Starting /dee2/code/volunteer_pipeline.sh SRR13857045 current disk space = 3052878012416 free memory = 1296789492 SRR13857045 SRAfilesize 01d2e810cd2fd9f42d0bc9f72e4540f0 SRR13857045.sra SRR13857045.sra file validated SRR13857045 is paired end SRR13857045 is conventional basespace SRR13857045 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857045_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3675 32.0 32.0 32.0 2.0 32.0 2 31.45625 32.0 32.0 32.0 32.0 32.0 3 35.12125 37.0 32.0 37.0 32.0 37.0 4 36.015 37.0 37.0 37.0 32.0 37.0 5 36.37375 37.0 37.0 37.0 37.0 37.0 6 39.882 41.0 41.0 41.0 37.0 41.0 7 40.029 41.0 41.0 41.0 37.0 41.0 8 39.982 41.0 41.0 41.0 37.0 41.0 9 40.10425 41.0 41.0 41.0 37.0 41.0 10-14 40.0517 41.0 41.0 41.0 37.0 41.0 15-19 40.104150000000004 41.0 41.0 41.0 37.0 41.0 20-24 40.07190000000001 41.0 41.0 41.0 37.0 41.0 25-29 39.9507 41.0 41.0 41.0 37.0 41.0 30-34 39.8685 41.0 41.0 41.0 37.0 41.0 35-39 39.9089 41.0 41.0 41.0 37.0 41.0 40-44 39.812650000000005 41.0 41.0 41.0 37.0 41.0 45-49 39.64855 41.0 41.0 41.0 37.0 41.0 50-54 39.65975 41.0 41.0 41.0 37.0 41.0 55-59 39.6074 41.0 41.0 41.0 37.0 41.0 60-64 39.4437 41.0 41.0 41.0 37.0 41.0 65-69 39.424099999999996 41.0 41.0 41.0 37.0 41.0 70-74 39.392399999999995 41.0 41.0 41.0 37.0 41.0 75-79 39.192750000000004 41.0 41.0 41.0 36.0 41.0 80-84 39.170449999999995 41.0 41.0 41.0 36.0 41.0 85-89 39.02605 41.0 41.0 41.0 34.0 41.0 90-94 39.259249999999994 41.0 41.0 41.0 37.0 41.0 95-99 39.078199999999995 41.0 41.0 41.0 36.0 41.0 100-104 39.05125 41.0 41.0 41.0 36.0 41.0 105-109 38.9287 41.0 41.0 41.0 33.0 41.0 110-114 38.88465 41.0 41.0 41.0 33.0 41.0 115-119 38.69745 41.0 41.0 41.0 32.0 41.0 120-124 38.4427 41.0 41.0 41.0 32.0 41.0 125-129 38.3129 41.0 40.2 41.0 32.0 41.0 130-134 38.035900000000005 41.0 37.8 41.0 32.0 41.0 135-139 37.9377 41.0 37.8 41.0 32.0 41.0 140-144 37.714099999999995 41.0 37.0 41.0 28.0 41.0 145-149 37.456900000000005 41.0 37.0 41.0 27.0 41.0 150 37.5405 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 7.0 24 14.0 25 18.0 26 27.0 27 26.0 28 28.0 29 33.0 30 34.0 31 60.0 32 51.0 33 52.0 34 82.0 35 104.0 36 123.0 37 142.0 38 206.0 39 419.0 40 2572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.833705357142858 24.079241071428573 23.660714285714285 33.426339285714285 2 17.325 22.2 48.225 12.25 3 24.224999999999998 21.15 32.525 22.1 4 19.8 19.575 43.05 17.575 5 29.4 17.724999999999998 36.75 16.125 6 20.175 19.900000000000002 42.475 17.45 7 31.424999999999997 21.45 31.424999999999997 15.7 8 17.025000000000002 22.475 42.4 18.099999999999998 9 27.750000000000004 19.175 34.075 19.0 10-14 26.02 24.745 27.415 21.82 15-19 26.235000000000003 24.14 25.814999999999998 23.810000000000002 20-24 24.09 25.245 26.740000000000002 23.925 25-29 24.01 25.124999999999996 27.615000000000002 23.25 30-34 24.165 25.805 25.95 24.08 35-39 24.98 25.45 25.85 23.72 40-44 24.525 26.174999999999997 25.535000000000004 23.765 45-49 24.54 25.285000000000004 26.525 23.65 50-54 24.185000000000002 25.790000000000003 25.509999999999998 24.515 55-59 23.45 24.8 26.565 25.185000000000002 60-64 23.7 24.4 27.05 24.85 65-69 24.415 25.805 26.384999999999998 23.395 70-74 23.580000000000002 24.895 27.800000000000004 23.724999999999998 75-79 23.43 24.740000000000002 27.265 24.565 80-84 24.224999999999998 26.13 25.569999999999997 24.075 85-89 24.22 26.965 25.435000000000002 23.380000000000003 90-94 23.82 27.389999999999997 25.35 23.44 95-99 24.67 26.085 25.069999999999997 24.175 100-104 24.352305691707514 25.252575772731824 26.16785035510653 24.227268180454136 105-109 23.7 25.424999999999997 26.634999999999998 24.240000000000002 110-114 23.123468520278042 26.023903585537834 27.65414812221833 23.198479771965793 115-119 24.005000000000003 25.335 26.479999999999997 24.18 120-124 24.337168584292147 26.428214107053527 24.907453726863434 24.327163581790895 125-129 23.695 26.525 26.22 23.56 130-134 23.46 26.284999999999997 26.674999999999997 23.580000000000002 135-139 23.380197128133286 26.927502876869962 26.00190123580327 23.690398759193478 140-144 24.91 27.245 24.48 23.365 145-149 24.48 27.29 24.05 24.18 150 25.525 26.924999999999997 23.95 23.599999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 2.0 3 9.5 4 15.0 5 8.5 6 1.5 7 1.5 8 3.0 9 1.5 10 0.5 11 1.0 12 0.5 13 0.5 14 3.0 15 2.5 16 2.0 17 4.0 18 3.5 19 3.0 20 2.5 21 4.5 22 5.0 23 4.0 24 6.5 25 7.0 26 8.0 27 10.5 28 10.0 29 12.0 30 14.5 31 18.5 32 24.5 33 29.0 34 38.0 35 52.5 36 54.0 37 57.0 38 69.5 39 77.5 40 97.0 41 127.5 42 159.5 43 189.5 44 222.0 45 241.0 46 210.5 47 179.5 48 173.5 49 152.0 50 155.0 51 166.0 52 147.5 53 136.0 54 110.5 55 98.5 56 105.0 57 96.5 58 88.5 59 87.0 60 79.5 61 54.0 62 38.0 63 39.5 64 38.5 65 37.0 66 34.0 67 34.0 68 29.5 69 22.0 70 19.5 71 13.0 72 11.5 73 11.5 74 8.0 75 3.0 76 3.5 77 4.5 78 5.5 79 3.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.015 115-119 0.0 120-124 0.05 125-129 0.0 130-134 0.0 135-139 0.065 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.575 #Duplication Level Percentage of deduplicated Percentage of total 1 88.83813873822439 77.8 2 9.220667998858122 16.150000000000002 3 1.1989723094490436 3.15 4 0.5709391949757351 2.0 5 0.05709391949757351 0.25 6 0.05709391949757351 0.3 7 0.05709391949757351 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGAT 7 0.17500000000000002 No Hit GTGTTTGAGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAAC 7 0.17500000000000002 No Hit TTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 6 0.15 No Hit AACTTTGTGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit AACTTTGTGTTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAA 5 0.125 No Hit GTGTTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2125 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTTG 30 2.7102942E-10 157.71233 1 TTGACAC 10 0.0069863307 143.91249 6 ACTTTGT 45 8.8330125E-9 95.94167 2 TTTGATT 35 0.0034127391 61.676785 4 CTTTGTG 75 3.051955E-7 57.565 3 TTTGTGT 80 4.7683716E-7 53.967186 4 GTTTGAT 45 0.009227825 47.970837 3 TTGTGTT 125 1.0314079E-5 34.538998 5 TGTGTTT 125 1.0314079E-5 34.538998 2 GTGTTTG 140 2.2424894E-5 30.838392 3 TGTTTGA 145 2.851027E-5 29.775002 4 TCGGAAG 30 0.0015085208 23.985416 140-144 ATCGGAA 30 0.0015085208 23.985416 140-144 >>END_MODULE SRR13857045 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857045_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.8125 12.0 2.0 32.0 2.0 32.0 2 30.45125 32.0 32.0 32.0 27.0 32.0 3 31.59375 32.0 32.0 37.0 22.0 37.0 4 32.86375 37.0 32.0 37.0 22.0 37.0 5 34.6 37.0 37.0 37.0 27.0 37.0 6 36.99525 41.0 37.0 41.0 27.0 41.0 7 37.29175 41.0 37.0 41.0 27.0 41.0 8 37.3635 41.0 37.0 41.0 27.0 41.0 9 37.78075 41.0 37.0 41.0 27.0 41.0 10-14 38.1888 41.0 38.6 41.0 32.0 41.0 15-19 38.241699999999994 41.0 39.4 41.0 31.0 41.0 20-24 38.40695 41.0 41.0 41.0 32.0 41.0 25-29 38.3612 41.0 38.6 41.0 32.0 41.0 30-34 38.3012 41.0 38.6 41.0 32.0 41.0 35-39 38.504599999999996 41.0 40.2 41.0 32.0 41.0 40-44 38.485400000000006 41.0 41.0 41.0 32.0 41.0 45-49 38.1844 41.0 38.6 41.0 31.0 41.0 50-54 38.181149999999995 41.0 37.8 41.0 31.0 41.0 55-59 38.1577 41.0 37.8 41.0 32.0 41.0 60-64 38.07015 41.0 37.0 41.0 31.0 41.0 65-69 38.24034999999999 41.0 37.8 41.0 32.0 41.0 70-74 38.0831 41.0 37.8 41.0 32.0 41.0 75-79 37.3214 40.2 36.0 41.0 29.0 41.0 80-84 38.17105 41.0 37.8 41.0 32.0 41.0 85-89 37.956 41.0 37.0 41.0 31.0 41.0 90-94 37.6999 41.0 37.0 41.0 30.0 41.0 95-99 37.65895 41.0 37.0 41.0 28.0 41.0 100-104 37.25885 41.0 37.0 41.0 27.0 41.0 105-109 37.1139 41.0 37.0 41.0 27.0 41.0 110-114 36.66915 41.0 37.0 41.0 26.0 41.0 115-119 36.1419 41.0 34.0 41.0 24.0 41.0 120-124 35.95605 41.0 33.0 41.0 22.0 41.0 125-129 35.5443 41.0 32.0 41.0 22.0 41.0 130-134 34.89684999999999 41.0 32.0 41.0 22.0 41.0 135-139 34.8451 41.0 32.0 41.0 22.0 41.0 140-144 34.3848 39.4 31.0 41.0 18.0 41.0 145-149 33.74464999999999 37.0 29.0 41.0 12.0 41.0 150 32.9385 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 11.0 23 42.0 24 43.0 25 48.0 26 65.0 27 66.0 28 75.0 29 86.0 30 92.0 31 102.0 32 102.0 33 129.0 34 156.0 35 154.0 36 178.0 37 235.0 38 367.0 39 729.0 40 1316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.49898580121704 24.016227180527384 25.882352941176475 31.602434077079106 2 17.549999999999997 24.3 46.85 11.3 3 24.45 21.075 32.550000000000004 21.925 4 20.275000000000002 18.224999999999998 43.05 18.45 5 30.975 18.15 34.275 16.6 6 20.225 20.1 42.325 17.349999999999998 7 29.175 21.975 32.85 16.0 8 17.0 21.65 43.6 17.75 9 29.299999999999997 18.525 33.525 18.65 10-14 25.785000000000004 24.625 27.495000000000005 22.095000000000002 15-19 25.290000000000003 23.595 26.615 24.5 20-24 23.395 24.745 28.12 23.74 25-29 23.39 25.5 27.83 23.28 30-34 24.725 25.580000000000002 26.729999999999997 22.965 35-39 24.01 25.374999999999996 26.32 24.295 40-44 24.03 26.419999999999998 25.840000000000003 23.71 45-49 24.335 24.779999999999998 26.86 24.025 50-54 24.365000000000002 25.415 26.045 24.175 55-59 24.195 24.3 27.185 24.32 60-64 23.89 24.355 27.515 24.240000000000002 65-69 23.915 24.75 27.515 23.82 70-74 23.5 24.565 27.765 24.169999999999998 75-79 23.025000000000002 24.83 27.800000000000004 24.345 80-84 24.285 26.095000000000002 26.279999999999998 23.34 85-89 23.825 27.01 25.6 23.565 90-94 23.815 26.645000000000003 27.025 22.515 95-99 24.044999999999998 25.669999999999998 26.155 24.13 100-104 24.275 24.62 27.235 23.87 105-109 23.005 24.855 27.544999999999998 24.595 110-114 23.355 25.105 28.215 23.325000000000003 115-119 24.43 24.82 26.655 24.095 120-124 23.62 25.5 25.6 25.28 125-129 24.145 25.72 26.795 23.34 130-134 23.26 24.415 28.01 24.315 135-139 23.23 26.35 26.645000000000003 23.775 140-144 24.43 26.505000000000003 25.605 23.46 145-149 24.52 26.179999999999996 25.585 23.715 150 24.6 24.85 24.6 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 2.5 3 10.0 4 15.5 5 10.0 6 3.5 7 2.0 8 3.0 9 3.5 10 1.5 11 0.0 12 1.5 13 3.5 14 3.5 15 2.5 16 3.5 17 5.5 18 5.5 19 4.5 20 4.5 21 5.5 22 6.0 23 5.0 24 6.5 25 7.0 26 6.5 27 14.0 28 15.0 29 10.0 30 15.0 31 19.5 32 19.0 33 23.0 34 34.5 35 41.5 36 41.5 37 52.0 38 73.5 39 96.0 40 115.0 41 132.5 42 152.5 43 194.5 44 237.0 45 246.0 46 217.0 47 165.0 48 144.5 49 163.0 50 160.0 51 138.5 52 147.0 53 157.5 54 138.0 55 113.5 56 104.5 57 102.5 58 97.0 59 86.0 60 67.0 61 48.0 62 42.0 63 37.5 64 31.5 65 30.5 66 28.0 67 27.0 68 26.5 69 19.5 70 14.5 71 10.5 72 5.5 73 3.0 74 2.0 75 2.5 76 3.0 77 5.5 78 5.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 38.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43173023770038 82.69999999999999 2 7.131011608623548 12.9 3 1.105583195135434 3.0 4 0.22111663902708678 0.8 5 0.027639579878385848 0.125 6 0.055279159756771695 0.3 7 0.027639579878385848 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 7 0.17500000000000002 No Hit CTTTGTGTTTGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTT 6 0.15 No Hit NTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 6 0.15 No Hit NTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.23750000000000002 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTGT 35 2.419365E-7 102.60715 2 TTGAGCC 25 9.0432476E-4 86.19 7 TTTGAGC 45 1.1049422E-4 63.84444 6 GTTTGAG 80 6.1336323E-9 62.846878 5 CTTTGTG 60 5.973392E-6 59.854168 3 TTTGTGT 60 5.973392E-6 59.854168 4 TGTGTTT 110 1.6370905E-11 58.765907 2 TTGTGTT 115 2.605666E-7 57.652176 1 GTTTGAC 40 0.005833349 53.86875 7 GTGTTTG 135 1.1823431E-10 47.883335 3 GTTTGAT 60 4.5809284E-4 47.883335 9 TGTTTGA 145 2.401066E-10 44.58103 4 GGAAGAG 35 0.003733644 20.52143 9 AGATCGG 35 0.003733644 20.52143 135-139 >>END_MODULE Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251225 spots for SRR13857045.sra Written 1251225 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra Read 1251215 spots for SRR13857045.sra Written 1251215 spots for SRR13857045.sra SRR ids: ['SRR13857045.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o3z265zz SRR13857045.sra spots: 25024310 blocks: [[1, 1251215], [1251216, 2502430], [2502431, 3753645], [3753646, 5004860], [5004861, 6256075], [6256076, 7507290], [7507291, 8758505], [8758506, 10009720], [10009721, 11260935], [11260936, 12512150], [12512151, 13763365], [13763366, 15014580], [15014581, 16265795], [16265796, 17517010], [17517011, 18768225], [18768226, 20019440], [20019441, 21270655], [21270656, 22521870], [22521871, 23773085], [23773086, 25024310]] SRR13857045 file size 8433779 SRR13857045 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857045 SRR13857045_1.fastq SRR13857045_2.fastq Input file: SRR13857045_1.fastq Paired file: SRR13857045_2.fastq trimmed: SRR13857045-trimmed-pair1.fastq, SRR13857045-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:45:34 2025 >> started Tue Feb 11 20:46:38 2025 >> done (64.250s) 25024310 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 35 ( 0.00%) empty read pairs filtered out after trimming by size control 25024271 (100.00%) read pairs available; of these: 2971989 (11.88%) trimmed read pairs available after processing 22052282 (88.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 15 0.00% 25 17 0.00% 26 7 0.00% 27 10 0.00% 28 6 0.00% 29 15 0.00% 30 12 0.00% 31 16 0.00% 32 16 0.00% 33 19 0.00% 34 10 0.00% 35 17 0.00% 36 19 0.00% 37 17 0.00% 38 26 0.00% 39 18 0.00% 40 18 0.00% 41 20 0.00% 42 17 0.00% 43 15 0.00% 44 13 0.00% 45 24 0.00% 46 17 0.00% 47 35 0.00% 48 26 0.00% 49 39 0.00% 50 22 0.00% 51 49 0.00% 52 36 0.00% 53 50 0.00% 54 36 0.00% 55 31 0.00% 56 37 0.00% 57 44 0.00% 58 27 0.00% 59 57 0.00% 60 36 0.00% 61 60 0.00% 62 69 0.00% 63 83 0.00% 64 45 0.00% 65 66 0.00% 66 64 0.00% 67 94 0.00% 68 88 0.00% 69 68 0.00% 70 73 0.00% 71 51 0.00% 72 146 0.00% 73 55 0.00% 74 53 0.00% 75 73 0.00% 76 35 0.00% 77 61 0.00% 78 51 0.00% 79 63 0.00% 80 50 0.00% 81 51 0.00% 82 56 0.00% 83 60 0.00% 84 67 0.00% 85 46 0.00% 86 64 0.00% 87 65 0.00% 88 81 0.00% 89 64 0.00% 90 61 0.00% 91 106 0.00% 92 80 0.00% 93 81 0.00% 94 59 0.00% 95 57 0.00% 96 105 0.00% 97 58 0.00% 98 98 0.00% 99 64 0.00% 100 74 0.00% 101 64 0.00% 102 60 0.00% 103 54 0.00% 104 56 0.00% 105 61 0.00% 106 55 0.00% 107 64 0.00% 108 69 0.00% 109 64 0.00% 110 80 0.00% 111 84 0.00% 112 80 0.00% 113 69 0.00% 114 71 0.00% 115 77 0.00% 116 84 0.00% 117 76 0.00% 118 92 0.00% 119 110 0.00% 120 131 0.00% 121 132 0.00% 122 140 0.00% 123 145 0.00% 124 159 0.00% 125 162 0.00% 126 164 0.00% 127 157 0.00% 128 211 0.00% 129 185 0.00% 130 186 0.00% 131 187 0.00% 132 222 0.00% 133 935 0.00% 134 104194 0.42% 135 109936 0.44% 136 113623 0.45% 137 118031 0.47% 138 120216 0.48% 139 126078 0.50% 140 125939 0.50% 141 132717 0.53% 142 133155 0.53% 143 138524 0.55% 144 140474 0.56% 145 149067 0.60% 146 146790 0.59% 147 162099 0.65% 148 199439 0.80% 149 943569 3.77% 150 22052282 88.12% 25024271 reads passed initial QC criterion=sequence-density sequence-density=5.87 sequence-density-rank=1 fanout-score=1.02 fanout-score-rank=46 prefix-density=4.03 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.70 sequence-density-rank=24 fanout-score=92.07 fanout-score-rank=1 prefix-density=2.31 prefix-fanout=27.7 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=6.73 sequence-density-rank=1 fanout-score=1.27 fanout-score-rank=46 prefix-density=6.29 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=45 fanout-score=51.38 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=2.0 sequence=CCTCTCCGGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATACGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGGATGGGGGCCGGCGATGCG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857045 SRR13857045_1.fastq SRR13857045_2.fastq Input file: SRR13857045_1.fastq Paired file: SRR13857045_2.fastq trimmed: SRR13857045-trimmed-pair1.fastq, SRR13857045-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:50:20 2025 >> started Tue Feb 11 20:50:39 2025 >> done (19.454s) 17874479 read pairs processed; of these: 211919 ( 1.19%) short read pairs filtered out after trimming by size control 454503 ( 2.54%) empty read pairs filtered out after trimming by size control 17208057 (96.27%) read pairs available; of these: 17877 ( 0.10%) trimmed read pairs available after processing 17190180 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 5 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 11 0.00% 25 14 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 11 0.00% 30 8 0.00% 31 15 0.00% 32 14 0.00% 33 11 0.00% 34 7 0.00% 35 12 0.00% 36 14 0.00% 37 11 0.00% 38 20 0.00% 39 13 0.00% 40 12 0.00% 41 16 0.00% 42 11 0.00% 43 10 0.00% 44 6 0.00% 45 17 0.00% 46 10 0.00% 47 24 0.00% 48 17 0.00% 49 30 0.00% 50 14 0.00% 51 36 0.00% 52 27 0.00% 53 35 0.00% 54 24 0.00% 55 24 0.00% 56 30 0.00% 57 31 0.00% 58 15 0.00% 59 43 0.00% 60 28 0.00% 61 45 0.00% 62 49 0.00% 63 64 0.00% 64 24 0.00% 65 49 0.00% 66 41 0.00% 67 60 0.00% 68 67 0.00% 69 52 0.00% 70 60 0.00% 71 36 0.00% 72 106 0.00% 73 39 0.00% 74 37 0.00% 75 47 0.00% 76 24 0.00% 77 39 0.00% 78 38 0.00% 79 49 0.00% 80 37 0.00% 81 37 0.00% 82 39 0.00% 83 46 0.00% 84 46 0.00% 85 34 0.00% 86 45 0.00% 87 44 0.00% 88 58 0.00% 89 44 0.00% 90 39 0.00% 91 78 0.00% 92 52 0.00% 93 56 0.00% 94 33 0.00% 95 36 0.00% 96 74 0.00% 97 42 0.00% 98 70 0.00% 99 41 0.00% 100 51 0.00% 101 49 0.00% 102 44 0.00% 103 34 0.00% 104 41 0.00% 105 40 0.00% 106 42 0.00% 107 46 0.00% 108 41 0.00% 109 48 0.00% 110 57 0.00% 111 58 0.00% 112 54 0.00% 113 46 0.00% 114 50 0.00% 115 56 0.00% 116 64 0.00% 117 56 0.00% 118 59 0.00% 119 77 0.00% 120 92 0.00% 121 86 0.00% 122 100 0.00% 123 104 0.00% 124 117 0.00% 125 127 0.00% 126 120 0.00% 127 99 0.00% 128 147 0.00% 129 129 0.00% 130 128 0.00% 131 131 0.00% 132 148 0.00% 133 666 0.00% 134 72236 0.42% 135 76361 0.44% 136 78633 0.46% 137 82012 0.48% 138 82925 0.48% 139 86700 0.50% 140 86603 0.50% 141 91155 0.53% 142 92372 0.54% 143 95828 0.56% 144 95556 0.56% 145 102151 0.59% 146 106658 0.62% 147 118265 0.69% 148 141766 0.82% 149 633533 3.68% 150 15159567 88.10% criterion=sequence-density sequence-density=4.17 sequence-density-rank=1 fanout-score=1.02 fanout-score-rank=46 prefix-density=4.10 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.69 sequence-density-rank=20 fanout-score=88.64 fanout-score-rank=1 prefix-density=2.09 prefix-fanout=29.3 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=4.94 sequence-density-rank=1 fanout-score=1.67 fanout-score-rank=47 prefix-density=6.46 prefix-fanout=1.3 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=53.98 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=1.0 sequence=TGCTTACCAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCGAGGGTTGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCGTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCTCGGTGCGAGTTCTATCGGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGG SRR13857045 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:53:01 Started mapping on | Feb 11 20:53:01 Finished on | Feb 11 21:01:48 Mapping speed, Million of reads per hour | 166.39 Number of input reads | 24357849 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 6509761 Uniquely mapped reads % | 26.73% Average mapped length | 275.03 Number of splices: Total | 2742424 Number of splices: Annotated (sjdb) | 2655200 Number of splices: GT/AG | 2675355 Number of splices: GC/AG | 39439 Number of splices: AT/AC | 5215 Number of splices: Non-canonical | 22415 Mismatch rate per base, % | 0.67% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 3.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536520 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 12430223 % of reads mapped to too many loci | 51.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.99% % of reads unmapped: other | 10.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 17311568 17311568 17311568 N_multimapping 536520 536520 536520 N_noFeature 2122684 4300483 4251012 N_ambiguous 134869 26710 27515 UnstrandedReadsAssigned:4252208 PositiveStrandReadsAssigned:2182568 NegativeStrandReadsAssigned:2231234 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR13857045 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857045-trimmed-pair1.fastq SRR13857045-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,357,849 reads, 19,470,585 reads pseudoaligned [quant] estimated average fragment length: 189.061 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR13857045.ke.tsv 34699 SRR13857045.se.tsv 87100 total ==> SRR13857045.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.94 129 2.15566 Potri.005G024800.1.v4.1 1035 846.939 25 0.902641 Potri.004G059700.1.v4.1 961 772.939 323 12.7786 Potri.007G009000.2.v4.1 1416 1227.94 0 0 Potri.003G141000.2.v4.1 2943 2754.94 142.311 1.57962 Potri.016G087400.1.v4.1 270 96.7468 263 83.1278 Potri.015G069301.1.v4.1 564 376.08 0 0 Potri.010G195200.1.v4.1 1773 1584.94 0 0 Potri.012G127500.1.v4.1 977 788.939 5 0.1938 ==> SRR13857045.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 265 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 110 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857045 completed mapping pipeline successfully