Starting /dee2/code/volunteer_pipeline.sh SRR13857050 current disk space = 3052578631680 free memory = 1509792460 SRR13857050 SRAfilesize 6f2308a59f398efd4ae430ee9fee338e SRR13857050.sra SRR13857050.sra file validated SRR13857050 is paired end SRR13857050 is conventional basespace SRR13857050 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857050_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.05625 32.0 32.0 32.0 2.0 32.0 2 31.59125 32.0 32.0 32.0 32.0 32.0 3 35.10125 37.0 32.0 37.0 32.0 37.0 4 36.24 37.0 37.0 37.0 32.0 37.0 5 36.3825 37.0 37.0 37.0 37.0 37.0 6 39.96375 41.0 41.0 41.0 37.0 41.0 7 40.03875 41.0 41.0 41.0 37.0 41.0 8 40.08775 41.0 41.0 41.0 37.0 41.0 9 40.1295 41.0 41.0 41.0 37.0 41.0 10-14 40.1669 41.0 41.0 41.0 37.0 41.0 15-19 40.106700000000004 41.0 41.0 41.0 37.8 41.0 20-24 40.01285 41.0 41.0 41.0 37.0 41.0 25-29 39.868900000000004 41.0 41.0 41.0 37.0 41.0 30-34 39.865249999999996 41.0 41.0 41.0 37.0 41.0 35-39 39.80895 41.0 41.0 41.0 37.0 41.0 40-44 39.74805 41.0 41.0 41.0 37.0 41.0 45-49 39.4779 41.0 41.0 41.0 37.0 41.0 50-54 39.693099999999994 41.0 41.0 41.0 37.0 41.0 55-59 39.38 41.0 41.0 41.0 37.0 41.0 60-64 39.579 41.0 41.0 41.0 37.0 41.0 65-69 39.505849999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.38045 41.0 41.0 41.0 37.0 41.0 75-79 39.1138 41.0 40.2 41.0 36.0 41.0 80-84 39.48375 41.0 41.0 41.0 37.0 41.0 85-89 39.41965 41.0 41.0 41.0 37.0 41.0 90-94 39.48855 41.0 41.0 41.0 37.0 41.0 95-99 39.36285 41.0 41.0 41.0 37.0 41.0 100-104 39.281600000000005 41.0 41.0 41.0 37.0 41.0 105-109 39.196749999999994 41.0 41.0 41.0 36.0 41.0 110-114 39.090349999999994 41.0 41.0 41.0 37.0 41.0 115-119 39.0048 41.0 41.0 41.0 35.0 41.0 120-124 38.65935 41.0 41.0 41.0 33.0 41.0 125-129 38.44265 41.0 41.0 41.0 32.0 41.0 130-134 38.3899 41.0 41.0 41.0 32.0 41.0 135-139 37.70190000000001 41.0 39.4 41.0 29.0 41.0 140-144 37.62425 41.0 37.0 41.0 28.0 41.0 145-149 37.58605 41.0 37.0 41.0 28.0 41.0 150 37.644 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 9.0 24 10.0 25 20.0 26 19.0 27 26.0 28 22.0 29 29.0 30 40.0 31 47.0 32 47.0 33 66.0 34 72.0 35 100.0 36 98.0 37 158.0 38 208.0 39 404.0 40 2623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.93174061433447 27.730375426621162 16.524459613196814 40.81342434584755 2 19.975 22.85 41.275 15.9 3 18.099999999999998 26.825 33.300000000000004 21.775 4 20.7 23.65 31.924999999999997 23.724999999999998 5 27.325 24.275 27.1 21.3 6 23.125 25.074999999999996 29.7 22.1 7 25.900000000000002 26.075 26.525 21.5 8 19.075 23.45 35.375 22.1 9 22.875 21.05 34.275 21.8 10-14 23.815 25.8 27.08 23.305 15-19 24.529999999999998 24.82 25.5 25.15 20-24 24.215 25.28 26.05 24.455 25-29 24.285 25.224999999999998 26.040000000000003 24.45 30-34 24.4 25.55 25.480000000000004 24.57 35-39 24.635 25.779999999999998 25.319999999999997 24.265 40-44 24.86 25.965 24.975 24.2 45-49 24.955 25.7 24.959999999999997 24.385 50-54 24.365000000000002 24.795 25.855 24.985 55-59 24.035 25.345000000000002 25.585 25.035 60-64 24.73 25.040000000000003 25.259999999999998 24.97 65-69 24.831241562078105 25.20126006300315 25.171258562928145 24.7962398119906 70-74 25.06 25.61 25.145 24.185000000000002 75-79 24.37 25.424999999999997 25.31 24.895 80-84 24.645 25.545 25.06 24.75 85-89 24.33 25.72 25.155 24.795 90-94 24.125 26.779999999999998 24.85 24.245 95-99 24.58 25.72 24.64 25.06 100-104 24.374499599679744 24.96997598078463 25.360288230584466 25.295236188951158 105-109 24.21 25.885 24.875 25.03 110-114 24.27849747411594 25.138798579502826 25.964087430600713 24.618616515780523 115-119 25.069999999999997 25.319999999999997 25.25 24.36 120-124 24.43799128823912 25.689681069443747 25.09387673359035 24.778450908726782 125-129 24.46201581423281 26.40876789110199 24.677209488539688 24.45200680612551 130-134 24.166916841789252 25.282697888521966 26.308415891123786 24.241969378564995 135-139 24.451897086795473 26.328961858043847 25.292822104314745 23.926318950845932 140-144 25.428814322148323 26.568985347802172 24.72870930639596 23.27349102365355 145-149 25.85 27.36 23.59 23.200000000000003 150 25.6 27.85 22.825 23.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 3.5 23 3.5 24 6.0 25 8.5 26 7.0 27 6.5 28 6.5 29 8.5 30 11.5 31 15.0 32 22.0 33 24.0 34 33.0 35 55.5 36 60.0 37 50.5 38 63.5 39 77.5 40 110.5 41 157.0 42 160.5 43 162.0 44 167.5 45 178.5 46 184.5 47 179.0 48 193.5 49 210.5 50 189.0 51 153.5 52 159.0 53 167.5 54 145.0 55 113.5 56 104.5 57 106.0 58 90.5 59 96.0 60 91.5 61 56.0 62 48.5 63 50.0 64 40.5 65 32.0 66 20.5 67 25.0 68 29.5 69 22.0 70 20.5 71 17.0 72 12.0 73 7.0 74 4.5 75 4.5 76 6.0 77 5.5 78 4.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.0 110-114 0.034999999999999996 115-119 0.0 120-124 0.135 125-129 0.09 130-134 0.06999999999999999 135-139 0.11 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.25007024445068 80.30000000000001 2 7.754987355998876 13.8 3 1.489182354593987 3.975 4 0.39336892385501543 1.4000000000000001 5 0.08429334082607474 0.375 6 0.02809778027535825 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCGGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACAT 6 0.15 No Hit CTAAGGTCCCTAAGCAATCACTTAGTGGAAAAGGAAGTGATCGAGCGATG 5 0.125 No Hit CTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACATTG 5 0.125 No Hit CCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACG 20 1.948587E-6 143.95 8 GTTTGAC 20 1.948587E-6 143.95 7 TTGACGT 10 0.0069808904 143.95 9 TTGACGG 10 0.0069808904 143.95 9 TGTGTTT 20 1.948587E-6 143.95 4 CTTTGTG 25 4.55185E-6 121.221054 1 GTGTTTG 25 5.914442E-6 115.16 5 TTGTGTT 30 1.4637406E-5 95.96667 3 TTTGTGT 30 1.4637406E-5 95.96667 2 TGTTTGA 35 3.146605E-5 82.25714 6 ATCGGAA 35 0.0036887764 20.564285 140-144 CGGAAGA 40 0.007982711 18.940788 1 >>END_MODULE SRR13857050 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857050_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.38375 27.0 2.0 32.0 2.0 32.0 2 30.58375 32.0 32.0 32.0 27.0 32.0 3 32.6725 32.0 32.0 37.0 32.0 37.0 4 33.4175 37.0 32.0 37.0 27.0 37.0 5 34.8125 37.0 37.0 37.0 27.0 37.0 6 37.8385 41.0 37.0 41.0 32.0 41.0 7 38.3335 41.0 37.0 41.0 32.0 41.0 8 38.59575 41.0 41.0 41.0 32.0 41.0 9 38.5405 41.0 41.0 41.0 32.0 41.0 10-14 38.501 41.0 39.4 41.0 32.0 41.0 15-19 38.58669999999999 41.0 40.2 41.0 32.0 41.0 20-24 38.81570000000001 41.0 41.0 41.0 33.0 41.0 25-29 38.70665 41.0 41.0 41.0 33.0 41.0 30-34 38.7631 41.0 41.0 41.0 32.0 41.0 35-39 38.59765 41.0 41.0 41.0 32.0 41.0 40-44 38.50985 41.0 40.2 41.0 32.0 41.0 45-49 38.457550000000005 41.0 39.4 41.0 32.0 41.0 50-54 38.450149999999994 41.0 39.4 41.0 32.0 41.0 55-59 38.693949999999994 41.0 41.0 41.0 32.0 41.0 60-64 38.611850000000004 41.0 41.0 41.0 32.0 41.0 65-69 38.58399999999999 41.0 41.0 41.0 32.0 41.0 70-74 38.57735 41.0 41.0 41.0 32.0 41.0 75-79 37.80365 40.2 37.6 41.0 30.0 41.0 80-84 38.58555 41.0 41.0 41.0 32.0 41.0 85-89 38.525549999999996 41.0 39.4 41.0 32.0 41.0 90-94 38.445350000000005 41.0 37.8 41.0 32.0 41.0 95-99 38.18515 41.0 37.0 41.0 32.0 41.0 100-104 37.9857 41.0 37.0 41.0 32.0 41.0 105-109 37.60045 41.0 37.0 41.0 30.0 41.0 110-114 37.30745 41.0 37.0 41.0 28.0 41.0 115-119 36.93235 41.0 37.0 41.0 27.0 41.0 120-124 36.5007 41.0 37.0 41.0 27.0 41.0 125-129 36.045750000000005 41.0 36.0 41.0 22.0 41.0 130-134 35.59095 41.0 33.0 41.0 22.0 41.0 135-139 35.2518 41.0 32.0 41.0 22.0 41.0 140-144 34.6826 40.2 32.0 41.0 20.0 41.0 145-149 34.427 39.4 32.0 41.0 20.0 41.0 150 33.907 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 11.0 23 18.0 24 30.0 25 49.0 26 46.0 27 47.0 28 57.0 29 64.0 30 76.0 31 82.0 32 115.0 33 103.0 34 148.0 35 124.0 36 180.0 37 286.0 38 368.0 39 792.0 40 1403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.802781289506953 26.71723556679309 17.024863042562156 40.4551201011378 2 18.875 23.225 42.625 15.275 3 17.925 26.5 31.674999999999997 23.9 4 20.525 24.7 30.675 24.099999999999998 5 27.224999999999998 23.575 26.974999999999998 22.225 6 22.075 24.099999999999998 31.5 22.325 7 25.8 26.075 28.175 19.950000000000003 8 19.25 22.275 36.0 22.475 9 22.650000000000002 21.95 32.875 22.525000000000002 10-14 23.871193559677984 25.616280814040703 27.11135556777839 23.401170058502927 15-19 24.169999999999998 24.91 26.0 24.92 20-24 24.26621331066553 24.601230061503074 26.761338066903345 24.371218560928046 25-29 23.849999999999998 25.27 26.619999999999997 24.26 30-34 24.626231311565576 25.216260813040652 25.691284564228212 24.466223311165557 35-39 24.601230061503074 25.061253062653133 25.791289564478227 24.546227311365566 40-44 24.8162408120406 25.456272813640684 25.19625981299065 24.53122656132807 45-49 24.462446244624463 25.837583758375835 25.557555755575557 24.14241424142414 50-54 24.335 25.224999999999998 25.86 24.58 55-59 24.72 24.795 25.5 24.985 60-64 24.654999999999998 24.725 25.88 24.740000000000002 65-69 24.281214060703036 25.44627231361568 25.83129156457823 24.441222061103055 70-74 23.845 25.355 25.89 24.91 75-79 24.58 25.580000000000002 25.31 24.529999999999998 80-84 25.22 25.5 25.019999999999996 24.26 85-89 24.779999999999998 25.785000000000004 25.624999999999996 23.810000000000002 90-94 24.845 25.695 25.72 23.74 95-99 24.34 25.47 25.240000000000002 24.95 100-104 25.174999999999997 25.069999999999997 25.490000000000002 24.265 105-109 24.45 25.174999999999997 25.430000000000003 24.945 110-114 24.39 24.925 26.005 24.68 115-119 24.88 25.245 25.435000000000002 24.44 120-124 24.765 25.259999999999998 25.35 24.625 125-129 25.295 24.855 25.374999999999996 24.474999999999998 130-134 25.205 25.080000000000002 25.785000000000004 23.93 135-139 24.9 26.279999999999998 25.330000000000002 23.49 140-144 25.15 26.715 24.09 24.044999999999998 145-149 25.775 27.18 23.61 23.435 150 25.374999999999996 25.75 25.224999999999998 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.5 18 2.5 19 2.5 20 1.5 21 3.5 22 4.0 23 3.5 24 5.0 25 7.5 26 8.0 27 6.5 28 7.0 29 8.5 30 13.5 31 18.5 32 22.0 33 26.0 34 31.5 35 47.5 36 60.0 37 64.5 38 66.5 39 79.0 40 105.5 41 136.5 42 176.5 43 182.5 44 189.5 45 205.5 46 189.5 47 186.0 48 196.5 49 186.0 50 169.5 51 160.0 52 148.5 53 144.5 54 127.0 55 116.0 56 117.5 57 109.0 58 102.0 59 94.5 60 76.0 61 56.0 62 49.5 63 51.0 64 42.0 65 26.5 66 23.5 67 27.0 68 20.5 69 15.0 70 14.5 71 9.5 72 10.5 73 9.5 74 5.0 75 5.0 76 7.0 77 7.0 78 4.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 40.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.005 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.47691472026072 85.125 2 6.5453557848995105 12.049999999999999 3 0.8690928843020097 2.4 4 0.08147745790331341 0.3 5 0.027159152634437803 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 35 0.0037449617 20.510714 140-144 >>END_MODULE Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324377 spots for SRR13857050.sra Written 1324377 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra Read 1324362 spots for SRR13857050.sra Written 1324362 spots for SRR13857050.sra SRR ids: ['SRR13857050.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9p_du9lu SRR13857050.sra spots: 26487255 blocks: [[1, 1324362], [1324363, 2648724], [2648725, 3973086], [3973087, 5297448], [5297449, 6621810], [6621811, 7946172], [7946173, 9270534], [9270535, 10594896], [10594897, 11919258], [11919259, 13243620], [13243621, 14567982], [14567983, 15892344], [15892345, 17216706], [17216707, 18541068], [18541069, 19865430], [19865431, 21189792], [21189793, 22514154], [22514155, 23838516], [23838517, 25162878], [25162879, 26487255]] SRR13857050 file size 8928094 SRR13857050 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857050 SRR13857050_1.fastq SRR13857050_2.fastq Input file: SRR13857050_1.fastq Paired file: SRR13857050_2.fastq trimmed: SRR13857050-trimmed-pair1.fastq, SRR13857050-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:03:20 2025 >> started Tue Feb 11 22:03:55 2025 >> done (34.177s) 26487255 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 25 ( 0.00%) empty read pairs filtered out after trimming by size control 26487216 (100.00%) read pairs available; of these: 3643328 (13.76%) trimmed read pairs available after processing 22843888 (86.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 9 0.00% 22 15 0.00% 23 16 0.00% 24 17 0.00% 25 21 0.00% 26 17 0.00% 27 24 0.00% 28 13 0.00% 29 15 0.00% 30 26 0.00% 31 17 0.00% 32 20 0.00% 33 17 0.00% 34 25 0.00% 35 17 0.00% 36 22 0.00% 37 32 0.00% 38 16 0.00% 39 24 0.00% 40 25 0.00% 41 44 0.00% 42 12 0.00% 43 26 0.00% 44 28 0.00% 45 38 0.00% 46 30 0.00% 47 47 0.00% 48 33 0.00% 49 44 0.00% 50 41 0.00% 51 47 0.00% 52 52 0.00% 53 46 0.00% 54 34 0.00% 55 63 0.00% 56 44 0.00% 57 67 0.00% 58 47 0.00% 59 60 0.00% 60 42 0.00% 61 77 0.00% 62 64 0.00% 63 102 0.00% 64 54 0.00% 65 88 0.00% 66 87 0.00% 67 121 0.00% 68 83 0.00% 69 75 0.00% 70 76 0.00% 71 79 0.00% 72 259 0.00% 73 90 0.00% 74 78 0.00% 75 79 0.00% 76 58 0.00% 77 74 0.00% 78 53 0.00% 79 78 0.00% 80 48 0.00% 81 59 0.00% 82 70 0.00% 83 84 0.00% 84 64 0.00% 85 70 0.00% 86 58 0.00% 87 81 0.00% 88 72 0.00% 89 66 0.00% 90 65 0.00% 91 96 0.00% 92 69 0.00% 93 58 0.00% 94 45 0.00% 95 59 0.00% 96 71 0.00% 97 70 0.00% 98 65 0.00% 99 78 0.00% 100 56 0.00% 101 60 0.00% 102 48 0.00% 103 54 0.00% 104 72 0.00% 105 74 0.00% 106 78 0.00% 107 44 0.00% 108 94 0.00% 109 70 0.00% 110 85 0.00% 111 106 0.00% 112 85 0.00% 113 79 0.00% 114 105 0.00% 115 96 0.00% 116 113 0.00% 117 117 0.00% 118 149 0.00% 119 156 0.00% 120 156 0.00% 121 178 0.00% 122 195 0.00% 123 192 0.00% 124 249 0.00% 125 221 0.00% 126 266 0.00% 127 212 0.00% 128 276 0.00% 129 276 0.00% 130 283 0.00% 131 251 0.00% 132 285 0.00% 133 1358 0.01% 134 150223 0.57% 135 158627 0.60% 136 162525 0.61% 137 166294 0.63% 138 172006 0.65% 139 175164 0.66% 140 178626 0.67% 141 184162 0.70% 142 187658 0.71% 143 193055 0.73% 144 196047 0.74% 145 201446 0.76% 146 204680 0.77% 147 213344 0.81% 148 250961 0.95% 149 838094 3.16% 150 22843888 86.24% 26487216 reads passed initial QC criterion=sequence-density sequence-density=2.54 sequence-density-rank=1 fanout-score=1.08 fanout-score-rank=40 prefix-density=0.74 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=41 fanout-score=97.58 fanout-score-rank=1 prefix-density=1.62 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=3.97 sequence-density-rank=1 fanout-score=1.41 fanout-score-rank=47 prefix-density=3.47 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=46 fanout-score=77.95 fanout-score-rank=1 prefix-density=1.60 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857050 SRR13857050_1.fastq SRR13857050_2.fastq Input file: SRR13857050_1.fastq Paired file: SRR13857050_2.fastq trimmed: SRR13857050-trimmed-pair1.fastq, SRR13857050-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:06:10 2025 >> started Tue Feb 11 22:06:22 2025 >> done (12.025s) 13243608 read pairs processed; of these: 96495 ( 0.73%) short read pairs filtered out after trimming by size control 43666 ( 0.33%) empty read pairs filtered out after trimming by size control 13103447 (98.94%) read pairs available; of these: 1499 ( 0.01%) trimmed read pairs available after processing 13101948 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 8 0.00% 22 6 0.00% 23 7 0.00% 24 6 0.00% 25 10 0.00% 26 8 0.00% 27 15 0.00% 28 8 0.00% 29 4 0.00% 30 15 0.00% 31 6 0.00% 32 10 0.00% 33 8 0.00% 34 13 0.00% 35 10 0.00% 36 10 0.00% 37 12 0.00% 38 7 0.00% 39 11 0.00% 40 15 0.00% 41 25 0.00% 42 9 0.00% 43 8 0.00% 44 13 0.00% 45 17 0.00% 46 7 0.00% 47 29 0.00% 48 20 0.00% 49 20 0.00% 50 17 0.00% 51 27 0.00% 52 25 0.00% 53 24 0.00% 54 18 0.00% 55 33 0.00% 56 19 0.00% 57 32 0.00% 58 26 0.00% 59 43 0.00% 60 20 0.00% 61 40 0.00% 62 25 0.00% 63 44 0.00% 64 30 0.00% 65 48 0.00% 66 49 0.00% 67 63 0.00% 68 46 0.00% 69 44 0.00% 70 42 0.00% 71 46 0.00% 72 121 0.00% 73 48 0.00% 74 36 0.00% 75 30 0.00% 76 30 0.00% 77 40 0.00% 78 29 0.00% 79 31 0.00% 80 22 0.00% 81 20 0.00% 82 35 0.00% 83 43 0.00% 84 29 0.00% 85 25 0.00% 86 31 0.00% 87 49 0.00% 88 44 0.00% 89 36 0.00% 90 33 0.00% 91 45 0.00% 92 35 0.00% 93 21 0.00% 94 22 0.00% 95 29 0.00% 96 27 0.00% 97 43 0.00% 98 23 0.00% 99 49 0.00% 100 24 0.00% 101 29 0.00% 102 28 0.00% 103 25 0.00% 104 35 0.00% 105 32 0.00% 106 41 0.00% 107 24 0.00% 108 47 0.00% 109 42 0.00% 110 44 0.00% 111 59 0.00% 112 44 0.00% 113 45 0.00% 114 46 0.00% 115 48 0.00% 116 52 0.00% 117 61 0.00% 118 79 0.00% 119 77 0.00% 120 75 0.00% 121 94 0.00% 122 99 0.00% 123 97 0.00% 124 124 0.00% 125 110 0.00% 126 132 0.00% 127 104 0.00% 128 127 0.00% 129 138 0.00% 130 118 0.00% 131 122 0.00% 132 163 0.00% 133 696 0.01% 134 74268 0.57% 135 78392 0.60% 136 80317 0.61% 137 82722 0.63% 138 85441 0.65% 139 86979 0.66% 140 88206 0.67% 141 91137 0.70% 142 92785 0.71% 143 95482 0.73% 144 97111 0.74% 145 99374 0.76% 146 102150 0.78% 147 105958 0.81% 148 124641 0.95% 149 413810 3.16% 150 11299460 86.23% criterion=sequence-density sequence-density=2.10 sequence-density-rank=1 fanout-score=1.11 fanout-score-rank=42 prefix-density=0.73 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=95.34 fanout-score-rank=1 prefix-density=1.62 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=3.41 sequence-density-rank=1 fanout-score=1.44 fanout-score-rank=46 prefix-density=3.45 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=46 fanout-score=75.35 fanout-score-rank=1 prefix-density=1.58 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR13857050 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 22:27:32 Started mapping on | Feb 11 22:27:33 Finished on | Feb 11 22:36:21 Mapping speed, Million of reads per hour | 179.64 Number of input reads | 26346710 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 8852219 Uniquely mapped reads % | 33.60% Average mapped length | 270.09 Number of splices: Total | 3541650 Number of splices: Annotated (sjdb) | 3401135 Number of splices: GT/AG | 3430465 Number of splices: GC/AG | 49213 Number of splices: AT/AC | 5397 Number of splices: Non-canonical | 56575 Mismatch rate per base, % | 0.62% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 3.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576611 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 11362747 % of reads mapped to too many loci | 43.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.60% % of reads unmapped: other | 7.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16917891 16917891 16917891 N_multimapping 576611 576611 576611 N_noFeature 3538511 6211848 6113401 N_ambiguous 146454 40732 40561 UnstrandedReadsAssigned:5167254 PositiveStrandReadsAssigned:2599639 NegativeStrandReadsAssigned:2698257 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857050 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857050-trimmed-pair1.fastq SRR13857050-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,346,710 reads, 19,758,784 reads pseudoaligned [quant] estimated average fragment length: 175.133 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR13857050.ke.tsv 34699 SRR13857050.se.tsv 87100 total ==> SRR13857050.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1843.87 582 10.8665 Potri.005G024800.1.v4.1 1035 860.867 57 2.27948 Potri.004G059700.1.v4.1 961 786.867 43 1.88132 Potri.007G009000.2.v4.1 1416 1241.87 0 0 Potri.003G141000.2.v4.1 2943 2768.87 135.225 1.68132 Potri.016G087400.1.v4.1 270 104.646 229 75.3374 Potri.015G069301.1.v4.1 564 389.985 0 0 Potri.010G195200.1.v4.1 1773 1598.87 2 0.043064 Potri.012G127500.1.v4.1 977 802.867 40 1.71519 ==> SRR13857050.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 78 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857050 completed mapping pipeline successfully