Starting /dee2/code/volunteer_pipeline.sh SRR13857048 current disk space = 3052588404736 free memory = 1311600120 SRR13857048 SRAfilesize 5cfe7d4f74346850919bee93b1369c91 SRR13857048.sra SRR13857048.sra file validated SRR13857048 is paired end SRR13857048 is conventional basespace SRR13857048 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857048_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3825 32.0 32.0 32.0 2.0 32.0 2 31.4725 32.0 32.0 32.0 32.0 32.0 3 34.78625 37.0 32.0 37.0 32.0 37.0 4 35.93375 37.0 37.0 37.0 32.0 37.0 5 36.125 37.0 37.0 37.0 37.0 37.0 6 39.63075 41.0 41.0 41.0 37.0 41.0 7 39.64 41.0 41.0 41.0 37.0 41.0 8 39.61825 41.0 41.0 41.0 37.0 41.0 9 39.71275 41.0 41.0 41.0 37.0 41.0 10-14 39.8968 41.0 41.0 41.0 37.0 41.0 15-19 39.71385 41.0 41.0 41.0 37.0 41.0 20-24 39.5268 41.0 41.0 41.0 37.0 41.0 25-29 39.32105 41.0 41.0 41.0 37.0 41.0 30-34 39.214150000000004 41.0 41.0 41.0 37.0 41.0 35-39 38.9527 41.0 41.0 41.0 35.0 41.0 40-44 39.0237 41.0 41.0 41.0 36.0 41.0 45-49 38.8189 41.0 41.0 41.0 33.0 41.0 50-54 38.77365 41.0 41.0 41.0 32.0 41.0 55-59 38.31975 41.0 40.2 41.0 31.0 41.0 60-64 38.39255000000001 41.0 41.0 41.0 32.0 41.0 65-69 38.0664 41.0 38.6 41.0 31.0 41.0 70-74 37.68205 41.0 37.0 41.0 28.0 41.0 75-79 36.926649999999995 40.2 36.0 41.0 25.0 41.0 80-84 37.63165 41.0 37.0 41.0 27.0 41.0 85-89 37.47045 41.0 37.0 41.0 26.0 41.0 90-94 37.2699 41.0 37.0 41.0 27.0 41.0 95-99 37.2768 41.0 37.0 41.0 25.0 41.0 100-104 37.1584 41.0 37.0 41.0 27.0 41.0 105-109 37.0619 41.0 37.0 41.0 26.0 41.0 110-114 36.751099999999994 41.0 37.0 41.0 22.0 41.0 115-119 36.8817 41.0 37.0 41.0 22.0 41.0 120-124 36.61865 41.0 37.0 41.0 22.0 41.0 125-129 36.647450000000006 41.0 37.0 41.0 22.0 41.0 130-134 36.429050000000004 41.0 37.0 41.0 22.0 41.0 135-139 35.5711 41.0 35.0 41.0 18.0 41.0 140-144 35.35185 41.0 32.0 41.0 20.0 41.0 145-149 35.49795 41.0 32.0 41.0 22.0 41.0 150 35.2185 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 23.0 24 38.0 25 77.0 26 52.0 27 72.0 28 63.0 29 74.0 30 89.0 31 81.0 32 93.0 33 80.0 34 103.0 35 124.0 36 143.0 37 188.0 38 256.0 39 453.0 40 1987.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.346368715083798 30.726256983240223 16.731843575418996 40.19553072625698 2 17.150000000000002 24.25 42.725 15.875 3 16.325 28.525 33.35 21.8 4 18.75 26.0 34.125 21.125 5 25.974999999999998 25.0 27.900000000000002 21.125 6 20.349999999999998 26.900000000000002 31.025000000000002 21.725 7 24.4 27.55 27.55 20.5 8 18.45 23.3 36.775000000000006 21.475 9 19.975 22.900000000000002 35.75 21.375 10-14 22.52 26.345000000000002 28.615000000000002 22.52 15-19 23.085 25.97 27.38 23.565 20-24 23.064999999999998 26.224999999999998 27.800000000000004 22.91 25-29 22.48 25.935000000000002 28.349999999999998 23.235 30-34 22.925 27.43 26.810000000000002 22.835 35-39 23.169999999999998 27.27 26.705000000000002 22.855 40-44 23.064999999999998 27.279999999999998 26.47 23.185 45-49 23.169999999999998 27.005000000000003 26.939999999999998 22.884999999999998 50-54 23.24 27.455000000000002 26.63 22.675 55-59 22.919999999999998 26.555 27.034999999999997 23.49 60-64 22.564999999999998 26.655 27.200000000000003 23.580000000000002 65-69 22.715 28.02 26.334999999999997 22.93 70-74 23.145 27.084999999999997 26.400000000000002 23.369999999999997 75-79 22.259999999999998 27.700000000000003 26.924999999999997 23.115 80-84 22.625 28.83 25.665 22.88 85-89 22.575 28.89 25.759999999999998 22.775000000000002 90-94 22.48 29.645 25.47 22.405 95-99 22.919999999999998 29.12 25.505 22.455 100-104 22.865716429107277 28.37209302325581 25.806451612903224 22.95573893473368 105-109 22.5 28.76 26.025 22.715 110-114 22.24222422242224 28.66786678667867 26.312631263126313 22.777277727772777 115-119 22.595000000000002 28.68 26.484999999999996 22.24 120-124 22.47786725353874 29.060171059870953 25.558945630970843 22.903016055619467 125-129 22.73068267066767 29.002250562640658 26.076519129782444 22.190547636909226 130-134 22.588388258238737 28.444266639996002 26.178926839025852 22.78841826273941 135-139 22.136029227766375 29.367899504529305 26.244932686051747 22.25113858165257 140-144 22.945736434108525 29.59739934983746 25.6514128532133 21.80545136284071 145-149 23.330000000000002 30.659999999999997 24.7 21.310000000000002 150 24.025 30.75 24.425 20.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.5 2 4.0 3 5.5 4 5.0 5 6.0 6 3.0 7 1.0 8 1.5 9 0.5 10 1.5 11 2.5 12 2.5 13 4.0 14 3.5 15 3.5 16 6.0 17 8.0 18 8.5 19 9.0 20 8.5 21 7.0 22 7.0 23 10.0 24 15.0 25 16.5 26 17.0 27 18.0 28 19.0 29 27.0 30 30.0 31 29.5 32 33.5 33 39.0 34 55.0 35 73.0 36 86.0 37 81.5 38 82.5 39 98.0 40 120.5 41 160.5 42 164.0 43 175.5 44 219.5 45 230.5 46 200.5 47 153.5 48 149.5 49 172.5 50 175.0 51 157.0 52 132.5 53 117.5 54 105.5 55 90.5 56 88.0 57 91.5 58 78.5 59 67.0 60 58.0 61 43.5 62 37.0 63 33.5 64 25.5 65 20.5 66 16.5 67 18.0 68 21.5 69 13.0 70 6.0 71 4.5 72 3.5 73 3.5 74 2.5 75 0.5 76 0.5 77 3.5 78 3.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.034999999999999996 125-129 0.025 130-134 0.015 135-139 0.095 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2109375 81.72500000000001 2 6.891741071428571 12.35 3 1.3671875 3.675 4 0.27901785714285715 1.0 5 0.13950892857142858 0.625 6 0.08370535714285714 0.44999999999999996 7 0.027901785714285712 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATC 7 0.17500000000000002 No Hit CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 6 0.15 No Hit CGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAA 6 0.15 No Hit TGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTT 5 0.125 No Hit CTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGA 5 0.125 No Hit CTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATC 5 0.125 No Hit CTGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGAT 5 0.125 No Hit CTCAACGAGAACAGAAATCTCGTGTGGAACAAAAGGGTAAAAGCTCGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138 2.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13857048 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857048_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.54625 32.0 2.0 32.0 2.0 32.0 2 30.365 32.0 32.0 32.0 27.0 32.0 3 32.5925 32.0 32.0 37.0 32.0 37.0 4 33.60875 37.0 32.0 37.0 27.0 37.0 5 34.5225 37.0 37.0 37.0 27.0 37.0 6 37.76875 41.0 37.0 41.0 27.0 41.0 7 37.99925 41.0 37.0 41.0 32.0 41.0 8 37.98725 41.0 37.0 41.0 32.0 41.0 9 37.95325 41.0 37.0 41.0 27.0 41.0 10-14 38.1608 41.0 37.8 41.0 32.0 41.0 15-19 38.08305 41.0 37.0 41.0 30.0 41.0 20-24 38.46265 41.0 41.0 41.0 32.0 41.0 25-29 38.0034 41.0 37.0 41.0 30.0 41.0 30-34 37.9569 41.0 37.0 41.0 30.0 41.0 35-39 37.85765 41.0 37.0 41.0 28.0 41.0 40-44 38.0868 41.0 37.0 41.0 31.0 41.0 45-49 37.8543 41.0 37.0 41.0 29.0 41.0 50-54 37.902 41.0 37.0 41.0 30.0 41.0 55-59 38.07885 41.0 37.0 41.0 32.0 41.0 60-64 38.0714 41.0 37.0 41.0 32.0 41.0 65-69 37.8146 41.0 37.0 41.0 29.0 41.0 70-74 37.908049999999996 41.0 37.0 41.0 29.0 41.0 75-79 37.054649999999995 40.2 36.0 41.0 28.0 41.0 80-84 37.80999999999999 41.0 37.0 41.0 30.0 41.0 85-89 37.77094999999999 41.0 37.0 41.0 30.0 41.0 90-94 37.479499999999994 41.0 37.0 41.0 27.0 41.0 95-99 37.29145 41.0 37.0 41.0 27.0 41.0 100-104 37.04445 41.0 37.0 41.0 27.0 41.0 105-109 36.58745 41.0 37.0 41.0 26.0 41.0 110-114 36.00945 41.0 34.0 41.0 22.0 41.0 115-119 35.480149999999995 41.0 32.0 41.0 22.0 41.0 120-124 35.1848 41.0 32.0 41.0 22.0 41.0 125-129 34.6866 41.0 32.0 41.0 18.0 41.0 130-134 34.08489999999999 39.4 29.0 41.0 12.0 41.0 135-139 33.6736 37.0 27.0 41.0 12.0 41.0 140-144 32.8997 37.0 27.0 41.0 12.0 41.0 145-149 32.80765 37.0 27.0 41.0 12.0 41.0 150 32.21125 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 10.0 23 35.0 24 34.0 25 69.0 26 58.0 27 75.0 28 95.0 29 111.0 30 100.0 31 133.0 32 139.0 33 128.0 34 155.0 35 207.0 36 216.0 37 246.0 38 361.0 39 643.0 40 1184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.31300345224396 30.072880705792098 18.22017644802455 39.39393939393939 2 16.950000000000003 25.5 42.075 15.475 3 16.6 28.499999999999996 33.425 21.475 4 20.275000000000002 25.6 33.375 20.75 5 26.775 24.95 28.375 19.900000000000002 6 21.075 27.05 31.775 20.1 7 23.674999999999997 26.85 29.549999999999997 19.925 8 18.325 22.325 37.974999999999994 21.375 9 20.674999999999997 24.025 36.225 19.075 10-14 22.765 25.71 29.244999999999997 22.28 15-19 22.925 26.174999999999997 28.449999999999996 22.45 20-24 22.71 25.145 29.794999999999998 22.35 25-29 22.655 25.695 28.945 22.705000000000002 30-34 22.95 25.635 29.154999999999998 22.259999999999998 35-39 23.175 26.185000000000002 28.18 22.46 40-44 23.735 26.045 28.625 21.595 45-49 23.26 24.9 29.025000000000002 22.814999999999998 50-54 23.315 25.44 28.660000000000004 22.585 55-59 23.294999999999998 25.324999999999996 28.82 22.56 60-64 22.939999999999998 24.64 29.53 22.89 65-69 23.93 25.019999999999996 29.615000000000002 21.435000000000002 70-74 22.900000000000002 25.06 29.415000000000003 22.625 75-79 22.145 25.185000000000002 29.345 23.325000000000003 80-84 22.27 25.785000000000004 29.32 22.625 85-89 23.025000000000002 25.785000000000004 28.93 22.259999999999998 90-94 22.720000000000002 25.945 29.404999999999998 21.93 95-99 22.93 25.319999999999997 29.104999999999997 22.645 100-104 22.64 25.16 29.189999999999998 23.01 105-109 22.31 25.095 29.69 22.905 110-114 22.75 25.82 29.505 21.925 115-119 23.01 25.480000000000004 29.265 22.245 120-124 22.564999999999998 25.974999999999998 28.465 22.994999999999997 125-129 23.055 25.615 29.475 21.855 130-134 22.765 25.174999999999997 29.935000000000002 22.125 135-139 22.945 26.265 29.035 21.755 140-144 23.34 26.11 28.754999999999995 21.795 145-149 23.695 27.35 27.165 21.790000000000003 150 24.275 25.974999999999998 27.875 21.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 4.0 2 5.0 3 6.0 4 3.5 5 6.0 6 8.5 7 7.5 8 5.0 9 6.0 10 6.5 11 4.0 12 9.0 13 11.5 14 8.5 15 7.5 16 11.5 17 13.0 18 9.5 19 8.5 20 7.0 21 5.5 22 8.5 23 11.0 24 10.5 25 13.5 26 15.5 27 13.0 28 13.0 29 19.5 30 26.5 31 30.5 32 40.5 33 42.0 34 44.0 35 60.0 36 74.5 37 84.5 38 98.5 39 117.5 40 134.0 41 149.0 42 172.5 43 188.5 44 206.0 45 216.5 46 184.0 47 163.5 48 168.5 49 166.0 50 163.5 51 156.5 52 138.0 53 123.5 54 103.5 55 83.0 56 84.5 57 82.0 58 70.0 59 66.0 60 60.5 61 40.0 62 26.0 63 31.5 64 24.0 65 15.0 66 16.0 67 18.0 68 18.0 69 13.5 70 11.5 71 8.5 72 5.5 73 3.0 74 1.0 75 1.0 76 1.0 77 1.0 78 3.5 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 34.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.39277172468775 88.8 2 4.996013818761626 9.4 3 0.5314908317831517 1.5 4 0.07972362476747276 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 40 0.008095551 17.95 5 >>END_MODULE Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193541 spots for SRR13857048.sra Written 1193541 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra Read 1193536 spots for SRR13857048.sra Written 1193536 spots for SRR13857048.sra SRR ids: ['SRR13857048.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fpq3g42o SRR13857048.sra spots: 23870725 blocks: [[1, 1193536], [1193537, 2387072], [2387073, 3580608], [3580609, 4774144], [4774145, 5967680], [5967681, 7161216], [7161217, 8354752], [8354753, 9548288], [9548289, 10741824], [10741825, 11935360], [11935361, 13128896], [13128897, 14322432], [14322433, 15515968], [15515969, 16709504], [16709505, 17903040], [17903041, 19096576], [19096577, 20290112], [20290113, 21483648], [21483649, 22677184], [22677185, 23870725]] SRR13857048 file size 8043993 SRR13857048 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857048 SRR13857048_1.fastq SRR13857048_2.fastq Input file: SRR13857048_1.fastq Paired file: SRR13857048_2.fastq trimmed: SRR13857048-trimmed-pair1.fastq, SRR13857048-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:39:32 2025 >> started Tue Feb 11 21:40:01 2025 >> done (29.099s) 23870725 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 24 ( 0.00%) empty read pairs filtered out after trimming by size control 23870692 (100.00%) read pairs available; of these: 3072672 (12.87%) trimmed read pairs available after processing 20798020 (87.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 5 0.00% 22 12 0.00% 23 12 0.00% 24 13 0.00% 25 15 0.00% 26 14 0.00% 27 8 0.00% 28 19 0.00% 29 18 0.00% 30 18 0.00% 31 33 0.00% 32 22 0.00% 33 23 0.00% 34 30 0.00% 35 30 0.00% 36 31 0.00% 37 37 0.00% 38 30 0.00% 39 30 0.00% 40 29 0.00% 41 34 0.00% 42 37 0.00% 43 46 0.00% 44 33 0.00% 45 42 0.00% 46 38 0.00% 47 54 0.00% 48 50 0.00% 49 50 0.00% 50 61 0.00% 51 89 0.00% 52 65 0.00% 53 72 0.00% 54 89 0.00% 55 68 0.00% 56 86 0.00% 57 83 0.00% 58 78 0.00% 59 135 0.00% 60 91 0.00% 61 132 0.00% 62 96 0.00% 63 171 0.00% 64 108 0.00% 65 170 0.00% 66 154 0.00% 67 229 0.00% 68 206 0.00% 69 163 0.00% 70 157 0.00% 71 163 0.00% 72 368 0.00% 73 172 0.00% 74 143 0.00% 75 180 0.00% 76 132 0.00% 77 138 0.00% 78 119 0.00% 79 146 0.00% 80 120 0.00% 81 177 0.00% 82 129 0.00% 83 151 0.00% 84 134 0.00% 85 170 0.00% 86 123 0.00% 87 214 0.00% 88 154 0.00% 89 152 0.00% 90 116 0.00% 91 206 0.00% 92 146 0.00% 93 107 0.00% 94 111 0.00% 95 146 0.00% 96 135 0.00% 97 137 0.00% 98 101 0.00% 99 162 0.00% 100 122 0.00% 101 140 0.00% 102 114 0.00% 103 136 0.00% 104 144 0.00% 105 118 0.00% 106 133 0.00% 107 153 0.00% 108 129 0.00% 109 135 0.00% 110 149 0.00% 111 194 0.00% 112 147 0.00% 113 179 0.00% 114 181 0.00% 115 164 0.00% 116 183 0.00% 117 215 0.00% 118 210 0.00% 119 245 0.00% 120 259 0.00% 121 313 0.00% 122 328 0.00% 123 321 0.00% 124 359 0.00% 125 408 0.00% 126 423 0.00% 127 415 0.00% 128 408 0.00% 129 409 0.00% 130 405 0.00% 131 447 0.00% 132 394 0.00% 133 1286 0.01% 134 110513 0.46% 135 116744 0.49% 136 120101 0.50% 137 123165 0.52% 138 127586 0.53% 139 132143 0.55% 140 132676 0.56% 141 137766 0.58% 142 141927 0.59% 143 144949 0.61% 144 147542 0.62% 145 151231 0.63% 146 154702 0.65% 147 164900 0.69% 148 215416 0.90% 149 934160 3.91% 150 20798020 87.13% 23870692 reads passed initial QC criterion=sequence-density sequence-density=2.42 sequence-density-rank=1 fanout-score=1.16 fanout-score-rank=35 prefix-density=0.66 prefix-fanout=1.2 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=60.24 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=2.0 sequence=CCTCTCCGGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATACGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGGATGGGGGCCGGCGATGCG criterion=sequence-density sequence-density=6.05 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=42 prefix-density=9.51 prefix-fanout=1.7 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=36 fanout-score=63.33 fanout-score-rank=1 prefix-density=7.02 prefix-fanout=1.3 sequence=GTGTTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCGGTAGAAGG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857048 SRR13857048_1.fastq SRR13857048_2.fastq Input file: SRR13857048_1.fastq Paired file: SRR13857048_2.fastq trimmed: SRR13857048-trimmed-pair1.fastq, SRR13857048-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:42:08 2025 >> started Tue Feb 11 21:42:23 2025 >> done (15.100s) 14322415 read pairs processed; of these: 85843 ( 0.60%) short read pairs filtered out after trimming by size control 42918 ( 0.30%) empty read pairs filtered out after trimming by size control 14193654 (99.10%) read pairs available; of these: 15748 ( 0.11%) trimmed read pairs available after processing 14177906 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 8 0.00% 23 9 0.00% 24 6 0.00% 25 11 0.00% 26 8 0.00% 27 7 0.00% 28 13 0.00% 29 13 0.00% 30 11 0.00% 31 20 0.00% 32 15 0.00% 33 14 0.00% 34 19 0.00% 35 20 0.00% 36 13 0.00% 37 24 0.00% 38 19 0.00% 39 17 0.00% 40 15 0.00% 41 25 0.00% 42 19 0.00% 43 24 0.00% 44 15 0.00% 45 30 0.00% 46 20 0.00% 47 34 0.00% 48 33 0.00% 49 30 0.00% 50 35 0.00% 51 63 0.00% 52 36 0.00% 53 48 0.00% 54 46 0.00% 55 45 0.00% 56 46 0.00% 57 43 0.00% 58 49 0.00% 59 80 0.00% 60 50 0.00% 61 85 0.00% 62 57 0.00% 63 100 0.00% 64 70 0.00% 65 97 0.00% 66 89 0.00% 67 136 0.00% 68 114 0.00% 69 103 0.00% 70 90 0.00% 71 99 0.00% 72 202 0.00% 73 100 0.00% 74 87 0.00% 75 112 0.00% 76 67 0.00% 77 87 0.00% 78 68 0.00% 79 84 0.00% 80 62 0.00% 81 107 0.00% 82 83 0.00% 83 92 0.00% 84 71 0.00% 85 100 0.00% 86 75 0.00% 87 132 0.00% 88 102 0.00% 89 101 0.00% 90 58 0.00% 91 127 0.00% 92 90 0.00% 93 67 0.00% 94 65 0.00% 95 91 0.00% 96 84 0.00% 97 78 0.00% 98 63 0.00% 99 101 0.00% 100 73 0.00% 101 92 0.00% 102 65 0.00% 103 82 0.00% 104 78 0.00% 105 63 0.00% 106 74 0.00% 107 88 0.00% 108 80 0.00% 109 85 0.00% 110 85 0.00% 111 112 0.00% 112 79 0.00% 113 102 0.00% 114 106 0.00% 115 95 0.00% 116 107 0.00% 117 120 0.00% 118 128 0.00% 119 149 0.00% 120 158 0.00% 121 196 0.00% 122 189 0.00% 123 187 0.00% 124 223 0.00% 125 228 0.00% 126 254 0.00% 127 247 0.00% 128 244 0.00% 129 248 0.00% 130 246 0.00% 131 268 0.00% 132 255 0.00% 133 744 0.01% 134 65466 0.46% 135 69352 0.49% 136 71677 0.50% 137 73660 0.52% 138 75906 0.53% 139 78514 0.55% 140 78737 0.55% 141 81960 0.58% 142 84630 0.60% 143 86371 0.61% 144 87887 0.62% 145 90631 0.64% 146 97340 0.69% 147 103366 0.73% 148 131266 0.92% 149 542999 3.83% 150 12363694 87.11% criterion=sequence-density sequence-density=2.19 sequence-density-rank=1 fanout-score=46.73 fanout-score-rank=2 prefix-density=3.56 prefix-fanout=28.7 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=56.70 fanout-score-rank=1 prefix-density=1.84 prefix-fanout=1.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=5.48 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=41 prefix-density=9.61 prefix-fanout=1.7 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=36 fanout-score=63.93 fanout-score-rank=1 prefix-density=6.47 prefix-fanout=1.4 sequence=GTGTTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCGGTAGAAGG SRR13857048 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 22:01:45 Started mapping on | Feb 11 22:01:47 Finished on | Feb 11 22:10:28 Mapping speed, Million of reads per hour | 164.05 Number of input reads | 23741573 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 7447507 Uniquely mapped reads % | 31.37% Average mapped length | 265.96 Number of splices: Total | 3345835 Number of splices: Annotated (sjdb) | 3204349 Number of splices: GT/AG | 3233956 Number of splices: GC/AG | 46128 Number of splices: AT/AC | 6040 Number of splices: Non-canonical | 59711 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 607651 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 9438061 % of reads mapped to too many loci | 39.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.76% % of reads unmapped: other | 10.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 15686424 15686424 15686424 N_multimapping 607651 607651 607651 N_noFeature 2154180 4936572 4569023 N_ambiguous 175168 36800 42564 UnstrandedReadsAssigned:5118159 PositiveStrandReadsAssigned:2474135 NegativeStrandReadsAssigned:2835920 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857048 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857048-trimmed-pair1.fastq SRR13857048-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,741,573 reads, 18,337,344 reads pseudoaligned [quant] estimated average fragment length: 177.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR13857048.ke.tsv 34699 SRR13857048.se.tsv 87100 total ==> SRR13857048.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.92 177 3.56587 Potri.005G024800.1.v4.1 1035 858.925 7 0.302417 Potri.004G059700.1.v4.1 961 784.925 246 11.6298 Potri.007G009000.2.v4.1 1416 1239.92 0 0 Potri.003G141000.2.v4.1 2943 2766.92 73.0382 0.979527 Potri.016G087400.1.v4.1 270 103.402 299 107.302 Potri.015G069301.1.v4.1 564 387.997 0 0 Potri.010G195200.1.v4.1 1773 1596.92 4 0.0929479 Potri.012G127500.1.v4.1 977 800.925 2 0.0926621 ==> SRR13857048.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 194 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 123 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 116 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857048 completed mapping pipeline successfully