Starting /dee2/code/volunteer_pipeline.sh SRR13857043 current disk space = 3052946092032 free memory = 1577327500 SRR13857043 SRAfilesize 905ca1004c5423e031cda35dffd6886d SRR13857043.sra SRR13857043.sra file validated SRR13857043 is paired end SRR13857043 is conventional basespace SRR13857043 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857043_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.34375 32.0 32.0 32.0 2.0 32.0 2 31.51 32.0 32.0 32.0 32.0 32.0 3 35.075 37.0 32.0 37.0 32.0 37.0 4 36.1625 37.0 37.0 37.0 32.0 37.0 5 36.34 37.0 37.0 37.0 37.0 37.0 6 39.7995 41.0 41.0 41.0 37.0 41.0 7 39.74825 41.0 41.0 41.0 37.0 41.0 8 39.98475 41.0 41.0 41.0 37.0 41.0 9 39.998 41.0 41.0 41.0 37.0 41.0 10-14 40.05625 41.0 41.0 41.0 37.0 41.0 15-19 39.9539 41.0 41.0 41.0 37.0 41.0 20-24 39.8324 41.0 41.0 41.0 37.0 41.0 25-29 39.733000000000004 41.0 41.0 41.0 37.0 41.0 30-34 39.68705 41.0 41.0 41.0 37.0 41.0 35-39 39.599199999999996 41.0 41.0 41.0 37.0 41.0 40-44 39.59185 41.0 41.0 41.0 37.0 41.0 45-49 39.3527 41.0 41.0 41.0 37.0 41.0 50-54 39.478500000000004 41.0 41.0 41.0 37.0 41.0 55-59 39.32165 41.0 41.0 41.0 37.0 41.0 60-64 39.32039999999999 41.0 41.0 41.0 37.0 41.0 65-69 39.175799999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.149350000000005 41.0 41.0 41.0 37.0 41.0 75-79 38.8271 41.0 40.2 41.0 34.0 41.0 80-84 39.17425 41.0 41.0 41.0 37.0 41.0 85-89 39.14025 41.0 41.0 41.0 37.0 41.0 90-94 39.0921 41.0 41.0 41.0 37.0 41.0 95-99 39.054700000000004 41.0 41.0 41.0 35.0 41.0 100-104 38.8616 41.0 41.0 41.0 32.0 41.0 105-109 38.795 41.0 41.0 41.0 32.0 41.0 110-114 38.60785 41.0 41.0 41.0 32.0 41.0 115-119 38.57555 41.0 41.0 41.0 32.0 41.0 120-124 38.203799999999994 41.0 39.4 41.0 31.0 41.0 125-129 38.008950000000006 41.0 37.8 41.0 32.0 41.0 130-134 37.85055 41.0 37.8 41.0 29.0 41.0 135-139 37.21335 41.0 37.0 41.0 27.0 41.0 140-144 37.140299999999996 41.0 37.0 41.0 26.0 41.0 145-149 37.2118 41.0 37.0 41.0 27.0 41.0 150 37.28725 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 6.0 24 18.0 25 25.0 26 27.0 27 43.0 28 38.0 29 33.0 30 52.0 31 59.0 32 58.0 33 77.0 34 73.0 35 114.0 36 102.0 37 158.0 38 205.0 39 366.0 40 2543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.964838255977497 26.357243319268637 17.18706047819972 41.49085794655415 2 18.099999999999998 23.0 44.4 14.499999999999998 3 18.175 24.925 34.65 22.25 4 18.725 23.875 34.050000000000004 23.35 5 29.225 22.25 28.375 20.150000000000002 6 22.375 24.525 31.75 21.349999999999998 7 26.625 26.724999999999998 25.974999999999998 20.674999999999997 8 18.6 22.925 37.0 21.475 9 21.95 21.625 35.425000000000004 21.0 10-14 24.025 25.985000000000003 27.415 22.575 15-19 23.885 25.115 26.229999999999997 24.77 20-24 23.915 25.474999999999998 26.974999999999998 23.635 25-29 23.52 24.855 27.169999999999998 24.455 30-34 23.595 25.83 26.705000000000002 23.87 35-39 23.544999999999998 25.795 26.455000000000002 24.205 40-44 24.015 25.805 26.169999999999998 24.01 45-49 24.75 25.424999999999997 26.265 23.56 50-54 23.96 26.1 25.915 24.025 55-59 23.945 25.39 25.805 24.86 60-64 23.895 25.31 26.8 23.995 65-69 24.099999999999998 25.715 26.215 23.97 70-74 23.565 26.029999999999998 26.525 23.880000000000003 75-79 23.64 25.905 26.1 24.355 80-84 23.57 26.155 25.840000000000003 24.435000000000002 85-89 23.885 26.490000000000002 25.474999999999998 24.15 90-94 23.93 26.69 25.840000000000003 23.54 95-99 24.215 26.215 25.36 24.21 100-104 24.58466773418735 25.55044035228183 25.685548438751 24.179343474779824 105-109 23.82 26.295 26.05 23.835 110-114 23.145415436946625 25.851633234955727 27.012155469961485 23.99079585813616 115-119 23.701185059252964 26.306315315765787 26.416320816040802 23.576178808940448 120-124 24.058682155017024 26.236731423993593 25.550771079511314 24.15381534147807 125-129 24.220587499374467 26.652654756543058 25.11634889656208 24.01040884752039 130-134 23.521465025517863 25.848093665565898 26.653657560292203 23.976783748624037 135-139 23.426310781711653 27.212178877259753 26.040362561971055 23.32114777905754 140-144 23.714742948589716 27.58551710342068 25.625125025005 23.074614922984598 145-149 24.545 28.185 24.44 22.830000000000002 150 24.8 27.425 24.224999999999998 23.549999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.5 3 5.0 4 7.0 5 8.0 6 3.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 2.5 14 2.5 15 3.0 16 3.0 17 5.0 18 5.5 19 5.0 20 6.0 21 5.0 22 3.5 23 3.5 24 6.0 25 8.0 26 13.0 27 15.5 28 16.0 29 17.5 30 22.0 31 30.0 32 33.0 33 38.0 34 44.5 35 49.0 36 55.5 37 61.0 38 66.0 39 81.5 40 90.0 41 116.5 42 139.0 43 169.0 44 215.0 45 219.0 46 188.0 47 160.5 48 169.0 49 176.0 50 158.0 51 149.5 52 155.5 53 150.0 54 133.5 55 115.5 56 113.0 57 108.0 58 89.0 59 84.5 60 84.0 61 59.5 62 43.0 63 46.0 64 40.5 65 31.0 66 26.0 67 28.0 68 24.0 69 18.0 70 17.5 71 9.0 72 4.0 73 6.5 74 5.5 75 5.0 76 6.5 77 6.0 78 5.5 79 3.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.0 110-114 0.045 115-119 0.005 120-124 0.13999999999999999 125-129 0.08499999999999999 130-134 0.06999999999999999 135-139 0.155 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.075 #Duplication Level Percentage of deduplicated Percentage of total 1 88.45822566752798 77.025 2 9.18748205569911 16.0 3 1.6652311225954637 4.35 4 0.516795865633075 1.7999999999999998 5 0.11484352569623889 0.5 6 0.028710881424059722 0.15 7 0.028710881424059722 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCAC 7 0.17500000000000002 No Hit CTTTGTGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit CTTCGGCGAAGGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCC 5 0.125 No Hit CTCGTCCCTTCTACCGGCGATGCGCTCCTGGCCTTAACTGGCCGGGTCGT 5 0.125 No Hit TGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CATAGGATTTCGATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1625 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTG 35 4.7293724E-10 145.05882 1 ATCCCGA 10 0.0069954093 143.85 6 GATCCCG 10 0.0069954093 143.85 5 CCCGAAG 10 0.0069954093 143.85 8 CCGAAGG 10 0.0069954093 143.85 9 CGATCCC 10 0.0069954093 143.85 4 TTTGTGT 30 5.275069E-10 143.84999 2 GTGTTTG 35 1.542503E-9 123.3 5 TGTGTTT 35 1.542503E-9 123.3 4 TGTTTGA 45 8.858478E-9 95.9 6 TTGTGTT 55 3.5697667E-8 78.46364 3 GTTTGAT 30 0.0018550509 71.924995 7 ATCGGAA 30 0.0015123422 23.975 140-144 TCGGAAG 35 0.0037036615 20.55 140-144 GATCGGA 75 0.0013144102 13.426 140-144 >>END_MODULE SRR13857043 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857043_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.8675 32.0 2.0 32.0 2.0 32.0 2 30.835 32.0 32.0 32.0 32.0 32.0 3 32.3775 32.0 32.0 37.0 32.0 37.0 4 33.6575 37.0 32.0 37.0 27.0 37.0 5 34.69875 37.0 37.0 37.0 27.0 37.0 6 37.5045 41.0 37.0 41.0 27.0 41.0 7 38.3735 41.0 41.0 41.0 32.0 41.0 8 38.5225 41.0 41.0 41.0 32.0 41.0 9 38.47 41.0 41.0 41.0 32.0 41.0 10-14 38.7202 41.0 41.0 41.0 34.0 41.0 15-19 38.62505 41.0 41.0 41.0 33.0 41.0 20-24 39.0032 41.0 41.0 41.0 36.0 41.0 25-29 38.87535 41.0 41.0 41.0 35.0 41.0 30-34 38.805800000000005 41.0 41.0 41.0 33.0 41.0 35-39 38.66845 41.0 41.0 41.0 32.0 41.0 40-44 38.663850000000004 41.0 41.0 41.0 32.0 41.0 45-49 38.549699999999994 41.0 41.0 41.0 32.0 41.0 50-54 38.51885 41.0 40.2 41.0 32.0 41.0 55-59 38.58785 41.0 41.0 41.0 32.0 41.0 60-64 38.5418 41.0 41.0 41.0 32.0 41.0 65-69 38.46605 41.0 41.0 41.0 32.0 41.0 70-74 38.51899999999999 41.0 41.0 41.0 32.0 41.0 75-79 37.580349999999996 40.2 37.6 41.0 29.0 41.0 80-84 38.37505 41.0 41.0 41.0 32.0 41.0 85-89 38.3925 41.0 38.6 41.0 32.0 41.0 90-94 38.28855 41.0 37.0 41.0 32.0 41.0 95-99 38.026250000000005 41.0 37.0 41.0 31.0 41.0 100-104 37.78135 41.0 37.0 41.0 30.0 41.0 105-109 37.4342 41.0 37.0 41.0 27.0 41.0 110-114 37.07715 41.0 37.0 41.0 27.0 41.0 115-119 36.6024 41.0 37.0 41.0 26.0 41.0 120-124 36.298500000000004 41.0 37.0 41.0 22.0 41.0 125-129 35.86445 41.0 34.0 41.0 22.0 41.0 130-134 35.2008 41.0 32.0 41.0 22.0 41.0 135-139 34.989 41.0 32.0 41.0 20.0 41.0 140-144 34.512950000000004 41.0 32.0 41.0 18.0 41.0 145-149 34.32735 38.6 31.0 41.0 20.0 41.0 150 33.879 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 9.0 23 27.0 24 30.0 25 49.0 26 44.0 27 69.0 28 61.0 29 69.0 30 73.0 31 91.0 32 97.0 33 135.0 34 133.0 35 140.0 36 194.0 37 247.0 38 352.0 39 707.0 40 1473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.37049597286986 26.45188639253921 19.37261551504875 39.80500211954217 2 17.375 23.549999999999997 44.3 14.774999999999999 3 18.8 25.2 33.925 22.075 4 19.2 21.875 36.375 22.55 5 29.025000000000002 23.625 28.749999999999996 18.6 6 20.549999999999997 25.15 34.050000000000004 20.25 7 26.275 25.074999999999996 29.425 19.225 8 18.099999999999998 22.575 38.35 20.974999999999998 9 22.775000000000002 21.8 34.300000000000004 21.125 10-14 23.788568285242786 26.418962844426662 27.29409411411712 22.498374756213433 15-19 24.215 25.06 26.605 24.12 20-24 23.43351502725409 25.428814322148323 27.744161624243635 23.393509026353954 25-29 23.674999999999997 25.814999999999998 27.175 23.335 30-34 23.625 25.624999999999996 26.8 23.95 35-39 23.793569035355304 26.278941841276193 26.148922338350754 23.778566785017752 40-44 24.196209810490522 26.14130706535327 26.271313565678284 23.391169558477923 45-49 23.758563784567684 25.403810571585737 27.074061109166376 23.7635645346802 50-54 24.47 25.915 25.955000000000002 23.66 55-59 23.9 25.040000000000003 26.790000000000003 24.27 60-64 24.075 24.315 27.345000000000002 24.265 65-69 24.215 25.814999999999998 26.875 23.095 70-74 23.49 24.945 27.584999999999997 23.98 75-79 22.93 24.93 28.005000000000003 24.135 80-84 24.22 25.365 26.584999999999997 23.830000000000002 85-89 23.645 26.529999999999998 26.179999999999996 23.645 90-94 23.955000000000002 25.81 26.279999999999998 23.955000000000002 95-99 24.645 25.495 26.1 23.76 100-104 24.55 26.025 26.06 23.365 105-109 23.335 25.195 27.200000000000003 24.27 110-114 23.305 25.155 27.860000000000003 23.68 115-119 23.595 25.95 26.87 23.585 120-124 23.71 26.27 26.224999999999998 23.794999999999998 125-129 24.57 24.975 26.740000000000002 23.715 130-134 23.59 25.21 27.060000000000002 24.14 135-139 23.244999999999997 26.86 26.525 23.369999999999997 140-144 24.310000000000002 26.724999999999998 26.33 22.634999999999998 145-149 24.625 27.034999999999997 25.509999999999998 22.830000000000002 150 25.5 26.0 24.875 23.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.5 2 2.0 3 4.5 4 7.0 5 5.0 6 3.5 7 3.0 8 1.5 9 1.5 10 2.0 11 3.5 12 4.0 13 2.5 14 2.0 15 3.5 16 5.0 17 4.5 18 4.0 19 5.5 20 7.0 21 8.5 22 8.0 23 6.5 24 6.0 25 8.0 26 11.0 27 11.0 28 13.5 29 17.5 30 21.0 31 29.0 32 34.0 33 37.5 34 38.5 35 45.5 36 67.0 37 73.5 38 81.0 39 94.5 40 119.5 41 136.0 42 141.5 43 163.0 44 193.0 45 206.5 46 178.5 47 164.0 48 165.0 49 170.5 50 176.0 51 171.0 52 155.5 53 136.0 54 126.0 55 110.5 56 96.0 57 94.0 58 98.0 59 94.0 60 75.5 61 50.5 62 41.0 63 40.5 64 30.0 65 23.0 66 24.5 67 25.0 68 25.0 69 21.5 70 14.5 71 11.5 72 11.0 73 8.0 74 3.0 75 3.0 76 5.0 77 2.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 41.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.005 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1960569550931 84.175 2 6.4895947426067915 11.85 3 1.067907995618839 2.9250000000000003 4 0.13691128148959475 0.5 5 0.054764512595837894 0.25 6 0.054764512595837894 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 6 0.15 No Hit CTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATC 6 0.15 No Hit NTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit CTACTATCCAGCGAAACCACAGCCAAGGGAACGGGCTTGGCGGAATCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1625 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTGT 30 0.0018672548 71.80625 2 TTTGTGT 55 2.9849051E-4 52.222725 2 CTTTGTG 45 0.0093042515 47.870834 3 TTGTGTT 60 4.586834E-4 47.870834 3 TGTGTTT 65 6.8071205E-4 44.18846 4 GTGTTTG 70 9.806791E-4 41.032143 5 TGTTTGA 80 0.0018913304 35.903126 6 ATCGGAA 25 5.2658666E-4 28.7225 140-144 GATCGGA 35 1.2774156E-4 24.619286 140-144 TCGGAAG 30 0.0015269675 23.935415 140-144 CGGAAGA 30 0.0015269675 23.935415 140-144 >>END_MODULE Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370863 spots for SRR13857043.sra Written 1370863 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra Read 1370862 spots for SRR13857043.sra Written 1370862 spots for SRR13857043.sra SRR ids: ['SRR13857043.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qsluja2d SRR13857043.sra spots: 27417241 blocks: [[1, 1370862], [1370863, 2741724], [2741725, 4112586], [4112587, 5483448], [5483449, 6854310], [6854311, 8225172], [8225173, 9596034], [9596035, 10966896], [10966897, 12337758], [12337759, 13708620], [13708621, 15079482], [15079483, 16450344], [16450345, 17821206], [17821207, 19192068], [19192069, 20562930], [20562931, 21933792], [21933793, 23304654], [23304655, 24675516], [24675517, 26046378], [26046379, 27417241]] SRR13857043 file size 9242328 SRR13857043 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857043 SRR13857043_1.fastq SRR13857043_2.fastq Input file: SRR13857043_1.fastq Paired file: SRR13857043_2.fastq trimmed: SRR13857043-trimmed-pair1.fastq, SRR13857043-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:20:41 2025 >> started Tue Feb 11 21:21:09 2025 >> done (28.032s) 27417241 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 29 ( 0.00%) empty read pairs filtered out after trimming by size control 27417189 (100.00%) read pairs available; of these: 3307838 (12.06%) trimmed read pairs available after processing 24109351 (87.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 8 0.00% 21 8 0.00% 22 12 0.00% 23 12 0.00% 24 9 0.00% 25 18 0.00% 26 22 0.00% 27 13 0.00% 28 13 0.00% 29 14 0.00% 30 14 0.00% 31 29 0.00% 32 18 0.00% 33 25 0.00% 34 18 0.00% 35 22 0.00% 36 34 0.00% 37 25 0.00% 38 28 0.00% 39 24 0.00% 40 19 0.00% 41 33 0.00% 42 22 0.00% 43 24 0.00% 44 43 0.00% 45 30 0.00% 46 27 0.00% 47 51 0.00% 48 34 0.00% 49 55 0.00% 50 51 0.00% 51 61 0.00% 52 46 0.00% 53 56 0.00% 54 43 0.00% 55 58 0.00% 56 66 0.00% 57 80 0.00% 58 59 0.00% 59 136 0.00% 60 35 0.00% 61 96 0.00% 62 80 0.00% 63 136 0.00% 64 73 0.00% 65 116 0.00% 66 88 0.00% 67 181 0.00% 68 151 0.00% 69 130 0.00% 70 166 0.00% 71 91 0.00% 72 325 0.00% 73 102 0.00% 74 99 0.00% 75 121 0.00% 76 73 0.00% 77 124 0.00% 78 74 0.00% 79 136 0.00% 80 77 0.00% 81 90 0.00% 82 96 0.00% 83 106 0.00% 84 80 0.00% 85 80 0.00% 86 86 0.00% 87 123 0.00% 88 93 0.00% 89 102 0.00% 90 88 0.00% 91 144 0.00% 92 93 0.00% 93 80 0.00% 94 51 0.00% 95 70 0.00% 96 121 0.00% 97 66 0.00% 98 99 0.00% 99 68 0.00% 100 69 0.00% 101 86 0.00% 102 72 0.00% 103 74 0.00% 104 79 0.00% 105 73 0.00% 106 73 0.00% 107 89 0.00% 108 79 0.00% 109 75 0.00% 110 65 0.00% 111 113 0.00% 112 71 0.00% 113 93 0.00% 114 96 0.00% 115 90 0.00% 116 93 0.00% 117 97 0.00% 118 118 0.00% 119 130 0.00% 120 147 0.00% 121 160 0.00% 122 170 0.00% 123 175 0.00% 124 178 0.00% 125 220 0.00% 126 211 0.00% 127 215 0.00% 128 217 0.00% 129 254 0.00% 130 186 0.00% 131 218 0.00% 132 244 0.00% 133 990 0.00% 134 121897 0.44% 135 131122 0.48% 136 135587 0.49% 137 140109 0.51% 138 144590 0.53% 139 149760 0.55% 140 151780 0.55% 141 157651 0.58% 142 161763 0.59% 143 165061 0.60% 144 169111 0.62% 145 175922 0.64% 146 177651 0.65% 147 191057 0.70% 148 231543 0.84% 149 892328 3.25% 150 24109351 87.94% 27417189 reads passed initial QC criterion=sequence-density sequence-density=3.40 sequence-density-rank=1 fanout-score=1.03 fanout-score-rank=43 prefix-density=1.65 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=1.01 sequence-density-rank=6 fanout-score=61.60 fanout-score-rank=1 prefix-density=2.14 prefix-fanout=29.0 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=4.97 sequence-density-rank=1 fanout-score=1.59 fanout-score-rank=46 prefix-density=5.42 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=42 fanout-score=45.61 fanout-score-rank=1 prefix-density=5.46 prefix-fanout=1.2 sequence=GTGTTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCGGTAGAAGG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857043 SRR13857043_1.fastq SRR13857043_2.fastq Input file: SRR13857043_1.fastq Paired file: SRR13857043_2.fastq trimmed: SRR13857043-trimmed-pair1.fastq, SRR13857043-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:23:47 2025 >> started Tue Feb 11 21:24:03 2025 >> done (15.745s) 16450314 read pairs processed; of these: 137401 ( 0.84%) short read pairs filtered out after trimming by size control 112896 ( 0.69%) empty read pairs filtered out after trimming by size control 16200017 (98.48%) read pairs available; of these: 9420 ( 0.06%) trimmed read pairs available after processing 16190597 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 9 0.00% 23 8 0.00% 24 4 0.00% 25 10 0.00% 26 10 0.00% 27 10 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 20 0.00% 32 12 0.00% 33 14 0.00% 34 9 0.00% 35 15 0.00% 36 20 0.00% 37 13 0.00% 38 18 0.00% 39 18 0.00% 40 13 0.00% 41 16 0.00% 42 11 0.00% 43 13 0.00% 44 26 0.00% 45 19 0.00% 46 13 0.00% 47 31 0.00% 48 24 0.00% 49 41 0.00% 50 25 0.00% 51 38 0.00% 52 28 0.00% 53 29 0.00% 54 24 0.00% 55 30 0.00% 56 37 0.00% 57 49 0.00% 58 39 0.00% 59 78 0.00% 60 21 0.00% 61 63 0.00% 62 46 0.00% 63 84 0.00% 64 48 0.00% 65 73 0.00% 66 56 0.00% 67 108 0.00% 68 89 0.00% 69 65 0.00% 70 96 0.00% 71 52 0.00% 72 194 0.00% 73 61 0.00% 74 63 0.00% 75 80 0.00% 76 42 0.00% 77 70 0.00% 78 46 0.00% 79 79 0.00% 80 45 0.00% 81 57 0.00% 82 53 0.00% 83 70 0.00% 84 41 0.00% 85 44 0.00% 86 49 0.00% 87 80 0.00% 88 51 0.00% 89 64 0.00% 90 51 0.00% 91 85 0.00% 92 60 0.00% 93 44 0.00% 94 31 0.00% 95 50 0.00% 96 77 0.00% 97 37 0.00% 98 62 0.00% 99 37 0.00% 100 47 0.00% 101 48 0.00% 102 38 0.00% 103 45 0.00% 104 54 0.00% 105 38 0.00% 106 42 0.00% 107 57 0.00% 108 49 0.00% 109 46 0.00% 110 40 0.00% 111 56 0.00% 112 45 0.00% 113 57 0.00% 114 55 0.00% 115 57 0.00% 116 58 0.00% 117 57 0.00% 118 70 0.00% 119 72 0.00% 120 81 0.00% 121 86 0.00% 122 99 0.00% 123 108 0.00% 124 115 0.00% 125 123 0.00% 126 126 0.00% 127 125 0.00% 128 137 0.00% 129 144 0.00% 130 117 0.00% 131 119 0.00% 132 152 0.00% 133 606 0.00% 134 72109 0.45% 135 77505 0.48% 136 80684 0.50% 137 83074 0.51% 138 85935 0.53% 139 88397 0.55% 140 90131 0.56% 141 94010 0.58% 142 96113 0.59% 143 97579 0.60% 144 100028 0.62% 145 104399 0.64% 146 108700 0.67% 147 116212 0.72% 148 138916 0.86% 149 519364 3.21% 150 14240357 87.90% criterion=sequence-density sequence-density=2.76 sequence-density-rank=1 fanout-score=1.04 fanout-score-rank=43 prefix-density=1.67 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.90 sequence-density-rank=6 fanout-score=64.71 fanout-score-rank=1 prefix-density=1.93 prefix-fanout=30.3 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=4.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=44 prefix-density=5.51 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=41 fanout-score=45.38 fanout-score-rank=1 prefix-density=4.63 prefix-fanout=1.2 sequence=GTGTTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCGGTAGAAGG SRR13857043 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:46:40 Started mapping on | Feb 11 21:46:40 Finished on | Feb 11 21:55:45 Mapping speed, Million of reads per hour | 179.45 Number of input reads | 27166563 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 7591885 Uniquely mapped reads % | 27.95% Average mapped length | 269.04 Number of splices: Total | 3208338 Number of splices: Annotated (sjdb) | 3066925 Number of splices: GT/AG | 3101588 Number of splices: GC/AG | 46561 Number of splices: AT/AC | 5881 Number of splices: Non-canonical | 54308 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 647694 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 13108002 % of reads mapped to too many loci | 48.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.55% % of reads unmapped: other | 8.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 18926992 18926992 18926992 N_multimapping 647694 647694 647694 N_noFeature 2599353 5183028 4920536 N_ambiguous 161441 35693 38376 UnstrandedReadsAssigned:4831091 PositiveStrandReadsAssigned:2373164 NegativeStrandReadsAssigned:2632973 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857043 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857043-trimmed-pair1.fastq SRR13857043-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,166,563 reads, 21,301,880 reads pseudoaligned [quant] estimated average fragment length: 180.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR13857043.ke.tsv 34699 SRR13857043.se.tsv 87100 total ==> SRR13857043.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.34 172 3.07762 Potri.005G024800.1.v4.1 1035 855.336 80 3.07656 Potri.004G059700.1.v4.1 961 781.336 159 6.69377 Potri.007G009000.2.v4.1 1416 1236.34 0 0 Potri.003G141000.2.v4.1 2943 2763.34 137.557 1.63742 Potri.016G087400.1.v4.1 270 101.348 306 99.316 Potri.015G069301.1.v4.1 564 384.421 0 0 Potri.010G195200.1.v4.1 1773 1593.34 0 0 Potri.012G127500.1.v4.1 977 797.336 9 0.371289 ==> SRR13857043.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 260 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 81 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 74 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857043 completed mapping pipeline successfully