Starting /dee2/code/volunteer_pipeline.sh SRR13857044 current disk space = 3052983287808 free memory = 1508203072 SRR13857044 SRAfilesize 7eff6813c38edff07816b3d861453fb7 SRR13857044.sra SRR13857044.sra file validated SRR13857044 is paired end SRR13857044 is conventional basespace SRR13857044 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857044_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.45125 32.0 32.0 32.0 2.0 32.0 2 31.5325 32.0 32.0 32.0 32.0 32.0 3 35.1275 37.0 32.0 37.0 32.0 37.0 4 36.03875 37.0 37.0 37.0 32.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 39.84925 41.0 41.0 41.0 37.0 41.0 7 40.05325 41.0 41.0 41.0 37.0 41.0 8 39.9495 41.0 41.0 41.0 37.0 41.0 9 39.998 41.0 41.0 41.0 37.0 41.0 10-14 40.091300000000004 41.0 41.0 41.0 37.0 41.0 15-19 40.029849999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.9812 41.0 41.0 41.0 37.0 41.0 25-29 39.85845 41.0 41.0 41.0 37.0 41.0 30-34 39.7146 41.0 41.0 41.0 37.0 41.0 35-39 39.728449999999995 41.0 41.0 41.0 37.0 41.0 40-44 39.608200000000004 41.0 41.0 41.0 37.0 41.0 45-49 39.51515 41.0 41.0 41.0 37.0 41.0 50-54 39.4366 41.0 41.0 41.0 37.0 41.0 55-59 39.4266 41.0 41.0 41.0 37.0 41.0 60-64 39.436350000000004 41.0 41.0 41.0 37.0 41.0 65-69 39.36935 41.0 41.0 41.0 37.0 41.0 70-74 39.28425 41.0 41.0 41.0 37.0 41.0 75-79 38.96435 41.0 40.2 41.0 36.0 41.0 80-84 39.02935 41.0 41.0 41.0 35.0 41.0 85-89 39.01915 41.0 41.0 41.0 36.0 41.0 90-94 39.1173 41.0 41.0 41.0 37.0 41.0 95-99 38.9422 41.0 41.0 41.0 33.0 41.0 100-104 38.903749999999995 41.0 41.0 41.0 33.0 41.0 105-109 38.84815 41.0 41.0 41.0 32.0 41.0 110-114 38.7538 41.0 41.0 41.0 32.0 41.0 115-119 38.574 41.0 41.0 41.0 32.0 41.0 120-124 38.343650000000004 41.0 41.0 41.0 32.0 41.0 125-129 38.2426 41.0 40.2 41.0 32.0 41.0 130-134 37.880599999999994 41.0 37.0 41.0 30.0 41.0 135-139 37.677049999999994 41.0 37.0 41.0 29.0 41.0 140-144 37.504650000000005 41.0 37.0 41.0 27.0 41.0 145-149 37.17575 41.0 37.0 41.0 27.0 41.0 150 37.0995 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 18.0 24 19.0 25 15.0 26 36.0 27 32.0 28 34.0 29 41.0 30 42.0 31 41.0 32 51.0 33 70.0 34 87.0 35 87.0 36 129.0 37 133.0 38 222.0 39 378.0 40 2563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.416782826874826 26.76331195985503 18.4555338723167 39.36437134095344 2 18.125 24.175 41.6 16.1 3 17.0 27.425 33.975 21.6 4 19.400000000000002 24.975 33.675 21.95 5 28.725 23.175 27.125 20.974999999999998 6 21.65 24.775 31.7 21.875 7 26.356589147286826 27.056764191047762 27.431857964491122 19.154788697174293 8 18.675 22.675 36.775000000000006 21.875 9 21.525 22.3 35.275 20.9 10-14 23.815 26.38 27.155 22.650000000000002 15-19 23.990000000000002 25.330000000000002 27.025 23.655 20-24 23.395 25.91 26.724999999999998 23.97 25-29 23.875 25.28 26.595000000000002 24.25 30-34 24.099999999999998 25.945 26.179999999999996 23.775 35-39 23.865 26.33 26.0 23.805 40-44 23.525 26.68 25.330000000000002 24.465 45-49 24.145 26.245 25.55 24.060000000000002 50-54 23.974999999999998 25.924999999999997 26.290000000000003 23.810000000000002 55-59 23.29 26.115 26.35 24.245 60-64 23.830000000000002 25.825 26.0 24.345 65-69 24.44 26.334999999999997 25.45 23.775 70-74 23.14 26.575 25.96 24.325 75-79 23.685000000000002 25.545 26.205000000000002 24.565 80-84 24.169999999999998 26.255 25.195 24.38 85-89 23.49 27.01 25.52 23.98 90-94 23.69 27.0 25.885 23.425 95-99 24.585 25.979999999999997 25.825 23.61 100-104 24.05221566469941 26.90807242172652 25.232569770931278 23.807142142642792 105-109 23.61 25.8 26.135 24.455 110-114 23.845961490372595 26.176544136034007 26.731682920730183 23.245811452863215 115-119 23.68118405920296 26.611330566528324 25.691284564228212 24.016200810040502 120-124 24.240908408783955 26.221799809914458 25.341403631634236 24.19588814966735 125-129 23.895 26.715 25.740000000000002 23.65 130-134 23.69 26.150000000000002 26.36 23.799999999999997 135-139 23.70896717373899 27.336869495596478 25.960768614891915 22.99339471577262 140-144 23.895 27.325 25.52 23.26 145-149 23.89 28.525 24.29 23.294999999999998 150 22.475 28.925 25.05 23.549999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.5 3 2.5 4 3.5 5 1.5 6 1.0 7 1.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.5 13 2.5 14 2.5 15 2.5 16 3.5 17 4.5 18 2.5 19 2.0 20 3.5 21 4.0 22 6.5 23 6.5 24 6.5 25 7.5 26 11.0 27 14.0 28 14.5 29 14.0 30 15.5 31 23.5 32 26.0 33 30.5 34 44.5 35 57.5 36 56.5 37 55.5 38 69.5 39 84.5 40 110.0 41 142.5 42 144.0 43 164.0 44 212.0 45 224.0 46 213.0 47 186.5 48 179.0 49 208.0 50 190.5 51 156.5 52 142.5 53 135.0 54 128.0 55 111.5 56 101.5 57 103.0 58 94.5 59 72.5 60 67.5 61 50.0 62 40.5 63 41.5 64 32.5 65 23.0 66 17.0 67 26.0 68 26.5 69 15.0 70 10.5 71 12.0 72 9.0 73 4.5 74 2.5 75 2.0 76 4.5 77 4.0 78 2.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.025 115-119 0.005 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.08 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.275 #Duplication Level Percentage of deduplicated Percentage of total 1 86.89533861037819 74.1 2 10.260920551158017 17.5 3 1.9935502785107009 5.1 4 0.5863383172090296 2.0 5 0.1465845793022574 0.625 6 0.02931691586045148 0.15 7 0.08795074758135445 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAG 7 0.17500000000000002 No Hit ATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGT 7 0.17500000000000002 No Hit CGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAA 7 0.17500000000000002 No Hit CCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAA 6 0.15 No Hit CTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCG 5 0.125 No Hit CAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATAC 5 0.125 No Hit CCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTC 5 0.125 No Hit CTCGTAGTTGGACTTTGGGTTGGGTCGGCCGGTCCGCCTCAGGTGTGCAC 5 0.125 No Hit CGAAGCTCCCACTTATCCTACACCTCTCAAGTCATTTCACAAAGTCGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1875 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTCC 10 0.0069808904 143.95 5 TTGAGGT 10 0.0069808904 143.95 9 TTGACGT 10 0.0069808904 143.95 9 TTTGTGT 30 1.4637406E-5 95.96667 2 CTTTGTG 35 2.4230783E-5 86.586464 1 GTGTTTG 40 6.1016373E-5 71.975 3 TGTGTTT 40 6.1016373E-5 71.975 2 TGTTTGA 50 1.841984E-4 57.58 4 TTGTGTT 50 1.841984E-4 57.58 3 >>END_MODULE SRR13857044 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857044_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.92 27.0 2.0 32.0 2.0 32.0 2 31.1275 32.0 32.0 32.0 32.0 32.0 3 31.9675 32.0 32.0 37.0 22.0 37.0 4 33.2975 37.0 32.0 37.0 27.0 37.0 5 34.445 37.0 37.0 37.0 27.0 37.0 6 36.94675 41.0 37.0 41.0 27.0 41.0 7 37.6545 41.0 37.0 41.0 27.0 41.0 8 37.87175 41.0 37.0 41.0 32.0 41.0 9 38.2485 41.0 37.0 41.0 32.0 41.0 10-14 38.712450000000004 41.0 41.0 41.0 34.0 41.0 15-19 38.786150000000006 41.0 41.0 41.0 35.0 41.0 20-24 38.7533 41.0 41.0 41.0 33.0 41.0 25-29 38.66835 41.0 41.0 41.0 32.0 41.0 30-34 38.78445 41.0 41.0 41.0 34.0 41.0 35-39 38.77655 41.0 41.0 41.0 33.0 41.0 40-44 38.675149999999995 41.0 41.0 41.0 33.0 41.0 45-49 38.5104 41.0 41.0 41.0 32.0 41.0 50-54 38.44415 41.0 41.0 41.0 32.0 41.0 55-59 38.51370000000001 41.0 41.0 41.0 32.0 41.0 60-64 38.34085 41.0 39.4 41.0 32.0 41.0 65-69 38.60415 41.0 41.0 41.0 32.0 41.0 70-74 38.4485 41.0 41.0 41.0 32.0 41.0 75-79 37.6447 40.2 37.6 41.0 30.0 41.0 80-84 38.4255 41.0 40.2 41.0 32.0 41.0 85-89 38.3383 41.0 40.2 41.0 32.0 41.0 90-94 38.15475 41.0 37.0 41.0 32.0 41.0 95-99 37.9176 41.0 37.0 41.0 29.0 41.0 100-104 37.64095 41.0 37.0 41.0 28.0 41.0 105-109 37.530950000000004 41.0 37.0 41.0 27.0 41.0 110-114 37.2131 41.0 37.0 41.0 27.0 41.0 115-119 36.74945 41.0 37.0 41.0 26.0 41.0 120-124 36.4409 41.0 35.0 41.0 24.0 41.0 125-129 36.11795 41.0 36.0 41.0 22.0 41.0 130-134 35.60994999999999 41.0 32.0 41.0 22.0 41.0 135-139 35.3224 41.0 32.0 41.0 22.0 41.0 140-144 34.6549 40.2 32.0 41.0 20.0 41.0 145-149 34.291599999999995 40.2 31.0 41.0 14.0 41.0 150 33.61225 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 23.0 24 42.0 25 41.0 26 54.0 27 58.0 28 76.0 29 82.0 30 78.0 31 100.0 32 90.0 33 115.0 34 122.0 35 140.0 36 195.0 37 216.0 38 352.0 39 685.0 40 1526.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.653923541247487 27.927565392354126 19.27565392354125 37.142857142857146 2 17.299999999999997 24.0 43.725 14.975 3 16.650000000000002 25.724999999999998 35.15 22.475 4 19.650000000000002 21.95 34.65 23.75 5 28.95 22.55 27.700000000000003 20.8 6 20.325 25.374999999999996 33.975 20.325 7 25.074999999999996 26.400000000000002 28.825 19.7 8 18.5 22.7 37.95 20.849999999999998 9 21.975 22.175 34.599999999999994 21.25 10-14 24.065 26.640000000000004 27.029999999999998 22.264999999999997 15-19 23.625 25.135 27.139999999999997 24.099999999999998 20-24 23.195 25.39 27.650000000000002 23.765 25-29 23.200000000000003 25.44 27.41 23.95 30-34 23.87 24.985 27.505000000000003 23.64 35-39 24.275 25.83 26.064999999999998 23.830000000000002 40-44 23.974999999999998 25.169999999999998 27.439999999999998 23.415 45-49 24.555 25.314999999999998 26.169999999999998 23.96 50-54 23.635 25.564999999999998 26.555 24.245 55-59 24.474999999999998 24.709999999999997 27.025 23.79 60-64 23.455000000000002 25.345000000000002 27.245 23.955000000000002 65-69 23.93 25.485000000000003 26.979999999999997 23.605 70-74 24.05 24.55 27.474999999999998 23.925 75-79 23.724999999999998 24.6 27.639999999999997 24.035 80-84 24.345 25.34 26.32 23.995 85-89 24.14 25.795 26.465 23.599999999999998 90-94 23.615 25.685000000000002 27.07 23.630000000000003 95-99 23.715 25.650000000000002 26.69 23.945 100-104 24.154999999999998 25.695 26.340000000000003 23.810000000000002 105-109 23.995 25.259999999999998 27.034999999999997 23.71 110-114 23.745 25.195 27.93 23.13 115-119 24.34 24.884999999999998 27.615000000000002 23.16 120-124 24.085 25.275 26.295 24.345 125-129 23.985 25.28 27.060000000000002 23.674999999999997 130-134 23.805 24.535 27.935 23.724999999999998 135-139 24.005000000000003 25.905 26.75 23.34 140-144 24.59 26.215 26.055 23.14 145-149 24.97 26.36 25.955000000000002 22.715 150 25.05 25.424999999999997 26.325 23.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 2.0 3 2.0 4 2.5 5 2.0 6 1.5 7 1.5 8 0.5 9 0.5 10 0.5 11 3.0 12 6.0 13 4.5 14 1.5 15 3.5 16 6.0 17 3.5 18 4.0 19 5.0 20 3.5 21 4.0 22 6.0 23 3.5 24 4.5 25 8.0 26 10.0 27 10.0 28 9.5 29 14.5 30 18.5 31 18.5 32 21.5 33 31.5 34 40.5 35 46.5 36 51.5 37 55.0 38 78.5 39 104.5 40 121.0 41 151.0 42 155.0 43 177.0 44 225.0 45 238.5 46 207.5 47 163.0 48 162.5 49 197.5 50 183.5 51 155.0 52 166.0 53 159.5 54 138.0 55 118.0 56 104.5 57 100.5 58 83.0 59 58.0 60 53.0 61 47.5 62 37.5 63 36.0 64 29.5 65 19.0 66 18.0 67 23.0 68 23.0 69 15.0 70 9.0 71 8.0 72 5.5 73 3.0 74 2.0 75 1.5 76 3.5 77 4.0 78 2.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content fail #Base N-Count 1 37.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.52869757174393 82.92500000000001 2 7.0364238410596025 12.75 3 1.076158940397351 2.9250000000000003 4 0.30353200883002207 1.0999999999999999 5 0.02759381898454746 0.125 6 0.0 0.0 7 0.02759381898454746 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 7 0.17500000000000002 No Hit CTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 1.2625 0.0 0.0 0.0 0.0 138 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGAAGG 25 9.036997E-4 86.205 9 >>END_MODULE Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239664 spots for SRR13857044.sra Written 1239664 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra Read 1239656 spots for SRR13857044.sra Written 1239656 spots for SRR13857044.sra SRR ids: ['SRR13857044.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dsd8jq5z SRR13857044.sra spots: 24793128 blocks: [[1, 1239656], [1239657, 2479312], [2479313, 3718968], [3718969, 4958624], [4958625, 6198280], [6198281, 7437936], [7437937, 8677592], [8677593, 9917248], [9917249, 11156904], [11156905, 12396560], [12396561, 13636216], [13636217, 14875872], [14875873, 16115528], [16115529, 17355184], [17355185, 18594840], [18594841, 19834496], [19834497, 21074152], [21074153, 22313808], [22313809, 23553464], [23553465, 24793128]] SRR13857044 file size 8355665 SRR13857044 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857044 SRR13857044_1.fastq SRR13857044_2.fastq Input file: SRR13857044_1.fastq Paired file: SRR13857044_2.fastq trimmed: SRR13857044-trimmed-pair1.fastq, SRR13857044-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:58:36 2025 >> started Tue Feb 11 20:59:04 2025 >> done (28.034s) 24793128 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 24 ( 0.00%) empty read pairs filtered out after trimming by size control 24793082 (100.00%) read pairs available; of these: 3078375 (12.42%) trimmed read pairs available after processing 21714707 (87.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 10 0.00% 21 11 0.00% 22 13 0.00% 23 9 0.00% 24 26 0.00% 25 13 0.00% 26 26 0.00% 27 16 0.00% 28 19 0.00% 29 31 0.00% 30 21 0.00% 31 30 0.00% 32 23 0.00% 33 25 0.00% 34 28 0.00% 35 39 0.00% 36 25 0.00% 37 27 0.00% 38 30 0.00% 39 27 0.00% 40 28 0.00% 41 45 0.00% 42 36 0.00% 43 32 0.00% 44 33 0.00% 45 46 0.00% 46 39 0.00% 47 35 0.00% 48 45 0.00% 49 50 0.00% 50 46 0.00% 51 64 0.00% 52 57 0.00% 53 60 0.00% 54 63 0.00% 55 69 0.00% 56 73 0.00% 57 62 0.00% 58 66 0.00% 59 110 0.00% 60 48 0.00% 61 93 0.00% 62 61 0.00% 63 129 0.00% 64 68 0.00% 65 120 0.00% 66 92 0.00% 67 160 0.00% 68 106 0.00% 69 113 0.00% 70 134 0.00% 71 100 0.00% 72 240 0.00% 73 85 0.00% 74 90 0.00% 75 151 0.00% 76 74 0.00% 77 108 0.00% 78 67 0.00% 79 108 0.00% 80 88 0.00% 81 92 0.00% 82 70 0.00% 83 112 0.00% 84 63 0.00% 85 91 0.00% 86 86 0.00% 87 119 0.00% 88 111 0.00% 89 99 0.00% 90 91 0.00% 91 150 0.00% 92 85 0.00% 93 96 0.00% 94 40 0.00% 95 78 0.00% 96 90 0.00% 97 59 0.00% 98 78 0.00% 99 103 0.00% 100 62 0.00% 101 101 0.00% 102 83 0.00% 103 57 0.00% 104 72 0.00% 105 80 0.00% 106 64 0.00% 107 79 0.00% 108 76 0.00% 109 76 0.00% 110 88 0.00% 111 117 0.00% 112 100 0.00% 113 100 0.00% 114 96 0.00% 115 100 0.00% 116 101 0.00% 117 87 0.00% 118 109 0.00% 119 144 0.00% 120 130 0.00% 121 180 0.00% 122 180 0.00% 123 178 0.00% 124 211 0.00% 125 244 0.00% 126 242 0.00% 127 242 0.00% 128 248 0.00% 129 269 0.00% 130 225 0.00% 131 264 0.00% 132 208 0.00% 133 955 0.00% 134 119423 0.48% 135 126765 0.51% 136 130050 0.52% 137 133115 0.54% 138 138635 0.56% 139 141638 0.57% 140 145108 0.59% 141 149792 0.60% 142 155285 0.63% 143 157622 0.64% 144 160730 0.65% 145 165861 0.67% 146 169367 0.68% 147 179273 0.72% 148 215631 0.87% 149 779047 3.14% 150 21714707 87.58% 24793082 reads passed initial QC criterion=sequence-density sequence-density=3.17 sequence-density-rank=1 fanout-score=1.12 fanout-score-rank=39 prefix-density=0.78 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=96.34 fanout-score-rank=1 prefix-density=2.82 prefix-fanout=1.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=5.44 sequence-density-rank=1 fanout-score=1.48 fanout-score-rank=44 prefix-density=5.42 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=42 fanout-score=69.28 fanout-score-rank=1 prefix-density=2.78 prefix-fanout=1.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857044 SRR13857044_1.fastq SRR13857044_2.fastq Input file: SRR13857044_1.fastq Paired file: SRR13857044_2.fastq trimmed: SRR13857044-trimmed-pair1.fastq, SRR13857044-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:01:20 2025 >> started Tue Feb 11 21:01:33 2025 >> done (13.340s) 14875849 read pairs processed; of these: 136246 ( 0.92%) short read pairs filtered out after trimming by size control 65614 ( 0.44%) empty read pairs filtered out after trimming by size control 14673989 (98.64%) read pairs available; of these: 4893 ( 0.03%) trimmed read pairs available after processing 14669096 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 8 0.00% 23 6 0.00% 24 16 0.00% 25 4 0.00% 26 15 0.00% 27 9 0.00% 28 11 0.00% 29 20 0.00% 30 11 0.00% 31 16 0.00% 32 12 0.00% 33 10 0.00% 34 20 0.00% 35 23 0.00% 36 16 0.00% 37 15 0.00% 38 12 0.00% 39 19 0.00% 40 17 0.00% 41 29 0.00% 42 23 0.00% 43 21 0.00% 44 18 0.00% 45 28 0.00% 46 26 0.00% 47 21 0.00% 48 26 0.00% 49 32 0.00% 50 24 0.00% 51 41 0.00% 52 37 0.00% 53 39 0.00% 54 39 0.00% 55 44 0.00% 56 40 0.00% 57 36 0.00% 58 46 0.00% 59 71 0.00% 60 36 0.00% 61 58 0.00% 62 31 0.00% 63 79 0.00% 64 32 0.00% 65 71 0.00% 66 59 0.00% 67 105 0.00% 68 54 0.00% 69 71 0.00% 70 75 0.00% 71 65 0.00% 72 163 0.00% 73 51 0.00% 74 54 0.00% 75 91 0.00% 76 52 0.00% 77 66 0.00% 78 41 0.00% 79 60 0.00% 80 54 0.00% 81 57 0.00% 82 39 0.00% 83 71 0.00% 84 35 0.00% 85 56 0.00% 86 47 0.00% 87 72 0.00% 88 74 0.00% 89 61 0.00% 90 61 0.00% 91 82 0.00% 92 54 0.00% 93 58 0.00% 94 24 0.00% 95 52 0.00% 96 57 0.00% 97 35 0.00% 98 42 0.00% 99 66 0.00% 100 37 0.00% 101 61 0.00% 102 50 0.00% 103 37 0.00% 104 39 0.00% 105 46 0.00% 106 38 0.00% 107 54 0.00% 108 44 0.00% 109 42 0.00% 110 57 0.00% 111 65 0.00% 112 58 0.00% 113 57 0.00% 114 55 0.00% 115 55 0.00% 116 51 0.00% 117 50 0.00% 118 70 0.00% 119 89 0.00% 120 73 0.00% 121 105 0.00% 122 109 0.00% 123 107 0.00% 124 132 0.00% 125 157 0.00% 126 156 0.00% 127 142 0.00% 128 138 0.00% 129 172 0.00% 130 137 0.00% 131 153 0.00% 132 129 0.00% 133 561 0.00% 134 70744 0.48% 135 74966 0.51% 136 77146 0.53% 137 78955 0.54% 138 82331 0.56% 139 83718 0.57% 140 86042 0.59% 141 88824 0.61% 142 91983 0.63% 143 93312 0.64% 144 95557 0.65% 145 98097 0.67% 146 102132 0.70% 147 107442 0.73% 148 128953 0.88% 149 457307 3.12% 150 12849826 87.57% criterion=sequence-density sequence-density=2.67 sequence-density-rank=1 fanout-score=1.12 fanout-score-rank=39 prefix-density=0.78 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=41 fanout-score=100.24 fanout-score-rank=1 prefix-density=2.78 prefix-fanout=1.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=4.66 sequence-density-rank=1 fanout-score=1.75 fanout-score-rank=42 prefix-density=5.41 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=41 fanout-score=59.39 fanout-score-rank=1 prefix-density=2.74 prefix-fanout=1.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR13857044 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:03:01 Started mapping on | Feb 11 21:03:02 Finished on | Feb 11 21:11:40 Mapping speed, Million of reads per hour | 170.90 Number of input reads | 24591222 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 7363206 Uniquely mapped reads % | 29.94% Average mapped length | 270.32 Number of splices: Total | 3157312 Number of splices: Annotated (sjdb) | 3064144 Number of splices: GT/AG | 3083287 Number of splices: GC/AG | 44218 Number of splices: AT/AC | 4591 Number of splices: Non-canonical | 25216 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 3.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568026 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 11578527 % of reads mapped to too many loci | 47.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.69% % of reads unmapped: other | 8.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16659990 16659990 16659990 N_multimapping 568026 568026 568026 N_noFeature 2450129 4933924 4791342 N_ambiguous 149047 29757 31462 UnstrandedReadsAssigned:4764030 PositiveStrandReadsAssigned:2399525 NegativeStrandReadsAssigned:2540402 Dataset is classified unstranded MeadianReadLen=138 20thPercentileLength=138 echo kmer=133 SRR13857044 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857044-trimmed-pair1.fastq SRR13857044-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,591,222 reads, 19,299,280 reads pseudoaligned [quant] estimated average fragment length: 179.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR13857044.ke.tsv 34699 SRR13857044.se.tsv 87100 total ==> SRR13857044.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.28 198 3.99515 Potri.005G024800.1.v4.1 1035 856.284 23 0.996842 Potri.004G059700.1.v4.1 961 782.284 196 9.29839 Potri.007G009000.2.v4.1 1416 1237.28 0 0 Potri.003G141000.2.v4.1 2943 2764.28 94 1.26201 Potri.016G087400.1.v4.1 270 101.844 220 80.1682 Potri.015G069301.1.v4.1 564 385.398 0 0 Potri.010G195200.1.v4.1 1773 1594.28 0 0 Potri.012G127500.1.v4.1 977 798.284 8 0.371919 ==> SRR13857044.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 286 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 125 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 121 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857044 completed mapping pipeline successfully