 106 0.00% 97 90 0.00% 98 100 0.00% 99 112 0.00% 100 110 0.00% 101 104 0.00% 102 103 0.00% 103 97 0.00% 104 86 0.00% 105 82 0.00% 106 94 0.00% 107 113 0.00% 108 81 0.00% 109 96 0.00% 110 91 0.00% 111 117 0.00% 112 114 0.00% 113 119 0.00% 114 122 0.00% 115 136 0.00% 116 132 0.00% 117 144 0.00% 118 165 0.00% 119 193 0.00% 120 214 0.00% 121 235 0.00% 122 226 0.00% 123 250 0.00% 124 285 0.00% 125 321 0.00% 126 308 0.00% 127 295 0.00% 128 343 0.00% 129 368 0.00% 130 297 0.00% 131 305 0.00% 132 320 0.00% 133 1465 0.01% 134 117551 0.47% 135 123345 0.49% 136 124847 0.50% 137 128825 0.51% 138 132491 0.53% 139 134848 0.54% 140 136833 0.55% 141 143442 0.57% 142 144131 0.58% 143 148377 0.59% 144 149949 0.60% 145 156244 0.62% 146 157804 0.63% 147 169494 0.68% 148 222099 0.89% 149 964468 3.86% 150 21848468 87.33% 25017889 reads passed initial QC criterion=sequence-density sequence-density=3.52 sequence-density-rank=1 fanout-score=1.06 fanout-score-rank=39 prefix-density=1.78 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=94.80 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=6.11 sequence-density-rank=1 fanout-score=1.64 fanout-score-rank=44 prefix-density=7.05 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.33 sequence-density-rank=35 fanout-score=48.98 fanout-score-rank=1 prefix-density=11.93 prefix-fanout=1.3 sequence=TGTGTTTGAGCG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857041 SRR13857041_1.fastq SRR13857041_2.fastq Input file: SRR13857041_1.fastq Paired file: SRR13857041_2.fastq trimmed: SRR13857041-trimmed-pair1.fastq, SRR13857041-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:11:56 2025 >> started Tue Feb 11 21:12:12 2025 >> done (15.823s) 16678593 read pairs processed; of these: 127778 ( 0.77%) short read pairs filtered out after trimming by size control 99362 ( 0.60%) empty read pairs filtered out after trimming by size control 16451453 (98.64%) read pairs available; of these: 3158 ( 0.02%) trimmed read pairs available after processing 16448295 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 4 0.00% 21 13 0.00% 22 7 0.00% 23 2 0.00% 24 16 0.00% 25 11 0.00% 26 4 0.00% 27 14 0.00% 28 8 0.00% 29 13 0.00% 30 15 0.00% 31 19 0.00% 32 15 0.00% 33 23 0.00% 34 13 0.00% 35 22 0.00% 36 15 0.00% 37 21 0.00% 38 9 0.00% 39 21 0.00% 40 17 0.00% 41 19 0.00% 42 18 0.00% 43 21 0.00% 44 19 0.00% 45 29 0.00% 46 19 0.00% 47 37 0.00% 48 28 0.00% 49 42 0.00% 50 36 0.00% 51 56 0.00% 52 55 0.00% 53 50 0.00% 54 50 0.00% 55 50 0.00% 56 59 0.00% 57 64 0.00% 58 44 0.00% 59 101 0.00% 60 51 0.00% 61 91 0.00% 62 66 0.00% 63 133 0.00% 64 52 0.00% 65 103 0.00% 66 101 0.00% 67 127 0.00% 68 127 0.00% 69 86 0.00% 70 137 0.00% 71 92 0.00% 72 349 0.00% 73 89 0.00% 74 107 0.00% 75 99 0.00% 76 90 0.00% 77 91 0.00% 78 67 0.00% 79 83 0.00% 80 93 0.00% 81 86 0.00% 82 74 0.00% 83 94 0.00% 84 65 0.00% 85 90 0.00% 86 57 0.00% 87 103 0.00% 88 86 0.00% 89 94 0.00% 90 62 0.00% 91 110 0.00% 92 68 0.00% 93 61 0.00% 94 59 0.00% 95 76 0.00% 96 73 0.00% 97 64 0.00% 98 61 0.00% 99 76 0.00% 100 75 0.00% 101 77 0.00% 102 70 0.00% 103 63 0.00% 104 55 0.00% 105 51 0.00% 106 63 0.00% 107 84 0.00% 108 63 0.00% 109 53 0.00% 110 64 0.00% 111 88 0.00% 112 80 0.00% 113 83 0.00% 114 90 0.00% 115 87 0.00% 116 89 0.00% 117 90 0.00% 118 109 0.00% 119 131 0.00% 120 142 0.00% 121 155 0.00% 122 155 0.00% 123 172 0.00% 124 191 0.00% 125 198 0.00% 126 199 0.00% 127 206 0.00% 128 228 0.00% 129 240 0.00% 130 199 0.00% 131 201 0.00% 132 237 0.00% 133 978 0.01% 134 77371 0.47% 135 81137 0.49% 136 82434 0.50% 137 84663 0.51% 138 87550 0.53% 139 88439 0.54% 140 90107 0.55% 141 94271 0.57% 142 95162 0.58% 143 98253 0.60% 144 98798 0.60% 145 102782 0.62% 146 104547 0.64% 147 112317 0.68% 148 146962 0.89% 149 632425 3.84% 150 14364390 87.31% criterion=sequence-density sequence-density=2.97 sequence-density-rank=1 fanout-score=1.06 fanout-score-rank=41 prefix-density=1.81 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=46.26 fanout-score-rank=1 prefix-density=3.13 prefix-fanout=1.1 sequence=GTGTTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCGGTAGAAGG criterion=sequence-density sequence-density=5.36 sequence-density-rank=1 fanout-score=1.88 fanout-score-rank=44 prefix-density=7.01 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.30 sequence-density-rank=36 fanout-score=52.73 fanout-score-rank=1 prefix-density=11.52 prefix-fanout=1.4 sequence=TGTGTTTGAGCG SRR13857041 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:13:40 Started mapping on | Feb 11 21:13:40 Finished on | Feb 11 21:21:23 Mapping speed, Million of reads per hour | 192.76 Number of input reads | 24790749 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10188809 Uniquely mapped reads % | 41.10% Average mapped length | 279.96 Number of splices: Total | 5406471 Number of splices: Annotated (sjdb) | 5229162 Number of splices: GT/AG | 5265520 Number of splices: GC/AG | 71280 Number of splices: AT/AC | 7841 Number of splices: Non-canonical | 61830 Mismatch rate per base, % | 0.69% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 550788 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 9096137 % of reads mapped to too many loci | 36.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.29% % of reads unmapped: other | 8.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14051152 14051152 14051152 N_multimapping 550788 550788 550788 N_noFeature 3020303 6626852 6513358 N_ambiguous 141188 36414 36208 UnstrandedReadsAssigned:7027318 PositiveStrandReadsAssigned:3525543 NegativeStrandReadsAssigned:3639243 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857041 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857041-trimmed-pair1.fastq SRR13857041-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,790,749 reads, 19,212,245 reads pseudoaligned [quant] estimated average fragment length: 192.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,264 rounds 52401 SRR13857041.ke.tsv 34699 SRR13857041.se.tsv 87100 total ==> SRR13857041.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.5 905 17.2536 Potri.005G024800.1.v4.1 1035 843.499 78 3.22003 Potri.004G059700.1.v4.1 961 769.505 18 0.814537 Potri.007G009000.2.v4.1 1416 1224.5 0 0 Potri.003G141000.2.v4.1 2943 2751.5 245.158 3.10261 Potri.016G087400.1.v4.1 270 92.3598 233 87.8462 Potri.015G069301.1.v4.1 564 372.619 0 0 Potri.010G195200.1.v4.1 1773 1581.5 8 0.176145 Potri.012G127500.1.v4.1 977 785.505 26 1.15259 ==> SRR13857041.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 118 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 56 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857041 completed mapping pipeline successfully