Starting /dee2/code/volunteer_pipeline.sh SRR13857049 current disk space = 3052241920000 free memory = 1575584396 SRR13857049 SRAfilesize c96bdc35199241213c6a4a5c7b0e1752 SRR13857049.sra SRR13857049.sra file validated SRR13857049 is paired end SRR13857049 is conventional basespace SRR13857049 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857049_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.35375 32.0 32.0 32.0 2.0 32.0 2 31.49875 32.0 32.0 32.0 32.0 32.0 3 34.94625 37.0 32.0 37.0 32.0 37.0 4 35.97 37.0 37.0 37.0 32.0 37.0 5 36.2225 37.0 37.0 37.0 37.0 37.0 6 39.444 41.0 41.0 41.0 37.0 41.0 7 39.814 41.0 41.0 41.0 37.0 41.0 8 39.89675 41.0 41.0 41.0 37.0 41.0 9 39.95925 41.0 41.0 41.0 37.0 41.0 10-14 39.979 41.0 41.0 41.0 37.0 41.0 15-19 39.9875 41.0 41.0 41.0 37.0 41.0 20-24 39.77115 41.0 41.0 41.0 37.0 41.0 25-29 39.6938 41.0 41.0 41.0 37.0 41.0 30-34 39.52175 41.0 41.0 41.0 37.0 41.0 35-39 39.6468 41.0 41.0 41.0 37.0 41.0 40-44 39.61555 41.0 41.0 41.0 37.0 41.0 45-49 39.56699999999999 41.0 41.0 41.0 37.0 41.0 50-54 39.51774999999999 41.0 41.0 41.0 37.0 41.0 55-59 39.13915 41.0 41.0 41.0 37.0 41.0 60-64 39.40065 41.0 41.0 41.0 37.0 41.0 65-69 38.963750000000005 41.0 41.0 41.0 34.0 41.0 70-74 38.9437 41.0 41.0 41.0 34.0 41.0 75-79 38.777849999999994 41.0 40.2 41.0 34.0 41.0 80-84 39.1199 41.0 41.0 41.0 36.0 41.0 85-89 39.03869999999999 41.0 41.0 41.0 35.0 41.0 90-94 38.9976 41.0 41.0 41.0 34.0 41.0 95-99 39.17014999999999 41.0 41.0 41.0 37.0 41.0 100-104 38.8943 41.0 41.0 41.0 33.0 41.0 105-109 38.9076 41.0 41.0 41.0 33.0 41.0 110-114 38.570550000000004 41.0 41.0 41.0 32.0 41.0 115-119 38.37755 41.0 40.2 41.0 32.0 41.0 120-124 38.28075 41.0 39.4 41.0 32.0 41.0 125-129 37.881299999999996 41.0 37.0 41.0 30.0 41.0 130-134 37.75005 41.0 37.0 41.0 28.0 41.0 135-139 37.392700000000005 41.0 37.0 41.0 29.0 41.0 140-144 37.270950000000006 41.0 37.0 41.0 27.0 41.0 145-149 37.13375 41.0 37.0 41.0 27.0 41.0 150 37.2785 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 10.0 24 30.0 25 16.0 26 22.0 27 34.0 28 35.0 29 31.0 30 49.0 31 61.0 32 55.0 33 78.0 34 86.0 35 101.0 36 116.0 37 161.0 38 240.0 39 448.0 40 2425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.760395463797616 26.548415236987495 16.10933410875254 41.58185519046234 2 18.804701175293822 23.330832708177045 43.03575893973493 14.828707176794198 3 17.925 25.674999999999997 32.824999999999996 23.575 4 20.424999999999997 24.7 32.45 22.425 5 27.400000000000002 22.975 28.050000000000004 21.575 6 21.7 25.2 30.4 22.7 7 26.924999999999997 26.325 25.8 20.95 8 19.8 22.05 35.25 22.900000000000002 9 22.45 20.849999999999998 34.949999999999996 21.75 10-14 23.57 25.295 27.029999999999998 24.104999999999997 15-19 24.695 25.185000000000002 25.7 24.42 20-24 24.240000000000002 24.79 26.529999999999998 24.44 25-29 24.42 25.195 25.915 24.47 30-34 24.33 25.21 25.869999999999997 24.59 35-39 24.585 25.365 25.474999999999998 24.575 40-44 24.09 25.924999999999997 25.35 24.635 45-49 24.575 25.825 25.71 23.89 50-54 24.485 25.635 25.575 24.305 55-59 24.21 25.085 25.535000000000004 25.169999999999998 60-64 24.545 24.68 26.185000000000002 24.59 65-69 24.595 25.245 25.655 24.505 70-74 24.169999999999998 25.180000000000003 26.085 24.565 75-79 24.55 25.085 25.605 24.759999999999998 80-84 24.29 26.31 24.915000000000003 24.485 85-89 24.605 26.534999999999997 24.805 24.055 90-94 24.855 25.974999999999998 25.005 24.165 95-99 24.94 25.755 24.495 24.81 100-104 24.86618978540343 25.181331599219646 25.081286578960533 24.871192036416385 105-109 24.48 24.86 25.545 25.115 110-114 23.9247849569914 25.6501300260052 25.94518903780756 24.479895979195838 115-119 24.251212560628034 25.816290814540725 25.321266063303167 24.611230561528078 120-124 24.699759807846277 25.915732586068856 24.71477181745396 24.669735788630906 125-129 24.289715886354543 25.885354141656663 24.99499799919968 24.829931972789115 130-134 24.777433229968988 25.44263278983695 25.457637291187357 24.322296689006702 135-139 24.42942942942943 26.79179179179179 24.714714714714713 24.064064064064063 140-144 25.070014002800562 27.1004200840168 24.42988597719544 23.399679935987198 145-149 25.295 28.03 23.035 23.64 150 26.075 26.8 24.05 23.075000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 3.0 5 3.5 6 1.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 2.0 18 2.5 19 2.5 20 3.5 21 3.5 22 3.5 23 5.5 24 5.0 25 5.0 26 8.0 27 8.5 28 12.0 29 13.0 30 10.0 31 15.0 32 18.0 33 18.5 34 29.0 35 42.5 36 54.5 37 61.5 38 72.0 39 85.0 40 99.0 41 113.0 42 136.0 43 160.5 44 201.0 45 226.0 46 190.0 47 168.5 48 188.0 49 193.0 50 181.0 51 163.0 52 162.5 53 161.5 54 135.0 55 123.0 56 120.0 57 109.5 58 89.5 59 89.5 60 85.0 61 63.0 62 51.5 63 50.5 64 39.0 65 28.0 66 26.0 67 27.5 68 27.5 69 24.0 70 26.0 71 16.0 72 7.5 73 6.5 74 3.5 75 2.5 76 1.5 77 2.0 78 3.5 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.025000000000002 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.02 115-119 0.005 120-124 0.08 125-129 0.04 130-134 0.03 135-139 0.1 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.75 #Duplication Level Percentage of deduplicated Percentage of total 1 89.25925925925927 78.325 2 8.660968660968662 15.2 3 1.3675213675213675 3.5999999999999996 4 0.5128205128205128 1.7999999999999998 5 0.08547008547008547 0.375 6 0.028490028490028487 0.15 7 0.056980056980056974 0.35000000000000003 8 0.028490028490028487 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAGGATTTCGATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTA 8 0.2 No Hit CAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAG 7 0.17500000000000002 No Hit CTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGAATAAG 7 0.17500000000000002 No Hit CTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAG 6 0.15 No Hit CTAGCTATGCGGAGGTGACCCTCCGCGGCCAGCTTCTTAGAGGGACTATG 5 0.125 No Hit CTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGG 5 0.125 No Hit ATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 1.25 0.0 0.0 0.0 0.0 138 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCAAT 10 0.004289331 169.0294 1 TTCAATC 10 0.007020917 143.675 2 TCGGTAG 10 0.007020917 143.675 7 CAATCGG 10 0.007020917 143.675 4 TCAATCG 10 0.007020917 143.675 3 ATCGGTA 10 0.007020917 143.675 6 AATCGGT 10 0.007020917 143.675 5 CGGTAGG 10 0.007020917 143.675 8 TCGGAAG 20 0.0062073963 28.735 140-144 ATCGGAA 25 5.252472E-4 28.735 140-144 AGATCGG 25 5.252472E-4 28.735 140-144 >>END_MODULE SRR13857049 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857049_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 15.97 12.0 2.0 32.0 2.0 32.0 2 30.90375 32.0 32.0 32.0 32.0 32.0 3 31.54 32.0 32.0 32.0 22.0 37.0 4 32.8425 37.0 27.0 37.0 27.0 37.0 5 34.4125 37.0 37.0 37.0 27.0 37.0 6 36.7265 41.0 37.0 41.0 27.0 41.0 7 37.69275 41.0 37.0 41.0 27.0 41.0 8 37.2995 41.0 37.0 41.0 27.0 41.0 9 37.78375 41.0 37.0 41.0 27.0 41.0 10-14 38.3798 41.0 40.2 41.0 32.0 41.0 15-19 38.44895 41.0 40.2 41.0 32.0 41.0 20-24 38.543749999999996 41.0 41.0 41.0 32.0 41.0 25-29 38.70455 41.0 41.0 41.0 33.0 41.0 30-34 38.55884999999999 41.0 40.2 41.0 32.0 41.0 35-39 38.563750000000006 41.0 41.0 41.0 32.0 41.0 40-44 38.464299999999994 41.0 41.0 41.0 32.0 41.0 45-49 38.4004 41.0 39.4 41.0 32.0 41.0 50-54 38.407799999999995 41.0 38.6 41.0 32.0 41.0 55-59 38.3681 41.0 39.4 41.0 32.0 41.0 60-64 38.304449999999996 41.0 37.8 41.0 32.0 41.0 65-69 38.24095 41.0 37.8 41.0 32.0 41.0 70-74 38.32845 41.0 38.6 41.0 32.0 41.0 75-79 37.422850000000004 40.2 36.8 41.0 29.0 41.0 80-84 38.17095 41.0 38.6 41.0 32.0 41.0 85-89 37.904050000000005 41.0 37.0 41.0 30.0 41.0 90-94 37.80525 41.0 37.0 41.0 29.0 41.0 95-99 37.4697 41.0 37.0 41.0 27.0 41.0 100-104 37.47355 41.0 37.0 41.0 27.0 41.0 105-109 37.0668 41.0 37.0 41.0 27.0 41.0 110-114 36.91645 41.0 37.0 41.0 27.0 41.0 115-119 36.405699999999996 41.0 37.0 41.0 25.0 41.0 120-124 35.80114999999999 41.0 32.0 41.0 22.0 41.0 125-129 35.3133 41.0 32.0 41.0 22.0 41.0 130-134 34.7039 41.0 32.0 41.0 22.0 41.0 135-139 34.62575 41.0 32.0 41.0 18.0 41.0 140-144 33.857800000000005 37.8 28.0 41.0 12.0 41.0 145-149 33.57455 37.0 27.0 41.0 12.0 41.0 150 33.15975 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 9.0 23 31.0 24 34.0 25 61.0 26 58.0 27 67.0 28 69.0 29 84.0 30 76.0 31 92.0 32 113.0 33 127.0 34 138.0 35 187.0 36 213.0 37 259.0 38 402.0 39 796.0 40 1184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.39539347408829 26.343570057581573 17.994241842610364 41.26679462571977 2 18.025 22.95 44.25 14.774999999999999 3 18.55 25.874999999999996 33.4 22.175 4 19.325 23.65 34.375 22.650000000000002 5 28.975 22.15 28.175 20.7 6 22.3 24.775 31.225 21.7 7 25.374999999999996 24.85 28.725 21.05 8 19.275000000000002 22.825 37.0 20.9 9 22.2 20.825 35.575 21.4 10-14 23.68 25.825 27.765 22.73 15-19 24.39 24.235 26.810000000000002 24.565 20-24 24.365000000000002 24.83 27.045 23.76 25-29 23.474999999999998 24.735 26.784999999999997 25.005 30-34 24.315 25.205 26.169999999999998 24.310000000000002 35-39 24.125 25.4 26.095000000000002 24.38 40-44 24.735 25.119999999999997 25.72 24.425 45-49 24.57 25.319999999999997 25.779999999999998 24.33 50-54 24.37 24.955 26.400000000000002 24.275 55-59 24.099999999999998 24.2 26.650000000000002 25.05 60-64 24.025 24.37 26.815 24.79 65-69 24.58 24.97 26.32 24.13 70-74 24.235 25.235000000000003 26.27 24.26 75-79 24.555 25.2 25.805 24.44 80-84 24.485 25.465 25.69 24.36 85-89 24.765 25.545 25.395 24.295 90-94 24.34 26.135 25.505 24.02 95-99 24.89 25.28 25.040000000000003 24.79 100-104 24.990000000000002 24.365000000000002 25.569999999999997 25.074999999999996 105-109 24.709999999999997 24.125 25.835 25.330000000000002 110-114 23.825 24.224999999999998 27.105 24.845 115-119 24.060000000000002 24.775 26.729999999999997 24.435000000000002 120-124 25.25 24.615000000000002 26.245 23.89 125-129 24.935 25.835 25.465 23.765 130-134 23.765 25.230000000000004 26.31 24.695 135-139 24.33 25.585 26.555 23.53 140-144 24.965 26.16 25.27 23.605 145-149 25.900000000000002 26.515 24.7 22.884999999999998 150 26.474999999999998 25.874999999999996 24.0 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 2.0 4 1.5 5 1.5 6 2.0 7 2.0 8 2.5 9 2.0 10 1.0 11 3.5 12 5.0 13 3.5 14 4.0 15 4.0 16 5.5 17 5.0 18 1.5 19 1.5 20 1.5 21 3.0 22 4.5 23 5.0 24 4.5 25 4.0 26 4.5 27 7.0 28 9.0 29 8.0 30 11.0 31 16.0 32 20.5 33 24.0 34 34.0 35 51.5 36 57.0 37 58.5 38 72.0 39 89.0 40 107.0 41 117.5 42 130.5 43 168.0 44 203.5 45 211.0 46 196.5 47 190.0 48 200.5 49 192.0 50 183.5 51 163.0 52 144.0 53 148.5 54 136.0 55 122.0 56 112.5 57 104.0 58 95.0 59 97.0 60 88.0 61 52.0 62 44.0 63 48.0 64 32.0 65 23.5 66 23.0 67 28.0 68 27.0 69 15.5 70 12.0 71 9.0 72 7.0 73 6.5 74 4.0 75 4.0 76 5.5 77 6.5 78 4.5 79 2.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 47.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.96536796536796 85.9 2 6.195887445887446 11.450000000000001 3 0.5681818181818182 1.575 4 0.1893939393939394 0.7000000000000001 5 0.08116883116883117 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAG 5 0.125 No Hit TGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAA 5 0.125 No Hit CCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.0625 0.0 0.0 0.0 0.0 128-129 0.075 0.0 0.0 0.0 0.0 130-131 0.075 0.0 0.0 0.0 0.0 132-133 0.075 0.0 0.0 0.0 0.0 134-135 0.33749999999999997 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 30 0.0015331751 23.918749 140-144 AGATCGG 35 0.0037544232 20.501785 7 >>END_MODULE Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652451 spots for SRR13857049.sra Written 1652451 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra Read 1652440 spots for SRR13857049.sra Written 1652440 spots for SRR13857049.sra SRR ids: ['SRR13857049.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ujhwtqm9 SRR13857049.sra spots: 33048811 blocks: [[1, 1652440], [1652441, 3304880], [3304881, 4957320], [4957321, 6609760], [6609761, 8262200], [8262201, 9914640], [9914641, 11567080], [11567081, 13219520], [13219521, 14871960], [14871961, 16524400], [16524401, 18176840], [18176841, 19829280], [19829281, 21481720], [21481721, 23134160], [23134161, 24786600], [24786601, 26439040], [26439041, 28091480], [28091481, 29743920], [29743921, 31396360], [31396361, 33048811]] SRR13857049 file size 11145183 SRR13857049 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857049 SRR13857049_1.fastq SRR13857049_2.fastq Input file: SRR13857049_1.fastq Paired file: SRR13857049_2.fastq trimmed: SRR13857049-trimmed-pair1.fastq, SRR13857049-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:24:45 2025 >> started Tue Feb 11 22:25:22 2025 >> done (36.426s) 33048811 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 26 ( 0.00%) empty read pairs filtered out after trimming by size control 33048775 (100.00%) read pairs available; of these: 3977203 (12.03%) trimmed read pairs available after processing 29071572 (87.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 8 0.00% 22 11 0.00% 23 14 0.00% 24 17 0.00% 25 18 0.00% 26 17 0.00% 27 15 0.00% 28 14 0.00% 29 22 0.00% 30 30 0.00% 31 21 0.00% 32 24 0.00% 33 28 0.00% 34 26 0.00% 35 36 0.00% 36 29 0.00% 37 44 0.00% 38 32 0.00% 39 35 0.00% 40 33 0.00% 41 53 0.00% 42 33 0.00% 43 51 0.00% 44 36 0.00% 45 60 0.00% 46 54 0.00% 47 52 0.00% 48 65 0.00% 49 60 0.00% 50 60 0.00% 51 94 0.00% 52 95 0.00% 53 91 0.00% 54 91 0.00% 55 128 0.00% 56 107 0.00% 57 98 0.00% 58 94 0.00% 59 151 0.00% 60 88 0.00% 61 166 0.00% 62 96 0.00% 63 196 0.00% 64 111 0.00% 65 168 0.00% 66 150 0.00% 67 263 0.00% 68 200 0.00% 69 173 0.00% 70 221 0.00% 71 164 0.00% 72 341 0.00% 73 146 0.00% 74 126 0.00% 75 179 0.00% 76 120 0.00% 77 165 0.00% 78 130 0.00% 79 153 0.00% 80 131 0.00% 81 159 0.00% 82 128 0.00% 83 158 0.00% 84 141 0.00% 85 157 0.00% 86 140 0.00% 87 186 0.00% 88 168 0.00% 89 143 0.00% 90 159 0.00% 91 233 0.00% 92 127 0.00% 93 146 0.00% 94 108 0.00% 95 157 0.00% 96 153 0.00% 97 122 0.00% 98 136 0.00% 99 153 0.00% 100 110 0.00% 101 158 0.00% 102 105 0.00% 103 142 0.00% 104 133 0.00% 105 147 0.00% 106 119 0.00% 107 152 0.00% 108 119 0.00% 109 127 0.00% 110 117 0.00% 111 146 0.00% 112 131 0.00% 113 159 0.00% 114 164 0.00% 115 172 0.00% 116 173 0.00% 117 177 0.00% 118 190 0.00% 119 184 0.00% 120 237 0.00% 121 251 0.00% 122 270 0.00% 123 283 0.00% 124 376 0.00% 125 354 0.00% 126 356 0.00% 127 369 0.00% 128 347 0.00% 129 411 0.00% 130 355 0.00% 131 367 0.00% 132 375 0.00% 133 1396 0.00% 134 142069 0.43% 135 151880 0.46% 136 156377 0.47% 137 161284 0.49% 138 167886 0.51% 139 175367 0.53% 140 176867 0.54% 141 185367 0.56% 142 189472 0.57% 143 194549 0.59% 144 197308 0.60% 145 205647 0.62% 146 209625 0.63% 147 225399 0.68% 148 280615 0.85% 149 1140502 3.45% 150 29071572 87.97% 33048775 reads passed initial QC criterion=sequence-density sequence-density=2.72 sequence-density-rank=1 fanout-score=1.09 fanout-score-rank=40 prefix-density=0.91 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=89.53 fanout-score-rank=1 prefix-density=2.60 prefix-fanout=1.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=4.79 sequence-density-rank=1 fanout-score=1.82 fanout-score-rank=45 prefix-density=5.71 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=43 fanout-score=63.50 fanout-score-rank=1 prefix-density=2.58 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857049 SRR13857049_1.fastq SRR13857049_2.fastq Input file: SRR13857049_1.fastq Paired file: SRR13857049_2.fastq trimmed: SRR13857049-trimmed-pair1.fastq, SRR13857049-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:28:41 2025 >> started Tue Feb 11 22:28:59 2025 >> done (17.108s) 16524388 read pairs processed; of these: 122431 ( 0.74%) short read pairs filtered out after trimming by size control 61583 ( 0.37%) empty read pairs filtered out after trimming by size control 16340374 (98.89%) read pairs available; of these: 4610 ( 0.03%) trimmed read pairs available after processing 16335764 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 7 0.00% 23 5 0.00% 24 7 0.00% 25 9 0.00% 26 7 0.00% 27 4 0.00% 28 5 0.00% 29 10 0.00% 30 13 0.00% 31 11 0.00% 32 11 0.00% 33 17 0.00% 34 13 0.00% 35 20 0.00% 36 13 0.00% 37 22 0.00% 38 17 0.00% 39 14 0.00% 40 15 0.00% 41 28 0.00% 42 16 0.00% 43 32 0.00% 44 25 0.00% 45 29 0.00% 46 27 0.00% 47 25 0.00% 48 36 0.00% 49 34 0.00% 50 34 0.00% 51 51 0.00% 52 48 0.00% 53 53 0.00% 54 41 0.00% 55 61 0.00% 56 59 0.00% 57 49 0.00% 58 44 0.00% 59 63 0.00% 60 48 0.00% 61 84 0.00% 62 49 0.00% 63 94 0.00% 64 56 0.00% 65 86 0.00% 66 76 0.00% 67 127 0.00% 68 95 0.00% 69 82 0.00% 70 114 0.00% 71 78 0.00% 72 182 0.00% 73 70 0.00% 74 63 0.00% 75 79 0.00% 76 53 0.00% 77 71 0.00% 78 83 0.00% 79 79 0.00% 80 68 0.00% 81 81 0.00% 82 60 0.00% 83 81 0.00% 84 78 0.00% 85 84 0.00% 86 72 0.00% 87 98 0.00% 88 80 0.00% 89 67 0.00% 90 88 0.00% 91 116 0.00% 92 68 0.00% 93 76 0.00% 94 58 0.00% 95 83 0.00% 96 76 0.00% 97 65 0.00% 98 70 0.00% 99 86 0.00% 100 51 0.00% 101 71 0.00% 102 58 0.00% 103 77 0.00% 104 66 0.00% 105 63 0.00% 106 57 0.00% 107 71 0.00% 108 55 0.00% 109 69 0.00% 110 62 0.00% 111 73 0.00% 112 57 0.00% 113 80 0.00% 114 78 0.00% 115 85 0.00% 116 91 0.00% 117 91 0.00% 118 103 0.00% 119 82 0.00% 120 124 0.00% 121 130 0.00% 122 125 0.00% 123 144 0.00% 124 188 0.00% 125 182 0.00% 126 187 0.00% 127 182 0.00% 128 162 0.00% 129 201 0.00% 130 179 0.00% 131 191 0.00% 132 212 0.00% 133 674 0.00% 134 70252 0.43% 135 75223 0.46% 136 77547 0.47% 137 80033 0.49% 138 83177 0.51% 139 87002 0.53% 140 87632 0.54% 141 91234 0.56% 142 93771 0.57% 143 96290 0.59% 144 97535 0.60% 145 101658 0.62% 146 105267 0.64% 147 113244 0.69% 148 139716 0.86% 149 561244 3.43% 150 14371025 87.95% criterion=sequence-density sequence-density=2.29 sequence-density-rank=1 fanout-score=1.11 fanout-score-rank=40 prefix-density=0.91 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=91.28 fanout-score-rank=1 prefix-density=2.62 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=4.12 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=40 prefix-density=5.70 prefix-fanout=1.6 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=43 fanout-score=64.21 fanout-score-rank=1 prefix-density=2.56 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR13857049 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:30:44 Started mapping on | Feb 11 22:30:44 Finished on | Feb 11 22:42:33 Mapping speed, Million of reads per hour | 166.87 Number of input reads | 32864761 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9378483 Uniquely mapped reads % | 28.54% Average mapped length | 280.01 Number of splices: Total | 3605311 Number of splices: Annotated (sjdb) | 3444919 Number of splices: GT/AG | 3486957 Number of splices: GC/AG | 49828 Number of splices: AT/AC | 6112 Number of splices: Non-canonical | 62414 Mismatch rate per base, % | 0.62% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 3.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 776791 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 15989012 % of reads mapped to too many loci | 48.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.78% % of reads unmapped: other | 10.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 22709487 22709487 22709487 N_multimapping 776791 776791 776791 N_noFeature 3747748 6595655 6409129 N_ambiguous 187131 31267 34689 UnstrandedReadsAssigned:5443604 PositiveStrandReadsAssigned:2751561 NegativeStrandReadsAssigned:2934665 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857049 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857049-trimmed-pair1.fastq SRR13857049-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,864,761 reads, 25,821,327 reads pseudoaligned [quant] estimated average fragment length: 191.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 975 rounds 52401 SRR13857049.ke.tsv 34699 SRR13857049.se.tsv 87100 total ==> SRR13857049.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.76 137 1.87722 Potri.005G024800.1.v4.1 1035 844.755 5 0.148235 Potri.004G059700.1.v4.1 961 770.755 184 5.97879 Potri.007G009000.2.v4.1 1416 1225.76 0 0 Potri.003G141000.2.v4.1 2943 2752.76 123 1.11905 Potri.016G087400.1.v4.1 270 92.5966 239 64.642 Potri.015G069301.1.v4.1 564 373.906 0 0 Potri.010G195200.1.v4.1 1773 1582.76 0 0 Potri.012G127500.1.v4.1 977 786.755 10 0.318326 ==> SRR13857049.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 273 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 113 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 173 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857049 completed mapping pipeline successfully