Starting /dee2/code/volunteer_pipeline.sh SRR13857047 current disk space = 3052956770304 free memory = 1413956400 SRR13857047 SRAfilesize fbe546a4faaca30c2e224fef9da29681 SRR13857047.sra SRR13857047.sra file validated SRR13857047 is paired end SRR13857047 is conventional basespace SRR13857047 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857047_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.24375 32.0 32.0 32.0 2.0 32.0 2 31.545 32.0 32.0 32.0 32.0 32.0 3 34.945 37.0 32.0 37.0 32.0 37.0 4 36.18125 37.0 37.0 37.0 32.0 37.0 5 36.27125 37.0 37.0 37.0 37.0 37.0 6 39.7575 41.0 41.0 41.0 37.0 41.0 7 39.94875 41.0 41.0 41.0 37.0 41.0 8 39.98725 41.0 41.0 41.0 37.0 41.0 9 40.037 41.0 41.0 41.0 37.0 41.0 10-14 40.047850000000004 41.0 41.0 41.0 37.0 41.0 15-19 40.07815 41.0 41.0 41.0 37.0 41.0 20-24 39.941700000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.8236 41.0 41.0 41.0 37.0 41.0 30-34 39.7429 41.0 41.0 41.0 37.0 41.0 35-39 39.752050000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.7156 41.0 41.0 41.0 37.0 41.0 45-49 39.61295 41.0 41.0 41.0 37.0 41.0 50-54 39.533750000000005 41.0 41.0 41.0 37.0 41.0 55-59 39.33540000000001 41.0 41.0 41.0 37.0 41.0 60-64 39.3902 41.0 41.0 41.0 37.0 41.0 65-69 39.14815 41.0 41.0 41.0 36.0 41.0 70-74 39.064299999999996 41.0 41.0 41.0 35.0 41.0 75-79 38.9098 41.0 40.2 41.0 35.0 41.0 80-84 39.212849999999996 41.0 41.0 41.0 36.0 41.0 85-89 39.1345 41.0 41.0 41.0 36.0 41.0 90-94 39.089 41.0 41.0 41.0 37.0 41.0 95-99 39.150600000000004 41.0 41.0 41.0 37.0 41.0 100-104 38.907399999999996 41.0 41.0 41.0 33.0 41.0 105-109 38.862049999999996 41.0 41.0 41.0 32.0 41.0 110-114 38.656000000000006 41.0 41.0 41.0 32.0 41.0 115-119 38.6223 41.0 41.0 41.0 32.0 41.0 120-124 38.378550000000004 41.0 39.4 41.0 32.0 41.0 125-129 38.01584999999999 41.0 37.8 41.0 32.0 41.0 130-134 37.95355 41.0 37.0 41.0 32.0 41.0 135-139 37.3551 41.0 37.0 41.0 29.0 41.0 140-144 37.40795 41.0 37.0 41.0 27.0 41.0 145-149 37.29185 41.0 37.0 41.0 27.0 41.0 150 37.17425 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 14.0 24 17.0 25 24.0 26 26.0 27 38.0 28 29.0 29 32.0 30 40.0 31 53.0 32 51.0 33 80.0 34 80.0 35 110.0 36 120.0 37 150.0 38 201.0 39 381.0 40 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.130753444737614 27.176781002638524 15.010260920551158 43.68220463207271 2 19.004751187796952 23.730932733183295 42.010502625656414 15.25381345336334 3 18.625 26.825 31.3 23.25 4 20.175 22.7 32.550000000000004 24.575 5 28.475 22.95 26.325 22.25 6 21.775 26.275 28.999999999999996 22.95 7 25.15 26.900000000000002 27.1 20.849999999999998 8 18.8 22.25 35.15 23.799999999999997 9 22.3 21.85 33.025 22.825 10-14 24.375 24.685000000000002 27.13 23.810000000000002 15-19 24.195 24.385 25.86 25.56 20-24 23.630000000000003 24.9 26.72 24.75 25-29 23.5 25.555 26.605 24.34 30-34 24.48 24.935 25.624999999999996 24.959999999999997 35-39 24.16 25.955000000000002 24.845 25.040000000000003 40-44 24.224999999999998 25.615 25.845000000000002 24.315 45-49 24.325 24.990000000000002 25.430000000000003 25.255 50-54 24.535 25.385 25.485000000000003 24.595 55-59 24.610000000000003 25.06 25.259999999999998 25.069999999999997 60-64 23.990000000000002 24.98 25.929999999999996 25.1 65-69 24.745 25.290000000000003 25.290000000000003 24.675 70-74 24.335 25.314999999999998 25.995 24.355 75-79 24.525 25.495 25.685000000000002 24.295 80-84 24.625 25.955000000000002 24.82 24.6 85-89 24.635 26.455000000000002 24.91 24.0 90-94 24.51 26.445 24.82 24.224999999999998 95-99 24.965 25.490000000000002 25.174999999999997 24.37 100-104 24.894936962177304 25.00500300180108 25.485291174704823 24.61476886131679 105-109 24.654999999999998 25.679999999999996 25.045 24.62 110-114 24.796158271222048 25.951678255214844 25.351408133660147 23.900755339902958 115-119 24.384876975395077 25.93018603720744 25.460092018403678 24.2248449689938 120-124 24.982477220386503 25.823570641834387 24.69710623810954 24.49684589966957 125-129 24.783587690768076 25.68426319739805 25.1588691518639 24.373279959969977 130-134 23.97938763257955 25.55033019811887 26.09065439263558 24.379627776666 135-139 24.392930456115756 26.6509788214089 25.083863215340713 23.87222750713463 140-144 25.117535260578173 26.81304391317395 24.612383715114532 23.45703711113334 145-149 25.240000000000002 27.79 23.96 23.01 150 25.374999999999996 27.175 24.825 22.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.5 5 1.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 4.5 16 3.5 17 1.5 18 2.5 19 1.0 20 3.0 21 5.5 22 5.5 23 6.0 24 6.5 25 7.5 26 11.0 27 11.5 28 11.0 29 13.5 30 16.5 31 17.0 32 25.0 33 34.0 34 33.5 35 40.5 36 47.5 37 46.5 38 53.0 39 66.0 40 88.0 41 124.0 42 135.0 43 154.0 44 201.5 45 218.5 46 194.5 47 179.5 48 181.0 49 178.0 50 188.5 51 186.0 52 164.5 53 140.0 54 127.5 55 113.5 56 112.0 57 120.0 58 96.5 59 93.0 60 85.5 61 57.0 62 51.5 63 57.0 64 47.0 65 32.0 66 25.0 67 26.0 68 27.0 69 26.5 70 20.5 71 13.0 72 11.5 73 7.5 74 7.0 75 5.0 76 4.0 77 6.5 78 5.5 79 2.5 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.725 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.045 115-119 0.02 120-124 0.13 125-129 0.075 130-134 0.06 135-139 0.135 140-144 0.03 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.1 #Duplication Level Percentage of deduplicated Percentage of total 1 89.38706015891033 78.75 2 8.683314415437003 15.299999999999999 3 1.3053348467650396 3.45 4 0.4256526674233825 1.5 5 0.14188422247446084 0.625 6 0.028376844494892167 0.15 7 0.0 0.0 8 0.0 0.0 9 0.028376844494892167 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCT 9 0.22499999999999998 No Hit ATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTT 6 0.15 No Hit CAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGC 5 0.125 No Hit ATTTCACCTTCGCCGAAGCTCCCACTTATCCTACACCTCTCAAGTCATTT 5 0.125 No Hit CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit CTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGA 5 0.125 No Hit CTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0125 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTTC 10 0.0069954093 143.85 4 TTTGACT 10 0.0069954093 143.85 8 GTTTGAC 10 0.0069954093 143.85 7 TTCGCTG 10 0.0069954093 143.85 8 GTTTCGC 10 0.0069954093 143.85 6 GGTTTCG 10 0.0069954093 143.85 5 TCGCTGG 10 0.0069954093 143.85 9 TTTCGCT 10 0.0069954093 143.85 7 TGTTTGA 30 1.46880175E-5 95.899994 6 TTTGTGT 30 1.46880175E-5 95.899994 2 CTTTGTG 40 2.6733986E-5 84.617645 1 GTGTTTG 35 3.1574735E-5 82.200005 5 TGTGTTT 40 6.122689E-5 71.925 4 TTGTGTT 65 6.7519007E-4 44.261536 3 AGATCGG 30 0.0015123422 23.975 135-139 >>END_MODULE SRR13857047 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857047_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.205 12.0 2.0 32.0 2.0 32.0 2 30.40125 32.0 32.0 32.0 27.0 32.0 3 31.52125 32.0 32.0 37.0 22.0 37.0 4 32.8675 37.0 27.0 37.0 27.0 37.0 5 34.4025 37.0 37.0 37.0 27.0 37.0 6 37.30275 41.0 37.0 41.0 27.0 41.0 7 37.877 41.0 37.0 41.0 32.0 41.0 8 37.165 41.0 37.0 41.0 27.0 41.0 9 37.8485 41.0 37.0 41.0 27.0 41.0 10-14 38.6564 41.0 41.0 41.0 32.0 41.0 15-19 38.83385 41.0 41.0 41.0 34.0 41.0 20-24 38.89200000000001 41.0 41.0 41.0 35.0 41.0 25-29 38.909000000000006 41.0 41.0 41.0 35.0 41.0 30-34 38.80905 41.0 41.0 41.0 32.0 41.0 35-39 38.79495000000001 41.0 41.0 41.0 33.0 41.0 40-44 38.8499 41.0 41.0 41.0 32.0 41.0 45-49 38.6888 41.0 41.0 41.0 32.0 41.0 50-54 38.6238 41.0 41.0 41.0 32.0 41.0 55-59 38.644400000000005 41.0 41.0 41.0 32.0 41.0 60-64 38.54315 41.0 41.0 41.0 32.0 41.0 65-69 38.525150000000004 41.0 41.0 41.0 32.0 41.0 70-74 38.4978 41.0 41.0 41.0 32.0 41.0 75-79 37.76055 40.2 37.6 41.0 30.0 41.0 80-84 38.44330000000001 41.0 41.0 41.0 32.0 41.0 85-89 38.325750000000006 41.0 37.8 41.0 32.0 41.0 90-94 38.183949999999996 41.0 37.0 41.0 32.0 41.0 95-99 37.8733 41.0 37.0 41.0 31.0 41.0 100-104 37.81115 41.0 37.0 41.0 29.0 41.0 105-109 37.5072 41.0 37.0 41.0 27.0 41.0 110-114 37.28055 41.0 37.0 41.0 27.0 41.0 115-119 36.8073 41.0 37.0 41.0 27.0 41.0 120-124 36.43235 41.0 36.0 41.0 26.0 41.0 125-129 35.81555 41.0 34.0 41.0 22.0 41.0 130-134 35.382999999999996 41.0 32.0 41.0 22.0 41.0 135-139 34.95909999999999 41.0 32.0 41.0 22.0 41.0 140-144 34.52885 41.0 32.0 41.0 22.0 41.0 145-149 34.13695 37.8 29.0 41.0 14.0 41.0 150 33.533 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 20.0 24 32.0 25 44.0 26 48.0 27 49.0 28 61.0 29 78.0 30 93.0 31 86.0 32 116.0 33 108.0 34 139.0 35 170.0 36 201.0 37 235.0 38 356.0 39 774.0 40 1384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.397266959492436 28.208882381649588 16.593460224499758 40.80039043435823 2 18.25 23.45 42.699999999999996 15.6 3 17.875 27.650000000000002 32.875 21.6 4 19.875 22.75 33.475 23.9 5 29.125 22.95 26.325 21.6 6 20.625 26.325 30.425 22.625 7 26.3 25.45 27.525 20.724999999999998 8 18.725 21.85 37.625 21.8 9 21.375 22.375 35.225 21.025 10-14 24.107410741074105 25.842584258425845 27.217721772177217 22.832283228322833 15-19 24.404999999999998 25.69 25.790000000000003 24.115000000000002 20-24 24.147414741474147 24.61246124612461 26.587658765876586 24.652465246524653 25-29 23.794999999999998 25.35 26.39 24.465 30-34 24.251212560628034 25.026251312565627 26.131306565328266 24.591229561478073 35-39 24.337433743374337 25.662566256625663 25.742574257425744 24.257425742574256 40-44 24.57122856142807 25.74128706435322 25.241262063103154 24.446222311115555 45-49 24.23121156057803 25.026251312565627 26.046302315115753 24.696234811740585 50-54 24.34 24.725 26.565 24.37 55-59 23.985 24.68 25.900000000000002 25.435000000000002 60-64 23.895 24.66 26.68 24.765 65-69 24.376218810940546 24.746237311865592 26.176308815440773 24.70123506175309 70-74 24.48 25.53 25.71 24.279999999999998 75-79 24.135 25.419999999999998 25.419999999999998 25.025 80-84 24.265 25.41 26.055 24.27 85-89 24.21 25.885 25.46 24.445 90-94 24.025 26.0 25.85 24.125 95-99 24.485 25.145 25.745 24.625 100-104 24.654999999999998 24.785 26.215 24.345 105-109 24.215 25.019999999999996 25.715 25.05 110-114 24.154999999999998 24.98 26.75 24.115000000000002 115-119 24.515 25.155 25.805 24.525 120-124 24.595 25.185000000000002 25.66 24.560000000000002 125-129 24.64 25.705 26.015 23.64 130-134 24.525 24.7 27.08 23.695 135-139 24.25 25.919999999999998 25.36 24.47 140-144 24.47 26.825 25.35 23.355 145-149 25.95 26.174999999999997 24.525 23.35 150 27.175 25.0 23.95 23.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 2.5 4 2.0 5 0.5 6 1.0 7 1.0 8 0.5 9 1.0 10 2.5 11 2.0 12 2.0 13 4.0 14 4.5 15 4.0 16 4.0 17 2.5 18 2.5 19 2.0 20 1.5 21 4.5 22 6.5 23 7.5 24 8.5 25 7.0 26 6.5 27 8.0 28 8.0 29 11.0 30 18.0 31 23.5 32 31.0 33 33.0 34 37.0 35 40.5 36 43.5 37 56.5 38 72.5 39 80.0 40 100.0 41 130.0 42 145.0 43 164.0 44 187.0 45 209.0 46 207.0 47 173.5 48 172.0 49 186.5 50 179.0 51 177.0 52 159.5 53 145.0 54 145.5 55 123.0 56 117.0 57 112.0 58 96.0 59 86.5 60 71.5 61 52.0 62 44.5 63 46.0 64 32.5 65 25.5 66 21.5 67 21.5 68 23.5 69 21.5 70 24.0 71 18.0 72 7.0 73 4.0 74 2.5 75 4.0 76 5.0 77 4.5 78 5.5 79 5.0 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 48.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.005 35-39 0.01 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.14830970556162 84.5 2 6.924754634678298 12.7 3 0.7088331515812432 1.95 4 0.16357688113413305 0.6 5 0.05452562704471102 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTCCCACTTATCCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAG 5 0.125 No Hit CTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.175 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138 2.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGTG 10 0.007057572 143.42499 9 GGGATTG 10 0.007057572 143.42499 2 CTTTGTG 45 2.8225966E-4 112.49019 1 TTTGTGT 50 1.8802893E-8 86.05501 2 TTGTGTT 65 1.16029696E-7 66.19616 3 TGTGTTT 65 1.16029696E-7 66.19616 4 GTGTTTG 75 3.1244235E-7 57.37 5 TGTTTGA 75 3.1244235E-7 57.37 6 GTTTGAG 60 4.6165005E-4 47.808334 7 AAAAAAA 25 5.306289E-4 28.685001 100-104 AGATCGG 30 0.0015386302 23.904167 135-139 >>END_MODULE Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654061 spots for SRR13857047.sra Written 1654061 spots for SRR13857047.sra Read 1654068 spots for SRR13857047.sra Written 1654068 spots for SRR13857047.sra SRR ids: ['SRR13857047.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bv_o3zdu SRR13857047.sra spots: 33081227 blocks: [[1, 1654061], [1654062, 3308122], [3308123, 4962183], [4962184, 6616244], [6616245, 8270305], [8270306, 9924366], [9924367, 11578427], [11578428, 13232488], [13232489, 14886549], [14886550, 16540610], [16540611, 18194671], [18194672, 19848732], [19848733, 21502793], [21502794, 23156854], [23156855, 24810915], [24810916, 26464976], [26464977, 28119037], [28119038, 29773098], [29773099, 31427159], [31427160, 33081227]] SRR13857047 file size 11156136 SRR13857047 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857047 SRR13857047_1.fastq SRR13857047_2.fastq Input file: SRR13857047_1.fastq Paired file: SRR13857047_2.fastq trimmed: SRR13857047-trimmed-pair1.fastq, SRR13857047-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:00:15 2025 >> started Tue Feb 11 21:01:11 2025 >> done (55.924s) 33081227 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 32 ( 0.00%) empty read pairs filtered out after trimming by size control 33081177 (100.00%) read pairs available; of these: 4165358 (12.59%) trimmed read pairs available after processing 28915819 (87.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 7 0.00% 22 7 0.00% 23 11 0.00% 24 12 0.00% 25 9 0.00% 26 20 0.00% 27 13 0.00% 28 18 0.00% 29 22 0.00% 30 19 0.00% 31 22 0.00% 32 27 0.00% 33 28 0.00% 34 27 0.00% 35 36 0.00% 36 31 0.00% 37 33 0.00% 38 29 0.00% 39 28 0.00% 40 29 0.00% 41 40 0.00% 42 30 0.00% 43 39 0.00% 44 29 0.00% 45 39 0.00% 46 48 0.00% 47 54 0.00% 48 43 0.00% 49 52 0.00% 50 40 0.00% 51 79 0.00% 52 55 0.00% 53 60 0.00% 54 62 0.00% 55 60 0.00% 56 66 0.00% 57 60 0.00% 58 61 0.00% 59 107 0.00% 60 63 0.00% 61 110 0.00% 62 66 0.00% 63 133 0.00% 64 70 0.00% 65 120 0.00% 66 117 0.00% 67 166 0.00% 68 155 0.00% 69 110 0.00% 70 164 0.00% 71 118 0.00% 72 281 0.00% 73 123 0.00% 74 77 0.00% 75 122 0.00% 76 107 0.00% 77 111 0.00% 78 80 0.00% 79 122 0.00% 80 79 0.00% 81 105 0.00% 82 96 0.00% 83 117 0.00% 84 100 0.00% 85 90 0.00% 86 99 0.00% 87 139 0.00% 88 153 0.00% 89 103 0.00% 90 120 0.00% 91 181 0.00% 92 103 0.00% 93 106 0.00% 94 92 0.00% 95 88 0.00% 96 124 0.00% 97 89 0.00% 98 91 0.00% 99 93 0.00% 100 76 0.00% 101 105 0.00% 102 80 0.00% 103 84 0.00% 104 74 0.00% 105 82 0.00% 106 75 0.00% 107 98 0.00% 108 95 0.00% 109 94 0.00% 110 94 0.00% 111 108 0.00% 112 93 0.00% 113 96 0.00% 114 114 0.00% 115 106 0.00% 116 107 0.00% 117 114 0.00% 118 165 0.00% 119 150 0.00% 120 159 0.00% 121 192 0.00% 122 217 0.00% 123 230 0.00% 124 237 0.00% 125 231 0.00% 126 295 0.00% 127 236 0.00% 128 248 0.00% 129 338 0.00% 130 267 0.00% 131 244 0.00% 132 263 0.00% 133 1426 0.00% 134 159406 0.48% 135 171195 0.52% 136 175739 0.53% 137 179812 0.54% 138 187749 0.57% 139 192046 0.58% 140 196399 0.59% 141 203181 0.61% 142 205289 0.62% 143 211333 0.64% 144 214356 0.65% 145 222278 0.67% 146 226093 0.68% 147 240038 0.73% 148 291152 0.88% 149 1076649 3.25% 150 28915819 87.41% 33081177 reads passed initial QC criterion=sequence-density sequence-density=2.45 sequence-density-rank=1 fanout-score=1.09 fanout-score-rank=40 prefix-density=0.62 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=99.81 fanout-score-rank=1 prefix-density=2.42 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=3.85 sequence-density-rank=1 fanout-score=1.44 fanout-score-rank=46 prefix-density=3.86 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=45 fanout-score=74.01 fanout-score-rank=1 prefix-density=2.42 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857047 SRR13857047_1.fastq SRR13857047_2.fastq Input file: SRR13857047_1.fastq Paired file: SRR13857047_2.fastq trimmed: SRR13857047-trimmed-pair1.fastq, SRR13857047-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:04:46 2025 >> started Tue Feb 11 21:05:13 2025 >> done (27.188s) 16540589 read pairs processed; of these: 117383 ( 0.71%) short read pairs filtered out after trimming by size control 47904 ( 0.29%) empty read pairs filtered out after trimming by size control 16375302 (99.00%) read pairs available; of these: 2949 ( 0.02%) trimmed read pairs available after processing 16372353 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 6 0.00% 27 2 0.00% 28 8 0.00% 29 11 0.00% 30 9 0.00% 31 14 0.00% 32 16 0.00% 33 13 0.00% 34 17 0.00% 35 16 0.00% 36 16 0.00% 37 19 0.00% 38 15 0.00% 39 7 0.00% 40 14 0.00% 41 29 0.00% 42 14 0.00% 43 19 0.00% 44 8 0.00% 45 22 0.00% 46 28 0.00% 47 25 0.00% 48 23 0.00% 49 24 0.00% 50 27 0.00% 51 42 0.00% 52 30 0.00% 53 35 0.00% 54 35 0.00% 55 39 0.00% 56 41 0.00% 57 24 0.00% 58 28 0.00% 59 56 0.00% 60 31 0.00% 61 47 0.00% 62 36 0.00% 63 63 0.00% 64 34 0.00% 65 59 0.00% 66 61 0.00% 67 89 0.00% 68 77 0.00% 69 56 0.00% 70 82 0.00% 71 59 0.00% 72 152 0.00% 73 61 0.00% 74 42 0.00% 75 59 0.00% 76 54 0.00% 77 50 0.00% 78 49 0.00% 79 67 0.00% 80 40 0.00% 81 58 0.00% 82 43 0.00% 83 74 0.00% 84 43 0.00% 85 41 0.00% 86 49 0.00% 87 80 0.00% 88 71 0.00% 89 57 0.00% 90 59 0.00% 91 95 0.00% 92 49 0.00% 93 45 0.00% 94 48 0.00% 95 40 0.00% 96 63 0.00% 97 42 0.00% 98 40 0.00% 99 56 0.00% 100 41 0.00% 101 48 0.00% 102 50 0.00% 103 38 0.00% 104 25 0.00% 105 41 0.00% 106 42 0.00% 107 50 0.00% 108 42 0.00% 109 54 0.00% 110 46 0.00% 111 56 0.00% 112 47 0.00% 113 45 0.00% 114 52 0.00% 115 53 0.00% 116 43 0.00% 117 50 0.00% 118 83 0.00% 119 76 0.00% 120 84 0.00% 121 108 0.00% 122 99 0.00% 123 131 0.00% 124 119 0.00% 125 104 0.00% 126 142 0.00% 127 119 0.00% 128 117 0.00% 129 172 0.00% 130 133 0.00% 131 120 0.00% 132 145 0.00% 133 681 0.00% 134 78931 0.48% 135 84903 0.52% 136 87319 0.53% 137 89402 0.55% 138 93308 0.57% 139 94821 0.58% 140 97019 0.59% 141 100313 0.61% 142 101621 0.62% 143 104942 0.64% 144 106165 0.65% 145 109925 0.67% 146 113032 0.69% 147 119594 0.73% 148 144585 0.88% 149 531912 3.25% 150 14311174 87.39% criterion=sequence-density sequence-density=2.02 sequence-density-rank=1 fanout-score=1.10 fanout-score-rank=40 prefix-density=0.62 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=102.72 fanout-score-rank=1 prefix-density=2.43 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=3.25 sequence-density-rank=1 fanout-score=1.73 fanout-score-rank=46 prefix-density=3.82 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=47 fanout-score=76.30 fanout-score-rank=1 prefix-density=2.41 prefix-fanout=1.6 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR13857047 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 21:38:59 Started mapping on | Feb 11 21:38:59 Finished on | Feb 11 21:55:21 Mapping speed, Million of reads per hour | 120.67 Number of input reads | 32915534 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 9880165 Uniquely mapped reads % | 30.02% Average mapped length | 269.15 Number of splices: Total | 4164990 Number of splices: Annotated (sjdb) | 3995151 Number of splices: GT/AG | 4030070 Number of splices: GC/AG | 60303 Number of splices: AT/AC | 7758 Number of splices: Non-canonical | 66859 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 3.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 792402 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 15504832 % of reads mapped to too many loci | 47.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.08% % of reads unmapped: other | 8.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 22242978 22242978 22242978 N_multimapping 792402 792402 792402 N_noFeature 3663945 6813955 6626188 N_ambiguous 197365 46462 47198 UnstrandedReadsAssigned:6018855 PositiveStrandReadsAssigned:3019748 NegativeStrandReadsAssigned:3206779 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857047 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857047-trimmed-pair1.fastq SRR13857047-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,915,534 reads, 25,683,035 reads pseudoaligned [quant] estimated average fragment length: 178.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR13857047.ke.tsv 34699 SRR13857047.se.tsv 87100 total ==> SRR13857047.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1840.22 222 3.25577 Potri.005G024800.1.v4.1 1035 857.225 66 2.07788 Potri.004G059700.1.v4.1 961 783.225 183 6.30575 Potri.007G009000.2.v4.1 1416 1238.22 0 0 Potri.003G141000.2.v4.1 2943 2765.22 124.847 1.21848 Potri.016G087400.1.v4.1 270 102.207 221 58.3556 Potri.015G069301.1.v4.1 564 386.343 0 0 Potri.010G195200.1.v4.1 1773 1595.22 4 0.0676722 Potri.012G127500.1.v4.1 977 799.225 23 0.77666 ==> SRR13857047.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 496 Potri.001G233950.v4.1 10 Potri.001G122700.v4.1 109 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 93 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857047 completed mapping pipeline successfully