Starting /dee2/code/volunteer_pipeline.sh SRR13857042 current disk space = 3053039321088 free memory = 1579888652 SRR13857042 SRAfilesize 2102a2e6aa28e98cc62fda7eabb56df2 SRR13857042.sra SRR13857042.sra file validated SRR13857042 is paired end SRR13857042 is conventional basespace SRR13857042 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857042_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.64 32.0 32.0 32.0 12.0 32.0 2 31.63375 32.0 32.0 32.0 32.0 32.0 3 35.19125 37.0 32.0 37.0 32.0 37.0 4 36.1725 37.0 37.0 37.0 32.0 37.0 5 36.38 37.0 37.0 37.0 37.0 37.0 6 39.935 41.0 41.0 41.0 37.0 41.0 7 40.12025 41.0 41.0 41.0 37.0 41.0 8 40.0885 41.0 41.0 41.0 37.0 41.0 9 40.09675 41.0 41.0 41.0 37.0 41.0 10-14 40.11395 41.0 41.0 41.0 37.0 41.0 15-19 40.08755 41.0 41.0 41.0 37.0 41.0 20-24 39.89415 41.0 41.0 41.0 37.0 41.0 25-29 39.696549999999995 41.0 41.0 41.0 37.0 41.0 30-34 39.45605 41.0 41.0 41.0 37.0 41.0 35-39 39.3863 41.0 41.0 41.0 37.0 41.0 40-44 39.28189999999999 41.0 41.0 41.0 37.0 41.0 45-49 38.93885 41.0 41.0 41.0 36.0 41.0 50-54 38.60875 41.0 41.0 41.0 32.0 41.0 55-59 38.1788 41.0 39.4 41.0 31.0 41.0 60-64 37.8038 41.0 37.0 41.0 27.0 41.0 65-69 37.8226 41.0 37.0 41.0 27.0 41.0 70-74 37.96815 41.0 37.8 41.0 30.0 41.0 75-79 37.63385 41.0 37.8 41.0 28.0 41.0 80-84 38.12435 41.0 39.4 41.0 31.0 41.0 85-89 38.367000000000004 41.0 41.0 41.0 32.0 41.0 90-94 38.54315 41.0 41.0 41.0 32.0 41.0 95-99 38.37815 41.0 41.0 41.0 32.0 41.0 100-104 38.468650000000004 41.0 41.0 41.0 32.0 41.0 105-109 38.61855 41.0 41.0 41.0 32.0 41.0 110-114 38.54225 41.0 41.0 41.0 32.0 41.0 115-119 38.31385 41.0 40.2 41.0 32.0 41.0 120-124 38.25905 41.0 39.4 41.0 32.0 41.0 125-129 38.114549999999994 41.0 37.8 41.0 31.0 41.0 130-134 37.83015 41.0 37.0 41.0 30.0 41.0 135-139 37.7273 41.0 37.0 41.0 30.0 41.0 140-144 37.59705 41.0 37.0 41.0 28.0 41.0 145-149 37.211349999999996 41.0 37.0 41.0 27.0 41.0 150 37.21375 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 19.0 24 25.0 25 41.0 26 48.0 27 37.0 28 48.0 29 52.0 30 55.0 31 40.0 32 61.0 33 94.0 34 87.0 35 97.0 36 123.0 37 140.0 38 252.0 39 449.0 40 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.226289517470883 27.121464226289515 17.831392124237382 40.82085413200222 2 18.5 23.225 43.675000000000004 14.6 3 17.974999999999998 25.95 34.925 21.15 4 20.424999999999997 23.5 33.025 23.05 5 29.45 22.6 27.875 20.075000000000003 6 21.0 25.174999999999997 32.9 20.925 7 25.650000000000002 25.4 28.375 20.575 8 17.625 22.35 37.55 22.475 9 19.900000000000002 22.7 35.725 21.675 10-14 23.599999999999998 25.919999999999998 27.52 22.96 15-19 23.669999999999998 25.990000000000002 26.19 24.15 20-24 23.625 25.455 27.015 23.905 25-29 23.59 25.435000000000002 26.6 24.375 30-34 23.985 26.224999999999998 26.064999999999998 23.724999999999998 35-39 23.669999999999998 26.290000000000003 25.919999999999998 24.12 40-44 24.104999999999997 25.71 26.064999999999998 24.12 45-49 24.14 26.645000000000003 25.495 23.72 50-54 23.965 25.935000000000002 25.825 24.275 55-59 23.669999999999998 26.465 25.715 24.15 60-64 23.14 25.885 26.090000000000003 24.884999999999998 65-69 23.855 26.495 25.805 23.845 70-74 23.32 26.284999999999997 26.565 23.830000000000002 75-79 23.16 26.715 25.945 24.18 80-84 23.96 26.669999999999998 25.3 24.07 85-89 23.665 27.165 25.47 23.7 90-94 23.965 27.095000000000002 25.275 23.665 95-99 23.97 26.515 26.055 23.46 100-104 24.436109027256812 26.531632908227053 25.52138034508627 23.510877719429857 105-109 23.405 26.8 25.735000000000003 24.060000000000002 110-114 23.63972794558912 26.125225045009003 26.7003400680136 23.53470694138828 115-119 24.085 27.005000000000003 25.685000000000002 23.225 120-124 24.295933169926467 27.31229053073883 25.086288829973487 23.305487469361214 125-129 24.43 26.009999999999998 25.81 23.75 130-134 23.45 25.990000000000002 26.5 24.060000000000002 135-139 23.584150490294174 26.956173704222536 25.61536922153292 23.84430658395037 140-144 24.39 27.805000000000003 25.055 22.75 145-149 24.455 28.465 24.404999999999998 22.675 150 24.15 28.499999999999996 23.9 23.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 3.5 17 4.5 18 4.0 19 5.0 20 4.5 21 4.5 22 5.5 23 9.5 24 11.0 25 8.5 26 8.5 27 15.0 28 15.5 29 17.5 30 25.5 31 27.5 32 29.0 33 28.5 34 31.5 35 49.5 36 67.5 37 72.0 38 76.5 39 94.5 40 120.5 41 137.0 42 158.0 43 170.0 44 194.5 45 242.5 46 207.5 47 159.5 48 161.5 49 165.5 50 182.5 51 179.0 52 157.0 53 138.5 54 128.5 55 116.0 56 112.0 57 105.5 58 81.0 59 79.0 60 65.5 61 45.0 62 37.5 63 32.5 64 29.0 65 20.5 66 20.0 67 23.0 68 24.0 69 20.0 70 13.5 71 9.5 72 9.0 73 7.0 74 5.5 75 4.5 76 4.5 77 5.0 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.02 115-119 0.0 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.06 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.57090082409775 78.8 2 8.042057402671213 14.149999999999999 3 1.875532821824382 4.95 4 0.36942313157146917 1.3 5 0.05683432793407218 0.25 6 0.02841716396703609 0.15 7 0.02841716396703609 0.17500000000000002 8 0.0 0.0 9 0.02841716396703609 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATC 9 0.22499999999999998 No Hit GGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAA 7 0.17500000000000002 No Hit ATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCC 6 0.15 No Hit CTGACAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAA 5 0.125 No Hit CGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138 2.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTTG 10 0.0050872327 159.79167 1 TAACGGA 10 0.0070008645 143.8125 4 TCTATTT 10 0.0070008645 143.8125 4 ACATCAA 10 0.0070008645 143.8125 9 CGGAATT 10 0.0070008645 143.8125 7 TTAACGG 10 0.0070008645 143.8125 3 >>END_MODULE SRR13857042 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857042_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.18875 27.0 2.0 32.0 2.0 32.0 2 30.83875 32.0 32.0 32.0 32.0 32.0 3 32.34375 32.0 32.0 37.0 32.0 37.0 4 33.8225 37.0 32.0 37.0 27.0 37.0 5 34.7525 37.0 37.0 37.0 27.0 37.0 6 37.908 41.0 37.0 41.0 27.0 41.0 7 38.234 41.0 37.0 41.0 32.0 41.0 8 38.47925 41.0 41.0 41.0 32.0 41.0 9 38.08275 41.0 37.0 41.0 32.0 41.0 10-14 38.61015 41.0 41.0 41.0 32.0 41.0 15-19 38.505700000000004 41.0 41.0 41.0 32.0 41.0 20-24 38.59245 41.0 41.0 41.0 32.0 41.0 25-29 38.550349999999995 41.0 41.0 41.0 32.0 41.0 30-34 38.2983 41.0 40.2 41.0 30.0 41.0 35-39 38.6034 41.0 41.0 41.0 32.0 41.0 40-44 38.580099999999995 41.0 41.0 41.0 32.0 41.0 45-49 38.54245 41.0 40.2 41.0 32.0 41.0 50-54 38.535849999999996 41.0 41.0 41.0 32.0 41.0 55-59 38.68005 41.0 41.0 41.0 32.0 41.0 60-64 38.4563 41.0 41.0 41.0 32.0 41.0 65-69 38.75320000000001 41.0 41.0 41.0 33.0 41.0 70-74 38.520500000000006 41.0 41.0 41.0 32.0 41.0 75-79 37.7779 40.2 38.6 41.0 30.0 41.0 80-84 38.5269 41.0 41.0 41.0 32.0 41.0 85-89 38.3634 41.0 40.2 41.0 32.0 41.0 90-94 38.0856 41.0 37.0 41.0 32.0 41.0 95-99 38.00075 41.0 37.0 41.0 31.0 41.0 100-104 37.7039 41.0 37.0 41.0 29.0 41.0 105-109 37.487350000000006 41.0 37.0 41.0 28.0 41.0 110-114 37.161649999999995 41.0 37.0 41.0 27.0 41.0 115-119 36.8299 41.0 37.0 41.0 26.0 41.0 120-124 36.46105 41.0 36.0 41.0 25.0 41.0 125-129 36.350199999999994 41.0 37.0 41.0 23.0 41.0 130-134 35.76735 41.0 34.0 41.0 22.0 41.0 135-139 35.458299999999994 41.0 32.0 41.0 22.0 41.0 140-144 35.0165 41.0 32.0 41.0 22.0 41.0 145-149 34.45505 40.2 31.0 41.0 20.0 41.0 150 33.75525 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 10.0 23 26.0 24 35.0 25 51.0 26 59.0 27 56.0 28 69.0 29 82.0 30 84.0 31 77.0 32 98.0 33 115.0 34 118.0 35 141.0 36 162.0 37 237.0 38 336.0 39 574.0 40 1670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.461538461538462 27.153846153846157 20.5 37.88461538461539 2 19.3 23.1 42.825 14.774999999999999 3 17.849999999999998 27.0 33.85 21.3 4 19.875 24.075 33.725 22.325 5 28.475 23.35 27.825 20.349999999999998 6 21.25 24.425 32.975 21.349999999999998 7 25.624999999999996 25.874999999999996 28.925 19.575 8 18.775 21.9 38.224999999999994 21.099999999999998 9 21.9 22.175 35.099999999999994 20.825 10-14 23.985 26.145000000000003 27.74 22.13 15-19 24.169999999999998 25.385 26.665 23.78 20-24 23.51 25.324999999999996 27.744999999999997 23.419999999999998 25-29 23.425 25.94 27.065 23.57 30-34 23.945 25.985000000000003 26.619999999999997 23.45 35-39 24.145 26.179999999999996 26.46 23.215 40-44 23.995 26.040000000000003 26.105 23.86 45-49 24.18 25.525 25.995 24.3 50-54 23.775 25.324999999999996 26.91 23.990000000000002 55-59 24.075 25.019999999999996 26.419999999999998 24.485 60-64 24.015 25.105 26.85 24.03 65-69 23.705000000000002 26.365 26.405 23.525 70-74 23.685000000000002 25.814999999999998 26.495 24.005000000000003 75-79 23.43 25.695 26.834999999999997 24.04 80-84 24.135 25.295 26.555 24.015 85-89 23.51 25.995 26.08 24.415 90-94 24.474999999999998 26.305 26.25 22.97 95-99 23.79 26.06 26.229999999999997 23.919999999999998 100-104 24.175 25.245 26.924999999999997 23.655 105-109 23.7 25.91 27.075 23.315 110-114 23.330000000000002 25.61 26.700000000000003 24.36 115-119 24.12 25.735000000000003 26.145000000000003 24.0 120-124 23.815 25.740000000000002 26.44 24.005000000000003 125-129 23.64 25.69 27.139999999999997 23.53 130-134 24.255 25.174999999999997 26.66 23.91 135-139 24.14 26.955000000000002 25.91 22.994999999999997 140-144 24.95 26.779999999999998 25.230000000000004 23.04 145-149 24.845 27.694999999999997 24.565 22.895 150 25.2 26.1 24.525 24.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 1.5 7 1.5 8 1.5 9 2.0 10 1.5 11 1.5 12 1.5 13 2.0 14 2.5 15 1.5 16 1.5 17 2.0 18 2.5 19 4.5 20 4.5 21 3.5 22 5.0 23 4.5 24 6.5 25 8.5 26 8.0 27 11.5 28 13.0 29 12.5 30 17.5 31 23.5 32 25.5 33 30.0 34 45.0 35 58.0 36 63.5 37 70.5 38 79.0 39 101.5 40 120.5 41 144.0 42 167.5 43 183.5 44 215.0 45 231.5 46 199.0 47 167.5 48 174.5 49 183.0 50 183.5 51 170.0 52 149.5 53 136.0 54 130.0 55 116.0 56 104.5 57 106.5 58 93.5 59 75.5 60 64.5 61 40.5 62 26.0 63 30.0 64 26.0 65 22.0 66 22.0 67 20.5 68 18.5 69 16.0 70 12.5 71 8.0 72 5.0 73 2.5 74 2.0 75 1.5 76 1.5 77 3.0 78 3.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 35.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.05217626385509 86.05000000000001 2 6.082725060827251 11.25 3 0.5947553392808868 1.6500000000000001 4 0.21627466882941337 0.8 5 0.054068667207353344 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGG 5 0.125 No Hit CGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTCA 10 0.007024571 143.65001 4 CTTTGTG 60 0.005066217 55.25 1 >>END_MODULE Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178885 spots for SRR13857042.sra Written 1178885 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra Read 1178874 spots for SRR13857042.sra Written 1178874 spots for SRR13857042.sra SRR ids: ['SRR13857042.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jdoa8jl SRR13857042.sra spots: 23577491 blocks: [[1, 1178874], [1178875, 2357748], [2357749, 3536622], [3536623, 4715496], [4715497, 5894370], [5894371, 7073244], [7073245, 8252118], [8252119, 9430992], [9430993, 10609866], [10609867, 11788740], [11788741, 12967614], [12967615, 14146488], [14146489, 15325362], [15325363, 16504236], [16504237, 17683110], [17683111, 18861984], [18861985, 20040858], [20040859, 21219732], [21219733, 22398606], [22398607, 23577491]] SRR13857042 file size 7944912 SRR13857042 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857042 SRR13857042_1.fastq SRR13857042_2.fastq Input file: SRR13857042_1.fastq Paired file: SRR13857042_2.fastq trimmed: SRR13857042-trimmed-pair1.fastq, SRR13857042-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:15:15 2025 >> started Tue Feb 11 21:15:39 2025 >> done (24.385s) 23577491 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 17 ( 0.00%) empty read pairs filtered out after trimming by size control 23577468 (100.00%) read pairs available; of these: 2951414 (12.52%) trimmed read pairs available after processing 20626054 (87.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 8 0.00% 22 5 0.00% 23 13 0.00% 24 12 0.00% 25 7 0.00% 26 16 0.00% 27 17 0.00% 28 6 0.00% 29 19 0.00% 30 16 0.00% 31 15 0.00% 32 21 0.00% 33 30 0.00% 34 14 0.00% 35 24 0.00% 36 16 0.00% 37 28 0.00% 38 19 0.00% 39 22 0.00% 40 18 0.00% 41 31 0.00% 42 27 0.00% 43 30 0.00% 44 17 0.00% 45 27 0.00% 46 28 0.00% 47 33 0.00% 48 34 0.00% 49 47 0.00% 50 46 0.00% 51 70 0.00% 52 40 0.00% 53 62 0.00% 54 54 0.00% 55 65 0.00% 56 55 0.00% 57 76 0.00% 58 53 0.00% 59 132 0.00% 60 58 0.00% 61 121 0.00% 62 86 0.00% 63 147 0.00% 64 58 0.00% 65 139 0.00% 66 115 0.00% 67 198 0.00% 68 205 0.00% 69 113 0.00% 70 174 0.00% 71 132 0.00% 72 388 0.00% 73 118 0.00% 74 116 0.00% 75 140 0.00% 76 126 0.00% 77 119 0.00% 78 123 0.00% 79 128 0.00% 80 137 0.00% 81 125 0.00% 82 98 0.00% 83 112 0.00% 84 107 0.00% 85 120 0.00% 86 94 0.00% 87 135 0.00% 88 126 0.00% 89 109 0.00% 90 108 0.00% 91 180 0.00% 92 74 0.00% 93 85 0.00% 94 87 0.00% 95 106 0.00% 96 98 0.00% 97 113 0.00% 98 90 0.00% 99 101 0.00% 100 65 0.00% 101 91 0.00% 102 82 0.00% 103 93 0.00% 104 86 0.00% 105 69 0.00% 106 68 0.00% 107 97 0.00% 108 99 0.00% 109 103 0.00% 110 101 0.00% 111 121 0.00% 112 94 0.00% 113 93 0.00% 114 93 0.00% 115 121 0.00% 116 106 0.00% 117 121 0.00% 118 140 0.00% 119 131 0.00% 120 173 0.00% 121 180 0.00% 122 174 0.00% 123 209 0.00% 124 227 0.00% 125 241 0.00% 126 238 0.00% 127 246 0.00% 128 245 0.00% 129 285 0.00% 130 267 0.00% 131 232 0.00% 132 279 0.00% 133 1033 0.00% 134 113682 0.48% 135 120142 0.51% 136 123692 0.52% 137 126612 0.54% 138 131058 0.56% 139 134642 0.57% 140 137050 0.58% 141 140451 0.60% 142 144381 0.61% 143 148499 0.63% 144 151450 0.64% 145 156276 0.66% 146 157458 0.67% 147 165005 0.70% 148 202273 0.86% 149 786472 3.34% 150 20626054 87.48% 23577468 reads passed initial QC criterion=sequence-density sequence-density=3.38 sequence-density-rank=1 fanout-score=1.11 fanout-score-rank=39 prefix-density=0.85 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=130.55 fanout-score-rank=1 prefix-density=2.38 prefix-fanout=1.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=5.40 sequence-density-rank=1 fanout-score=1.42 fanout-score-rank=45 prefix-density=5.05 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=45 fanout-score=90.84 fanout-score-rank=1 prefix-density=2.34 prefix-fanout=1.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857042 SRR13857042_1.fastq SRR13857042_2.fastq Input file: SRR13857042_1.fastq Paired file: SRR13857042_2.fastq trimmed: SRR13857042-trimmed-pair1.fastq, SRR13857042-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:18:16 2025 >> started Tue Feb 11 21:18:31 2025 >> done (14.335s) 14146481 read pairs processed; of these: 124758 ( 0.88%) short read pairs filtered out after trimming by size control 66832 ( 0.47%) empty read pairs filtered out after trimming by size control 13954891 (98.65%) read pairs available; of these: 2798 ( 0.02%) trimmed read pairs available after processing 13952093 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 6 0.00% 22 2 0.00% 23 7 0.00% 24 7 0.00% 25 4 0.00% 26 9 0.00% 27 10 0.00% 28 3 0.00% 29 13 0.00% 30 13 0.00% 31 6 0.00% 32 12 0.00% 33 17 0.00% 34 7 0.00% 35 16 0.00% 36 10 0.00% 37 19 0.00% 38 9 0.00% 39 14 0.00% 40 11 0.00% 41 14 0.00% 42 19 0.00% 43 19 0.00% 44 9 0.00% 45 17 0.00% 46 12 0.00% 47 19 0.00% 48 19 0.00% 49 31 0.00% 50 28 0.00% 51 50 0.00% 52 25 0.00% 53 31 0.00% 54 36 0.00% 55 39 0.00% 56 34 0.00% 57 43 0.00% 58 33 0.00% 59 80 0.00% 60 34 0.00% 61 73 0.00% 62 53 0.00% 63 91 0.00% 64 36 0.00% 65 86 0.00% 66 70 0.00% 67 125 0.00% 68 117 0.00% 69 65 0.00% 70 118 0.00% 71 81 0.00% 72 219 0.00% 73 67 0.00% 74 71 0.00% 75 83 0.00% 76 77 0.00% 77 86 0.00% 78 73 0.00% 79 72 0.00% 80 93 0.00% 81 78 0.00% 82 49 0.00% 83 68 0.00% 84 69 0.00% 85 72 0.00% 86 52 0.00% 87 81 0.00% 88 72 0.00% 89 56 0.00% 90 64 0.00% 91 122 0.00% 92 48 0.00% 93 56 0.00% 94 51 0.00% 95 56 0.00% 96 66 0.00% 97 73 0.00% 98 59 0.00% 99 56 0.00% 100 40 0.00% 101 57 0.00% 102 54 0.00% 103 59 0.00% 104 51 0.00% 105 45 0.00% 106 35 0.00% 107 60 0.00% 108 65 0.00% 109 49 0.00% 110 60 0.00% 111 70 0.00% 112 61 0.00% 113 57 0.00% 114 57 0.00% 115 73 0.00% 116 57 0.00% 117 64 0.00% 118 76 0.00% 119 82 0.00% 120 104 0.00% 121 106 0.00% 122 111 0.00% 123 132 0.00% 124 135 0.00% 125 147 0.00% 126 136 0.00% 127 151 0.00% 128 139 0.00% 129 178 0.00% 130 162 0.00% 131 140 0.00% 132 191 0.00% 133 622 0.00% 134 67264 0.48% 135 71435 0.51% 136 73161 0.52% 137 75265 0.54% 138 78019 0.56% 139 79642 0.57% 140 81254 0.58% 141 83068 0.60% 142 85790 0.61% 143 87984 0.63% 144 89700 0.64% 145 92977 0.67% 146 94026 0.67% 147 98808 0.71% 148 119867 0.86% 149 464397 3.33% 150 12204815 87.46% criterion=sequence-density sequence-density=2.84 sequence-density-rank=1 fanout-score=1.13 fanout-score-rank=39 prefix-density=0.84 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=120.59 fanout-score-rank=1 prefix-density=2.34 prefix-fanout=1.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=4.66 sequence-density-rank=1 fanout-score=1.61 fanout-score-rank=45 prefix-density=5.18 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=45 fanout-score=44.02 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=2.2 sequence=CCTCTCCGGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATACGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGGATGGGGGCCGGCGATGCG SRR13857042 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:38:00 Started mapping on | Feb 11 21:38:00 Finished on | Feb 11 21:45:09 Mapping speed, Million of reads per hour | 196.24 Number of input reads | 23385605 Average input read length | 274 UNIQUE READS: Uniquely mapped reads number | 7536392 Uniquely mapped reads % | 32.23% Average mapped length | 266.57 Number of splices: Total | 3807368 Number of splices: Annotated (sjdb) | 3701099 Number of splices: GT/AG | 3719872 Number of splices: GC/AG | 52447 Number of splices: AT/AC | 5676 Number of splices: Non-canonical | 29373 Mismatch rate per base, % | 0.65% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 3.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 532600 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 10236931 % of reads mapped to too many loci | 43.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.14% % of reads unmapped: other | 8.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 15316613 15316613 15316613 N_multimapping 532600 532600 532600 N_noFeature 2143272 4844204 4755361 N_ambiguous 150100 34761 35488 UnstrandedReadsAssigned:5243020 PositiveStrandReadsAssigned:2657427 NegativeStrandReadsAssigned:2745543 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR13857042 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857042-trimmed-pair1.fastq SRR13857042-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,385,605 reads, 18,557,791 reads pseudoaligned [quant] estimated average fragment length: 175.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR13857042.ke.tsv 34699 SRR13857042.se.tsv 87100 total ==> SRR13857042.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1843.47 266 5.64119 Potri.005G024800.1.v4.1 1035 860.468 52 2.36262 Potri.004G059700.1.v4.1 961 786.472 246 12.2286 Potri.007G009000.2.v4.1 1416 1241.47 0 0 Potri.003G141000.2.v4.1 2943 2768.47 156.402 2.20866 Potri.016G087400.1.v4.1 270 105.634 307 113.621 Potri.015G069301.1.v4.1 564 389.605 0 0 Potri.010G195200.1.v4.1 1773 1598.47 0 0 Potri.012G127500.1.v4.1 977 802.468 20 0.974376 ==> SRR13857042.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 93 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857042 completed mapping pipeline successfully